ID: 918227181

View in Genome Browser
Species Human (GRCh38)
Location 1:182494621-182494643
Sequence TCTCTGATACTGATGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918227176_918227181 23 Left 918227176 1:182494575-182494597 CCTACAGAACCTAAAGGTATAAA 0: 1
1: 0
2: 1
3: 33
4: 248
Right 918227181 1:182494621-182494643 TCTCTGATACTGATGGTAAATGG 0: 1
1: 0
2: 0
3: 14
4: 166
918227177_918227181 14 Left 918227177 1:182494584-182494606 CCTAAAGGTATAAAGATGACAAA 0: 1
1: 0
2: 1
3: 53
4: 529
Right 918227181 1:182494621-182494643 TCTCTGATACTGATGGTAAATGG 0: 1
1: 0
2: 0
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918227181 Original CRISPR TCTCTGATACTGATGGTAAA TGG Intronic
900657296 1:3765155-3765177 TCTGTGATGCTGAAGGAAAATGG - Intronic
902924910 1:19689721-19689743 TCTCTGATTCTTCTGGCAAAGGG + Intronic
904676139 1:32200421-32200443 TCTCTGAAACTGCCGGGAAAGGG + Exonic
906836834 1:49092635-49092657 AGTCTGATAATGATGGTAGAAGG - Intronic
908333955 1:63100755-63100777 TTTCTGATAATGATAGTAAATGG + Intergenic
909459524 1:75894043-75894065 TTTCTCATAGTCATGGTAAAAGG - Intronic
910282299 1:85514568-85514590 ACTCTGACATTGATAGTAAAAGG - Intronic
910862155 1:91752411-91752433 TCTCTGATTTTAATGATAAATGG + Intronic
911532406 1:99060206-99060228 TCTCTCATATTGATGTTACAAGG - Intergenic
912748089 1:112262641-112262663 TCTCTGATGGTGATGGTTTATGG - Intergenic
913220012 1:116652096-116652118 TTTCTGATACTGATGATATAAGG + Intronic
914207791 1:145549324-145549346 ACTCTGACATTGATAGTAAAAGG + Intergenic
916241633 1:162645867-162645889 TCCCTGATTCTGTTAGTAAATGG - Intronic
916522797 1:165580354-165580376 ACTCTGATGCAGATGGTACATGG - Intergenic
916541470 1:165759734-165759756 TCATAGCTACTGATGGTAAAAGG + Intronic
917091571 1:171358773-171358795 TCGCTCATACTAATGCTAAATGG - Intergenic
917588170 1:176449610-176449632 TATCTGATATTGATAATAAAGGG - Intergenic
918227181 1:182494621-182494643 TCTCTGATACTGATGGTAAATGG + Intronic
919128429 1:193425217-193425239 ATTCTGATACTGGTGGTATAGGG - Intergenic
920063254 1:203243968-203243990 TCTCTGATACTAATGTAAAATGG - Intronic
920884363 1:209912201-209912223 TCAATGAAAATGATGGTAAATGG - Intergenic
921694968 1:218198554-218198576 TCTCTGGCTCTGAGGGTAAAAGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922588986 1:226758848-226758870 TCACAGATAGTTATGGTAAAAGG - Intergenic
922665829 1:227467801-227467823 TCTCTGATAGGGATGGAAAGGGG + Intergenic
923977288 1:239277495-239277517 TCTCTGACACTGAGGGTCAGAGG + Intergenic
1063737791 10:8780404-8780426 TATCTAATAGTGATGGAAAATGG - Intergenic
1068127818 10:52863524-52863546 GCTTTGATATTGCTGGTAAAAGG - Intergenic
1069490798 10:68858806-68858828 TCTCTCCTACTGATGGAAGAGGG - Intronic
1071022251 10:81071240-81071262 TCTCTGTTACTGAGGGTTCATGG - Intergenic
1071429683 10:85596981-85597003 TCACTGATACGGATGATAATGGG + Intergenic
1072076918 10:91985593-91985615 TCTCACATACTGATGGTCAGAGG - Intronic
1072566796 10:96623129-96623151 AGTCTTGTACTGATGGTAAAGGG - Intronic
1075139340 10:119817885-119817907 TCTCTGGTACAGATTTTAAAGGG - Intronic
1075426806 10:122348285-122348307 TCGCTGTTGCTGGTGGTAAAGGG + Intergenic
1076308266 10:129480742-129480764 TATCTGCTGCTGATGATAAAAGG - Intronic
1077844863 11:6013313-6013335 GCTGTGATCCTGATGGTCAAGGG + Intergenic
1078239413 11:9516642-9516664 TATCTGATAATGATGATAATAGG - Intronic
1079671892 11:23181119-23181141 TATCTTAGACTGCTGGTAAAAGG + Intergenic
1080931695 11:36817986-36818008 TCTCTGATTCTGATGCTTAGTGG - Intergenic
1085815275 11:79730803-79730825 TCTCTGATCCACATGGAAAAGGG - Intergenic
1087182562 11:95154260-95154282 GCTTTGATAGTGATTGTAAATGG - Intergenic
1087220150 11:95538348-95538370 TGTCAGATAATGAAGGTAAAGGG - Intergenic
1093575832 12:20728801-20728823 TCCTTGATACTGATGTAAAAAGG - Intronic
1093758477 12:22879081-22879103 TCACTGCTACTGATGTTAATGGG - Intergenic
1095325092 12:40880638-40880660 TCTCTGACACTTATTGTCAAAGG - Intronic
1100175248 12:92023080-92023102 TCTCTGAAGGTGAGGGTAAAGGG + Intronic
1101027827 12:100630931-100630953 TTTCTGATGCTTAGGGTAAACGG - Intergenic
1103249098 12:119484789-119484811 TTTCAGTTACTGATGGAAAATGG - Intronic
1106710522 13:32326670-32326692 TCTCTAATACTTCTGTTAAAAGG + Intronic
1106792944 13:33174532-33174554 TCTCTTAGCCTCATGGTAAAGGG - Intronic
1107163563 13:37259752-37259774 TCTCTGACACTGAAGGGTAAAGG - Intergenic
1107408307 13:40135841-40135863 TAGCTGATACTGATCTTAAATGG - Intergenic
1109282413 13:60372277-60372299 TCTCTGACCCTGAAGGCAAATGG + Intergenic
1109912033 13:68925151-68925173 TCTATGATAATGAGAGTAAAAGG + Intergenic
1113449167 13:110394299-110394321 TCTCTGCTCCTCATGTTAAAGGG - Intronic
1115460711 14:33657530-33657552 TTTTTGATACTGAAGGAAAAAGG + Intronic
1120110178 14:80545059-80545081 ATTCTGAGAATGATGGTAAAAGG - Intronic
1124286078 15:28401391-28401413 GTTCTGATTCTGATGGGAAAGGG - Intergenic
1124296623 15:28510269-28510291 GTTCTGATTCTGATGGGAAATGG + Intergenic
1125417056 15:39465118-39465140 TGTCTGGTACAGATGGTGAAAGG - Intergenic
1125757130 15:42071602-42071624 CCTCAGGTACTGATGGAAAATGG + Intronic
1126520550 15:49589234-49589256 TATCTGAAACTGAAAGTAAAAGG - Intronic
1130181446 15:81633350-81633372 TCTCTGATTATTAGGGTAAATGG + Intergenic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1132631150 16:918105-918127 TCTCTGAAAGTGCTGGTTAAGGG + Intronic
1137494261 16:48957656-48957678 TCTCTGATTGTGTTGGAAAAGGG + Intergenic
1137787111 16:51149196-51149218 TTCCTGATACTGAAGGCAAAAGG + Intronic
1137884857 16:52092249-52092271 GCTCTGATGCTGGTGTTAAATGG - Intergenic
1139043771 16:63032082-63032104 TCTCTGGAAATGATGGTAAGTGG - Intergenic
1141926529 16:87173840-87173862 CCTATGATCCTGAGGGTAAAAGG - Intronic
1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG + Intronic
1144022536 17:11250182-11250204 AGTTTGATACTGAGGGTAAAAGG + Intronic
1145746255 17:27322188-27322210 TGTCTGATACAGCTGGTAGAAGG - Intergenic
1155986640 18:32237370-32237392 TGTTTGTTACTGATGGTACAGGG - Intronic
1158287536 18:55900997-55901019 TCTCTGTTTCTGATGGAAAAAGG - Intergenic
1158357928 18:56640827-56640849 TCTAGGATTGTGATGGTAAAAGG + Intronic
1159835967 18:73335859-73335881 TCTCTGATACTAAGGTAAAATGG + Intergenic
1167833900 19:52050492-52050514 TCACTGTTACTGTTGTTAAAAGG + Intronic
928059990 2:28102251-28102273 TCTCTGGTATTGAGGGAAAAAGG - Intronic
928307195 2:30179888-30179910 TCCCTGGTACTCATGGTAGATGG - Intergenic
935344669 2:102095219-102095241 TATGTGATAGTGATGGGAAAAGG + Intronic
936643659 2:114344644-114344666 GCTCTGATCCAGATAGTAAAAGG + Intergenic
937133404 2:119530428-119530450 TCACTGACACTGATGTTGAAAGG + Intergenic
938634943 2:133213532-133213554 TCTCTCACTCTGATGGCAAATGG + Intronic
939109240 2:137987638-137987660 TCTCTTATACTGATGGCTTATGG + Intronic
939951758 2:148483654-148483676 TCTGTGTTAATGAGGGTAAAGGG - Intronic
940062085 2:149583456-149583478 TATTTGACACAGATGGTAAAGGG + Intronic
946611153 2:221459264-221459286 TCTCTGTTAGGGATGGTAACAGG + Intronic
947360403 2:229340247-229340269 TCTCTGACACTCATGGAGAATGG - Intergenic
1171008091 20:21487843-21487865 TCTCTGAAGCTGATTATAAAAGG - Intergenic
1171727916 20:28642767-28642789 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1176314490 21:5229299-5229321 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1178527045 21:33339580-33339602 TCTCTGCTACTTATGGTCAATGG + Intronic
1180392278 22:12295273-12295295 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1180407467 22:12569499-12569521 TCTGTGATACAGAAGGGAAAAGG - Intergenic
1180821307 22:18830117-18830139 TTTCTGATACTGATGATATAAGG + Intergenic
1180860100 22:19073912-19073934 TCTCCCACACTGATGGTGAACGG + Intronic
1181191671 22:21145928-21145950 TTTCTGATACTGATGATATAAGG - Intergenic
1181207526 22:21264582-21264604 TTTCTGATACTGATGATATAAGG + Intergenic
1181825384 22:25511136-25511158 ATTCTGATACTGATGGTCCAGGG + Intergenic
1183852421 22:40601848-40601870 CCTCTGATTGTGATGGGAAAGGG - Intronic
1203219393 22_KI270731v1_random:30834-30856 TTTCTGATACTGATGATATAAGG - Intergenic
1203271432 22_KI270734v1_random:55993-56015 TTTCTGATACTGATGATATAAGG + Intergenic
953645358 3:44748667-44748689 GTTCTGATGCTGATGGTACAGGG + Intronic
956156427 3:66303231-66303253 TCTCTGATACTGTAGTAAAATGG - Intronic
956635298 3:71358189-71358211 TCTCAGATTCTGATGATTAAAGG + Intronic
957615056 3:82516498-82516520 CTTCTGATAATGATGGAAAAGGG + Intergenic
957811744 3:85230685-85230707 TCTCAGATACTGCTTGTATAAGG + Intronic
959332579 3:105024321-105024343 TCACTGAGAGTGACGGTAAATGG - Intergenic
960097021 3:113698700-113698722 TATCTGAAACTGATGTTGAATGG - Intergenic
964626889 3:158768356-158768378 TCTCAGTTACTGATGGACAATGG + Intronic
964926090 3:161959841-161959863 TTTCTGAAACTGTTGGAAAATGG + Intergenic
965123617 3:164595513-164595535 CCTCTGACAGTGATGGCAAAGGG + Intergenic
965606178 3:170499632-170499654 TCTTTGAAAATGATGGTAAGAGG + Intronic
969602497 4:8184723-8184745 TCTGTGAAACTGAAGGCAAAAGG - Intronic
972249363 4:37283564-37283586 TCACTGATACTAACGGTACAAGG - Intronic
973302166 4:48598848-48598870 TTTCTGATACTGTTGTTAGATGG + Intronic
975615020 4:76237495-76237517 TCTGTGATACTAATGATACATGG - Intronic
975786927 4:77900622-77900644 TATCAGATACTGGTGGTCAATGG + Intronic
975836804 4:78431179-78431201 TCTTTGCTACTGATGGTAGATGG + Intronic
976802808 4:89011412-89011434 TATCTGATACAGATGGTTATAGG + Intronic
977913531 4:102564674-102564696 TCTCTGGTACTGAAGGAAAGAGG - Intronic
978343930 4:107746132-107746154 TCTATGAGACTAAAGGTAAAAGG + Intergenic
978671765 4:111256681-111256703 TCTCTGTTACTAATGGTACCAGG + Intergenic
978775454 4:112501719-112501741 TAAATGATACTGATGGTTAATGG - Intergenic
980340495 4:131539220-131539242 TGTGTGATACTGATTTTAAATGG - Intergenic
981803297 4:148682918-148682940 TTTCTGATATTGGTGGAAAAAGG + Intergenic
982183268 4:152769582-152769604 CCTCAGATTTTGATGGTAAAGGG + Exonic
984054732 4:174913332-174913354 TCTCTGAGTGTGAGGGTAAAAGG - Intronic
985230294 4:187809025-187809047 TCTTTGATAATGCAGGTAAATGG - Intergenic
985432624 4:189896099-189896121 TCTGTGATACAGAAGGGAAAAGG - Intergenic
988098144 5:26644173-26644195 TCTCTAATTCTGATTTTAAAAGG - Intergenic
988233722 5:28511051-28511073 TCTATGATACTGATGTTACCAGG + Intergenic
992327166 5:75671982-75672004 TGTCTCATACTGATTATAAATGG + Intergenic
997839435 5:137225758-137225780 TGTCTAATACTGCTGGTACAGGG + Intronic
1000242588 5:159422473-159422495 TCCTTGGTAGTGATGGTAAAAGG + Intergenic
1003125849 6:3355498-3355520 TCTCTTATACACATGGTAAGAGG - Intronic
1005961545 6:30697264-30697286 CCTCTGATCCTGATGACAAACGG + Intergenic
1007176455 6:39901126-39901148 TCTCTGATCCTGATGATGATGGG + Intronic
1011467327 6:87671771-87671793 TCTCTGTTACTCTTAGTAAAAGG - Intergenic
1012649027 6:101729214-101729236 TCCATGTTACTGATGCTAAATGG - Intronic
1015805148 6:137101218-137101240 CATCTGACACTGATGTTAAAAGG + Intergenic
1016657325 6:146536303-146536325 TCTATAATACTGAAGATAAAAGG + Intergenic
1017335471 6:153253715-153253737 TCTCTGAACCTTATGATAAATGG - Intergenic
1024585991 7:50842614-50842636 TCTCTGAAACTGATGGGGAAGGG + Intergenic
1026393147 7:69922885-69922907 TTTCTTATACTTATAGTAAAGGG + Intronic
1030952585 7:115810108-115810130 TTTCTGATAGTGCTGTTAAATGG + Intergenic
1031200114 7:118671539-118671561 TCTCTGAAAAAGAAGGTAAAGGG - Intergenic
1031646488 7:124232211-124232233 TCTCTCATACTGATGTTTATTGG + Intergenic
1031646912 7:124237235-124237257 TCTCTCATACTGATGTTTATTGG + Intergenic
1031647330 7:124242231-124242253 TCTCTCATACTGATGTTTATTGG + Intergenic
1031801240 7:126248602-126248624 TTTCTTATACTGATTGTAAATGG + Intergenic
1032851208 7:135797220-135797242 TCTTTGATTCTGATGTTCAAAGG - Intergenic
1032887191 7:136153353-136153375 GACCTGAGACTGATGGTAAAGGG + Intergenic
1033975962 7:147101116-147101138 TATGTGCTCCTGATGGTAAACGG - Intronic
1034044470 7:147913221-147913243 TCTCTCATACTGCTGGCACAAGG + Intronic
1039287704 8:36060861-36060883 TCTATGATATTGAGGGAAAATGG + Intergenic
1039608947 8:38903928-38903950 TCACTGAGACAGATGGAAAACGG - Intronic
1042389771 8:68220489-68220511 GCTTTGATACTGAAGGTAAGGGG - Intronic
1044563306 8:93635785-93635807 TTTCTGATTCTGATGGCAAGTGG - Intergenic
1046126415 8:109914387-109914409 TCAGTGAGAATGATGGTAAAAGG + Intergenic
1046326127 8:112649005-112649027 TCTCTGAAACTGAAGATACAGGG + Intronic
1046649139 8:116817873-116817895 TCTGTGAAACTGTTAGTAAAAGG + Intronic
1048040400 8:130722167-130722189 TATTGGAAACTGATGGTAAAGGG - Intergenic
1060444533 9:123675754-123675776 TCTCTTACATTGCTGGTAAAGGG + Intronic
1060968246 9:127723497-127723519 TCTCTGTTACTGCTGGAAGAGGG + Intronic
1061494033 9:130961526-130961548 ACTCTGATCCTGAAGGGAAATGG + Intergenic
1203421066 Un_KI270448v1:6577-6599 TCTGTGATACAGAAGGGAAATGG - Intergenic
1203421637 Un_KI270521v1:6092-6114 TCTGTGATACAGAAGGGAAAAGG - Intergenic
1187377664 X:18770444-18770466 TCTCTGAAAGTGATTCTAAAAGG - Intronic
1188279519 X:28247411-28247433 TCTCTGAAACTGATGAAAATGGG - Intergenic
1189201763 X:39202330-39202352 TCTCTGATCCTGATAATAATTGG - Intergenic
1189273449 X:39767944-39767966 TCTGTGATGCTGATGGAAAATGG - Intergenic
1190439035 X:50458349-50458371 TCTATAATACTGAAGATAAAAGG + Intronic
1193159561 X:78213511-78213533 TCTCGCACACTGATGGTCAAAGG + Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1195396380 X:104414867-104414889 TCAATAATATTGATGGTAAATGG + Intergenic
1196732362 X:118953662-118953684 TCTTTAATACTGATGACAAAGGG + Intergenic
1199267784 X:145848444-145848466 TCTGTGACACAGCTGGTAAATGG + Intergenic
1199945823 X:152666176-152666198 TCTTTGTTACTGTTGGGAAATGG - Intergenic