ID: 918227451

View in Genome Browser
Species Human (GRCh38)
Location 1:182497168-182497190
Sequence GAAGCAGTTCACATTGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918227451_918227452 -3 Left 918227451 1:182497168-182497190 CCTACATCAATGTGAACTGCTTC 0: 1
1: 0
2: 3
3: 12
4: 175
Right 918227452 1:182497188-182497210 TTCTTGTCCTTCTTTATGATAGG 0: 1
1: 0
2: 5
3: 26
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918227451 Original CRISPR GAAGCAGTTCACATTGATGT AGG (reversed) Intronic
900769548 1:4529661-4529683 CAAGCAGATCACATAGCTGTGGG - Intergenic
900964694 1:5949819-5949841 GAAGCAGCACACAGTGAAGTAGG + Intronic
901346629 1:8550101-8550123 GAAGAAGTTCACATTGTGGGAGG + Intronic
903503307 1:23814342-23814364 AAAGGAGTTCACCTGGATGTTGG - Intronic
908634886 1:66152688-66152710 GAACCAGCTCACATAGTTGTGGG + Intronic
909742277 1:79045306-79045328 GAATCAGATCACATACATGTGGG + Intergenic
910043389 1:82882220-82882242 GATGAAGATAACATTGATGTTGG - Intergenic
912030765 1:105240526-105240548 GAAGCAGTACATATTTAAGTAGG - Intergenic
912890905 1:113529458-113529480 GACGCTGTTCCCATTGATGCAGG + Intronic
915216719 1:154345318-154345340 GCAGCGGCTCACATTGGTGTGGG + Exonic
915858946 1:159421991-159422013 CAAGCAGTCCACGGTGATGTTGG + Intergenic
916389651 1:164317832-164317854 CAAGGATTTCACATTGTTGTCGG + Intergenic
916476070 1:165170133-165170155 GAAGGAGGTGACATTGATTTTGG - Intergenic
918227451 1:182497168-182497190 GAAGCAGTTCACATTGATGTAGG - Intronic
918867583 1:189922497-189922519 GAATCTGTTGACCTTGATGTTGG + Intergenic
919260530 1:195187999-195188021 AAACCAGTTCACATTAAGGTAGG - Intergenic
919458033 1:197843127-197843149 GAAGAAGGTCACATTGATAAGGG - Intergenic
919739635 1:200974010-200974032 GAAGCAGCTCAGATCGAAGTGGG + Exonic
921789561 1:219274240-219274262 GAAGGAAATCACACTGATGTAGG + Intergenic
923776504 1:236983421-236983443 GGAGAAGTTGAGATTGATGTAGG - Intergenic
1064039854 10:11951820-11951842 GAAGCAGGTGACAGTGATGGGGG - Intronic
1065759766 10:28971215-28971237 GCAGCAGTTAACGATGATGTTGG - Intergenic
1066785325 10:38997357-38997379 AAAGTAGTACACATTGATTTAGG - Intergenic
1068971525 10:62963275-62963297 GATTAAGTTCACATTAATGTAGG + Intergenic
1069012218 10:63386702-63386724 CAAGCATTTCACTTTGGTGTTGG - Intronic
1069458589 10:68573454-68573476 CAGGAAGTTCCCATTGATGTGGG - Exonic
1070479450 10:76868050-76868072 AAAGCAGTTAACATTGATTCTGG + Intergenic
1077221309 11:1418732-1418754 GCAGCAGTTCAGACTGAAGTAGG + Intronic
1077744722 11:4889945-4889967 GAAGAAGTTGACAGTGTTGTCGG + Intronic
1078010198 11:7567338-7567360 AAGGCAGTTGACATTGTTGTTGG + Intronic
1078798803 11:14622279-14622301 GAAACAGTTCACATTCCTGTGGG + Intronic
1079242962 11:18733559-18733581 GATGTAGTTGGCATTGATGTAGG + Exonic
1080466244 11:32500064-32500086 GAGGCAGTTCACTTTGAAGCTGG + Intergenic
1083609520 11:63998386-63998408 GCAGCAGTTCACATTTATTGAGG - Exonic
1085067142 11:73507316-73507338 GAACCACTTCACATTGTTTTTGG - Intronic
1086603655 11:88666708-88666730 GAAGCAGTTTCCATTTTTGTTGG - Intronic
1087078965 11:94151621-94151643 GAAGCATTTCACACTGATGCGGG + Intronic
1092473328 12:8797273-8797295 GAAATAGTTCACATCCATGTGGG - Intergenic
1092919675 12:13220106-13220128 TAAGCATTTGACATTGATGTGGG + Intergenic
1096575332 12:52549191-52549213 GAATCAGTTCACCTTGAGGGGGG + Intronic
1097365947 12:58712703-58712725 GTAGCATTTCACATTTATGAGGG + Intronic
1097885380 12:64723816-64723838 GAAGCAGTGCACAGTGAGGGTGG + Intronic
1101547798 12:105733032-105733054 GATGCAGTTCCCAATGATTTGGG + Intergenic
1102145263 12:110650549-110650571 GAACCTGTTCACAATCATGTGGG + Intronic
1109171580 13:59104638-59104660 GAATCAGTTCACATTTAAGATGG - Intergenic
1109686336 13:65824759-65824781 CAAACAGTACACATGGATGTAGG - Intergenic
1110658570 13:78030445-78030467 GCAGCAGGTCACATTGGGGTAGG + Intergenic
1110662309 13:78071639-78071661 GAAGGAGTTGACATTGAAATGGG + Intergenic
1111032667 13:82625326-82625348 AAAGCAATTCACATTAATGATGG + Intergenic
1111942629 13:94628039-94628061 GAAGCATTTCACATAAATGTTGG + Exonic
1112907142 13:104437076-104437098 GAAGCAGTAGCCATTGATTTAGG + Intergenic
1113094407 13:106648615-106648637 GACCCAGTTTACTTTGATGTGGG + Intergenic
1113405185 13:110032219-110032241 GAAGAAGCTCACATAGTTGTGGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1116002202 14:39256187-39256209 CAAGCAGTTGACATAAATGTAGG - Intronic
1120626420 14:86831999-86832021 CAAACAGTCCACACTGATGTTGG - Intergenic
1120833129 14:89015643-89015665 GTAGGAGTTCAAATTGATGCCGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124473034 15:30005232-30005254 GAAGAAGCTCAGATTGATGATGG + Intergenic
1125701593 15:41690479-41690501 GAATCAGTTGACATAAATGTGGG + Intronic
1125763780 15:42119193-42119215 GAAGCAGCTCACAATTATGGAGG + Intergenic
1126156265 15:45568290-45568312 GAATCAGTTTGCATTCATGTGGG + Intergenic
1126268686 15:46786723-46786745 CAAGCAGTTCAAAGTGATGAGGG - Intergenic
1127688157 15:61368667-61368689 GCAGCAGTTCACACAGATGTGGG - Intergenic
1128782936 15:70374938-70374960 GGAGCAGATCACTTTGATTTGGG + Intergenic
1130176111 15:81573091-81573113 GAAACAGTTCACATTCACTTGGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133073536 16:3262853-3262875 GCAGCAGATCTCATTGATCTGGG - Intergenic
1136418058 16:30115444-30115466 TCAGCAGTTCACATAGCTGTGGG - Intronic
1137390613 16:48078349-48078371 GAGCCAGTTCACATTGAAGCAGG - Intergenic
1137982827 16:53084391-53084413 GAAGCAGTTTAGAGTGTTGTTGG + Intronic
1140829080 16:78734788-78734810 GAAGGAGTTCTCTTTGAAGTAGG - Intronic
1141044864 16:80706992-80707014 GAAGCCGTACAGATTGATGAAGG + Intronic
1144019386 17:11226555-11226577 GTAGTAGTTCACATTTATGGTGG - Intergenic
1144107537 17:11999087-11999109 GAAGCAGAGCACATTGATGTTGG - Intergenic
1150270402 17:63860739-63860761 TGAGCAGGTCACATTAATGTCGG - Intergenic
1153299372 18:3579904-3579926 GAATCACTTCCCATAGATGTGGG - Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155324120 18:24648990-24649012 AAAGCAGTTCACATTCATATGGG - Intergenic
1155807623 18:30192201-30192223 CAAGCAGTGCACATTGGTGTTGG + Intergenic
1159178999 18:64877050-64877072 GAAGAAGTTCCCAGTGAAGTGGG + Intergenic
1164210997 19:23097257-23097279 GAAGCACATGACCTTGATGTTGG - Intronic
926520514 2:13907081-13907103 GAAGAAGTTCATAGTGAGGTAGG + Intergenic
930368168 2:50469692-50469714 AAAGTTGTTCACCTTGATGTTGG + Intronic
931859316 2:66337580-66337602 GAAGTTGGGCACATTGATGTGGG - Intergenic
934755873 2:96824513-96824535 GAAGCCATGCACATTTATGTAGG + Intronic
935594880 2:104870614-104870636 CCAGCAGTTCATCTTGATGTAGG - Intergenic
937428739 2:121820787-121820809 GAAGCAGCTCTCAGTCATGTAGG + Intergenic
937635857 2:124154492-124154514 GCAGAAGTTCACATTGTTCTTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939451085 2:142375978-142376000 GAAGAAGGTCACATTGATACGGG + Intergenic
944166764 2:196731009-196731031 GAAGGATTTCACATTGACTTGGG - Intronic
944864701 2:203849008-203849030 GAAACAGTTTGCATTCATGTGGG + Intergenic
946793495 2:223325174-223325196 GAAGCAATTCAGATTGTTGAAGG - Intergenic
947404543 2:229761257-229761279 CAAGCGGTTCTCATTTATGTAGG + Intergenic
948658386 2:239491205-239491227 GAAGCAGCACACATTTATGGTGG + Intergenic
1169121158 20:3096643-3096665 GAATCTGTTAACATTGATGGTGG + Intergenic
1169878312 20:10321517-10321539 GAAGCAGATCACATGGCTATTGG - Intergenic
1175804381 20:61819313-61819335 GAACCAGAGCACATGGATGTTGG + Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1179098960 21:38339787-38339809 GAAGTAGTTCCCCTTCATGTAGG + Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1182156123 22:28074688-28074710 AAAACAGACCACATTGATGTGGG - Intronic
1183841996 22:40506312-40506334 GAAGCAGATCACATTCAAGAAGG - Intronic
1185395529 22:50585305-50585327 AAAGCAGTTCACATTTATATGGG + Intronic
957244838 3:77703560-77703582 GAAGCAGGTTACATTGCTGCAGG - Intergenic
958065071 3:88534268-88534290 TAAGCAGCTCACATTAATCTGGG - Intergenic
960383701 3:116994279-116994301 GAAGTAGTTCACATTCATGTGGG + Intronic
961707718 3:128801537-128801559 GAAACAGTTAACATTGATAGGGG + Intronic
961941043 3:130637115-130637137 GAAGCAGTTCTCATTGGAGGAGG - Intronic
964410534 3:156393118-156393140 GCAGCAGATCACATTGGAGTTGG + Intronic
964657109 3:159079571-159079593 GAAGCATTTCATATTCATTTTGG + Intronic
966091341 3:176142424-176142446 AAACCAGTTCTCATTTATGTGGG - Intergenic
967450469 3:189617356-189617378 GAAACAGTTCACATTCATGTGGG - Intergenic
970967024 4:21939945-21939967 GAGGCATTTCAAATTGGTGTAGG - Intronic
971250121 4:24967564-24967586 GGAACAGTTCACCTTCATGTGGG + Intronic
975715289 4:77199651-77199673 GAAGCAGTTCCCTTGGATTTGGG + Intronic
977622777 4:99155872-99155894 AAAAAAGTTCACATTGGTGTAGG + Intronic
980168988 4:129264081-129264103 AAAGAAGTACACAGTGATGTGGG - Intergenic
980457857 4:133069104-133069126 AAAGCAGTTTACTCTGATGTTGG + Intergenic
981549890 4:145933255-145933277 GAAGCAGTCTAGATTGATGCTGG - Intronic
983525675 4:168758350-168758372 GCAGCATTTCACATTCATTTTGG - Intronic
983972470 4:173891926-173891948 AAAGCCATTCACATGGATGTTGG + Intergenic
985386519 4:189453310-189453332 GAAGCACTTCACATGGCTGGAGG - Intergenic
986306727 5:6521946-6521968 GAAACGGTTCAGATGGATGTAGG + Intergenic
986512874 5:8526906-8526928 GATGTAGGTCACATTTATGTTGG - Intergenic
986732024 5:10641917-10641939 GAACCATTTCTCATTGATGAGGG - Intronic
988089956 5:26525502-26525524 GAAGCCTTGCACATTGTTGTAGG + Intergenic
989512122 5:42300303-42300325 CAAGCAGTTGTCAGTGATGTTGG + Intergenic
989610151 5:43283045-43283067 AAAGCAGTTCACATTTCTCTGGG - Intergenic
990074664 5:51829191-51829213 TATGAAGTGCACATTGATGTGGG - Intergenic
991536441 5:67674004-67674026 GAAGCAATTCCCATTTATGCAGG - Intergenic
994021433 5:95030184-95030206 GAAGCAGATCACATACCTGTTGG + Intronic
998689704 5:144573660-144573682 GAAGCAGTGGAAAATGATGTTGG + Intergenic
1000503999 5:162091198-162091220 GAAGCAGCATACATAGATGTAGG + Intronic
1001322436 5:170693631-170693653 AAAGCAGTTCATGTTGATGGAGG - Intronic
1001733271 5:173976105-173976127 GAAGCCTTTCACATTGCTGTTGG - Intronic
1002835306 6:860680-860702 GAATCAGTTCACCTGGACGTAGG + Intergenic
1008391920 6:50962213-50962235 GAAGAAGTTTACATTGAAGAAGG - Intergenic
1008776795 6:55050020-55050042 GAATCAGATCACATCCATGTGGG + Intergenic
1010621448 6:78081545-78081567 GAAACATTTAACATTGATCTGGG + Intergenic
1014107503 6:117583307-117583329 AAAGGAGTTCATATTGATGCAGG - Intronic
1015451078 6:133366517-133366539 GAAGCAGGTCAAATGGAGGTGGG - Intronic
1015660896 6:135572227-135572249 GACTCACTTCACAGTGATGTAGG + Intergenic
1016587288 6:145704061-145704083 TAAGCAGATTACTTTGATGTAGG - Intronic
1017747680 6:157461420-157461442 GAAGCAGGGCAGATTGCTGTGGG + Intronic
1022660661 7:32363489-32363511 CAAGCAGTTCAGATTAATTTAGG - Intergenic
1024808060 7:53171109-53171131 TAAGAAGTTCACATTCATGTGGG - Intergenic
1026618887 7:71932930-71932952 GGCGCATGTCACATTGATGTAGG + Intronic
1028626306 7:92881077-92881099 CAAGCAGTTCATGTTGGTGTTGG - Intergenic
1028687869 7:93612758-93612780 GAAGCAGTTCACCTTCATTTGGG + Intronic
1028872916 7:95788421-95788443 GAAGCAGTTGCCTTTGAAGTGGG + Intronic
1031858203 7:126947146-126947168 GATGCTATTCAAATTGATGTAGG + Intronic
1032527942 7:132593937-132593959 GAAGCAGTTTGCAGTGATGAAGG + Intronic
1036194294 8:6700496-6700518 GAATCAAGTCACATTGAAGTTGG + Intergenic
1036228355 8:6979451-6979473 AAAGCTTTTGACATTGATGTAGG + Intronic
1036230808 8:6998568-6998590 AAAGCTTTTGACATTGATGTAGG + Intronic
1036233254 8:7017667-7017689 AAAGCTTTTGACATTGATGTAGG + Intronic
1037163423 8:15798784-15798806 AAAGGAGTTCACTTTAATGTGGG + Intergenic
1038497116 8:28011277-28011299 GAAGCAGTTTCCAGTGATGGAGG - Intergenic
1039919971 8:41886608-41886630 GGAGGACTTGACATTGATGTTGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040725223 8:50374705-50374727 TGAGCAGTTCACATTGATTTGGG - Intronic
1042100822 8:65273220-65273242 AAAGCAGCCCACAATGATGTGGG - Intergenic
1043659208 8:82714445-82714467 GAAGCACTGCACATTGTTGGTGG - Intergenic
1045066480 8:98451347-98451369 GAAGCAGTTCAGTTTGTTGGCGG + Intronic
1045160053 8:99530078-99530100 GAAGAACTTTACATTGATGGGGG + Intronic
1051715009 9:19973403-19973425 GAAGCAGTTCATTTTGTGGTTGG + Intergenic
1055057438 9:72036779-72036801 AAAAGAGTTCACATTAATGTGGG + Intergenic
1056176988 9:84045198-84045220 GAAGCAGTTTGCACTGGTGTTGG + Intergenic
1057008498 9:91581641-91581663 GAAGAAGATCACATTGAAGAAGG + Intronic
1059638298 9:116191842-116191864 GAAGCTGTTTACAATGTTGTAGG + Intronic
1059823110 9:117996121-117996143 AGAGCAGTTCCGATTGATGTGGG + Intergenic
1062078622 9:134606473-134606495 CAGTCAGTTCACAGTGATGTGGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1188228311 X:27629196-27629218 GAAGCTTTTTAGATTGATGTGGG + Intronic
1188569340 X:31563361-31563383 GAAGCAGATCAGATTGTTTTTGG - Intronic
1190974970 X:55389922-55389944 GGAGCAGTATGCATTGATGTTGG - Intergenic
1191684904 X:63879622-63879644 TAAGTAGTTCACACTGGTGTCGG - Intergenic
1194645773 X:96456696-96456718 ACAGCATTTCACACTGATGTTGG + Intergenic
1194665893 X:96677119-96677141 AAAGCTGTTAAAATTGATGTGGG + Intergenic
1194693374 X:97013915-97013937 GAATCAGTGAGCATTGATGTTGG + Intronic
1194748867 X:97661525-97661547 GAGGCAGTTGACATTAAGGTGGG + Intergenic
1196223322 X:113137386-113137408 GAAGCAGTTGAAAGTCATGTGGG - Intergenic
1196397666 X:115283130-115283152 CTAGCAGTTGACATTGATTTGGG - Intergenic
1198329217 X:135606088-135606110 GAAGCAGTCCACAGGCATGTGGG - Intergenic
1200002729 X:153070561-153070583 GAAGCAGGTCGCATTGGAGTGGG - Intergenic
1200004994 X:153079448-153079470 GAAGCAGGTCGCATTGGAGTGGG + Intergenic