ID: 918231214

View in Genome Browser
Species Human (GRCh38)
Location 1:182534316-182534338
Sequence CACATTATTTTTCATTTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918231214_918231216 11 Left 918231214 1:182534316-182534338 CCTGGTAAATGAAAAATAATGTG 0: 1
1: 0
2: 0
3: 36
4: 377
Right 918231216 1:182534350-182534372 ATTCTTATTTATACTTCTTTAGG 0: 1
1: 0
2: 6
3: 75
4: 1032

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918231214 Original CRISPR CACATTATTTTTCATTTACC AGG (reversed) Intronic
900658005 1:3769686-3769708 CACCTTATTTTTTATGTACCAGG - Intronic
902587814 1:17451743-17451765 CTCATTATTTTTCATCTTCTCGG + Intergenic
905578104 1:39062182-39062204 AACATAAGTTTTCATTTATCTGG - Intergenic
905718152 1:40171186-40171208 AAAATTATTTTTCAATTAGCTGG - Intronic
905773541 1:40653776-40653798 CACATAATTTATCATCCACCTGG + Intronic
906931661 1:50176130-50176152 CACATTATTTTTATTTCACTTGG + Intronic
908006639 1:59734920-59734942 CAGATTATTTTGTAATTACCTGG + Intronic
909217645 1:72910892-72910914 TACATTTTTCTTCATTTTCCTGG + Intergenic
909394132 1:75150654-75150676 AAAATTATTTTCCATTTCCCTGG - Intronic
909683623 1:78320867-78320889 CACATGATGTTTCATCTTCCAGG + Intronic
910025098 1:82640529-82640551 CACATTATTTTGCATATAGAAGG + Intergenic
911276924 1:95872595-95872617 CTCATTATTTTTTATTTCTCTGG - Intergenic
911755660 1:101551639-101551661 CATATAATTTTTAATTTTCCTGG + Intergenic
911992015 1:104710540-104710562 CATATTATTATTCATTTAATTGG + Intergenic
915058119 1:153155794-153155816 CATATTATTATTGTTTTACCGGG + Intergenic
915158320 1:153896974-153896996 CACAGTATTTTTTAATTAACTGG - Intronic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
917436008 1:175022238-175022260 CACAGTATTTTGGATATACCTGG + Intronic
917985641 1:180315508-180315530 CACATTTATTCTCAATTACCAGG - Intronic
918231214 1:182534316-182534338 CACATTATTTTTCATTTACCAGG - Intronic
918636165 1:186776957-186776979 CACATCATATTTCTTTTTCCAGG - Intergenic
919471390 1:197983313-197983335 CCCCTTATTTTTCATCTAACTGG - Intergenic
919620033 1:199854082-199854104 AACATAATTTTTCATTTCTCTGG + Intergenic
920732814 1:208503838-208503860 CACATGAGTATTCATTTGCCTGG - Intergenic
921318219 1:213912060-213912082 CACATCTTTGTCCATTTACCTGG - Intergenic
921356372 1:214287960-214287982 CACGTTATTTTTCATATGCGGGG + Intronic
922054835 1:222031733-222031755 CACAGTATTTTTCTTTAACGTGG - Intergenic
922276378 1:224082721-224082743 CATTTTATTTTTCATTTACAAGG - Intergenic
922579175 1:226684480-226684502 CACTTTTTTTTTCTTTAACCAGG + Intronic
924565673 1:245196182-245196204 CATCTTATATCTCATTTACCAGG - Intronic
1063714918 10:8517082-8517104 CAGTTTATTTTTCTTTTCCCAGG - Intergenic
1063989115 10:11540723-11540745 CACATTATTTTTTATTTAAAGGG - Intronic
1064293794 10:14059245-14059267 TACATTATTCTTCATTTAGGAGG - Intronic
1064668431 10:17682690-17682712 CACATTTTTTTTCATGTGCATGG - Intronic
1066005015 10:31138531-31138553 AAAAATATTTTACATTTACCTGG + Intergenic
1067596188 10:47560317-47560339 TACATTATTTTTAATTTTCCTGG - Intergenic
1067990773 10:51209429-51209451 TATATTATTTTACTTTTACCAGG - Intronic
1068456806 10:57265947-57265969 CACAATTTGTTTCATTTAACAGG - Intergenic
1068540133 10:58283061-58283083 CTCATTTTCTTTCATTTACAGGG + Intronic
1068550789 10:58405553-58405575 CACATTGTTTACCATTTACCTGG - Intergenic
1068562779 10:58534588-58534610 GAATTTATTTTTCATTTAACTGG - Intronic
1068901118 10:62269714-62269736 CCCATGTTTTTTCATTTGCCTGG + Intergenic
1069118075 10:64533384-64533406 CAAATTATTTTTTAATAACCTGG - Intergenic
1069408015 10:68122985-68123007 TACATTATTTTTATTATACCAGG + Intronic
1069881616 10:71597059-71597081 CTCATCATCTTTCATTTCCCAGG + Intronic
1070489449 10:76962942-76962964 TGCATCATTTTTCATTTACAGGG + Intronic
1071188551 10:83073967-83073989 CATCTTTTTTTACATTTACCTGG - Intergenic
1071308879 10:84325014-84325036 CACATTATTTTTCATCTTTCTGG + Intergenic
1075956506 10:126527797-126527819 CAATTTATTTTTTATTTATCCGG + Intronic
1076689366 10:132213450-132213472 CACATTTGTTTTCATTTCCCGGG - Intronic
1078383790 11:10869194-10869216 AACATGAGTTTTCATTTTCCAGG + Intergenic
1079910923 11:26308445-26308467 CACATCATTATTCATTTATCTGG + Intergenic
1079983188 11:27173601-27173623 CACATTCTTTTTTTTTTTCCAGG - Intergenic
1080119977 11:28665948-28665970 CAAATTATTTTGGATTTATCTGG - Intergenic
1081114015 11:39174917-39174939 CATATTTTCTTTCATTTTCCCGG - Intergenic
1082633793 11:55572126-55572148 CACATTATTATTCAGTTGCATGG - Exonic
1082836086 11:57651006-57651028 CAGATTATGTTTTTTTTACCTGG - Intronic
1083093798 11:60228363-60228385 CATTTTAATTTTCATTTCCCTGG - Intronic
1083524688 11:63351491-63351513 CACATAATTTTTGACTGACCAGG + Intronic
1085956364 11:81401139-81401161 CACATTCTTTTTCCTTTATCTGG + Intergenic
1088148597 11:106716079-106716101 AACATTATTTTCACTTTACCTGG - Intronic
1088316516 11:108512333-108512355 CACATTATTTTTGATTTGGAAGG + Exonic
1088667416 11:112107541-112107563 CTCATTATTTTTGATCTTCCTGG - Intronic
1090073962 11:123567625-123567647 AACACTATTTTTCATTTCCATGG - Intronic
1090574853 11:128089587-128089609 CACATTTTTTTTTCTTTACATGG + Intergenic
1090903362 11:131052094-131052116 CACATTTTTTTTCTTTTGCTGGG - Intergenic
1091685308 12:2557269-2557291 CACTTTATGTTTCTTTTAACTGG - Intronic
1093162866 12:15769127-15769149 CACTTTATGTTCCATTAACCAGG + Intronic
1093222914 12:16445582-16445604 CAAAATAGTTTTCATTTACATGG - Intronic
1094242115 12:28240850-28240872 GACATAAGTTTTCATTTTCCTGG + Intronic
1095649123 12:44585884-44585906 CAGTTTTTTTTTCTTTTACCTGG - Intronic
1095653301 12:44639618-44639640 CACTTTATTTTTCCATTTCCAGG + Intronic
1095970906 12:47901535-47901557 CACTTTGCTTTTCATTTCCCCGG + Intronic
1096882600 12:54685047-54685069 CACTTTAATTTTAATTTTCCAGG + Intergenic
1097574874 12:61380080-61380102 TATTTTATTTTTCATTTATCTGG + Intergenic
1097964819 12:65567657-65567679 TATGTCATTTTTCATTTACCAGG - Intergenic
1098410720 12:70180596-70180618 CTTATTGTTTTTCATTTACCTGG + Intergenic
1099613561 12:84907704-84907726 AACATAAATTTTCATTTATCTGG - Intronic
1099986772 12:89674893-89674915 AACAATATTTTACATTTACTTGG - Intronic
1102361405 12:112291012-112291034 CACATTAATTATCTTTCACCTGG + Intronic
1103886125 12:124201855-124201877 CACATTATATTTTGTTTATCTGG + Intronic
1105393809 13:20008870-20008892 CAGTTTATTTTTCTTTTTCCAGG - Intronic
1105702797 13:22945718-22945740 TACTTTAATTTTCATTTTCCTGG + Intergenic
1106158246 13:27177369-27177391 GACATTATTTTTAAATTACTAGG + Intergenic
1106542177 13:30699861-30699883 AACAGTAATTTTCATTTACCAGG + Intergenic
1106681435 13:32012447-32012469 AACATTATTTTTAATATATCTGG + Intergenic
1106838428 13:33661041-33661063 AATATTATTTGTTATTTACCTGG + Intergenic
1107549470 13:41461576-41461598 CACATAATTTTTCCTTTGACGGG + Intronic
1107746415 13:43515023-43515045 CACATTTTGTTTCATTTTCATGG + Intronic
1107850091 13:44562719-44562741 CATATTAGTTCGCATTTACCTGG + Intronic
1108446856 13:50518146-50518168 CCCAGTAGTTTTCATTTACTAGG + Intronic
1108606278 13:52042047-52042069 CTCATTATTTTTCCTTTATAGGG - Intronic
1109083306 13:57935969-57935991 CATATTATGTTTCACTTCCCTGG + Intergenic
1109321431 13:60814565-60814587 AACAGAATTTTTCATTTATCTGG + Intergenic
1109528980 13:63615122-63615144 TAGATTCTTTTTCATTAACCAGG - Intergenic
1109605763 13:64693084-64693106 CAAATTATTCTTTATTTTCCAGG + Intergenic
1109944594 13:69417055-69417077 CACATTATTTGTAATTTTCCAGG - Intergenic
1110909872 13:80944922-80944944 CACAGTATTTTAAATTTGCCTGG + Intergenic
1111106564 13:83652698-83652720 CAAATGATTTTTTATTGACCAGG + Intergenic
1111483086 13:88858071-88858093 CATATTATTTTGTATTTATCTGG + Intergenic
1112406107 13:99122087-99122109 CACATGATTTTTAATTTCTCAGG + Intergenic
1113047724 13:106173773-106173795 CAACTTAATTATCATTTACCAGG + Intergenic
1114498401 14:23150289-23150311 CACATCATCCTTCACTTACCAGG - Intronic
1115221109 14:31059471-31059493 GACATTTTTTTCCTTTTACCTGG + Intronic
1115938445 14:38582015-38582037 CAAATTATTTTTGGCTTACCTGG - Intergenic
1117522829 14:56567647-56567669 CAGATCATTTTTCATTTGCCTGG - Intronic
1117893785 14:60455986-60456008 CACATTATTTTACAGTTCTCAGG + Intronic
1118420789 14:65600093-65600115 CACATTATTCTACGTTTACTTGG - Intronic
1119134679 14:72206118-72206140 CATATTATAATTGATTTACCTGG - Intronic
1120202266 14:81550347-81550369 CTCATTAGTTTTCTTTCACCTGG + Intergenic
1120235790 14:81889332-81889354 AACATTGTTTTTCATTTATCAGG + Intergenic
1123146553 14:106136587-106136609 CACATTTTTTTTTTTTTACAGGG - Intergenic
1124711115 15:32012822-32012844 AACATGAGTTTTCATTTATCTGG + Intergenic
1125336916 15:38635824-38635846 CCAAATAATTTTCATTTACCAGG + Intergenic
1125345231 15:38712547-38712569 CACTTTTTGTTTAATTTACCAGG + Intergenic
1125493438 15:40166852-40166874 CTCATTACTTTGCATTTCCCTGG + Intronic
1126262187 15:46706151-46706173 AACATAATTTTTCATTTTTCTGG - Intergenic
1126368677 15:47922687-47922709 CACAATCTGTTTCCTTTACCTGG - Intergenic
1126832379 15:52621394-52621416 CATATTATTTTTCAGTTAATAGG - Intronic
1126943895 15:53796240-53796262 CTCTTTATTTTTAATTTATCTGG - Intergenic
1127051999 15:55093952-55093974 CACAATTTTTTTCATTTTTCTGG + Intergenic
1127516565 15:59699683-59699705 AACATTATTTCTCATTTATGTGG + Intergenic
1127549940 15:60027073-60027095 CTCATTATTTTACATGTACAAGG + Intronic
1128493310 15:68172611-68172633 CACATTATTTGCCAAGTACCAGG - Intronic
1129022142 15:72530017-72530039 GACAATATTTTCCTTTTACCTGG - Intronic
1129557079 15:76522133-76522155 AATATTATTTCTCATTTACATGG + Intronic
1131849469 15:96523547-96523569 CACATTATTTTTCATTATGATGG - Intergenic
1135083542 16:19456557-19456579 CACATTATTTTTAAAATGCCAGG - Intronic
1135597383 16:23754861-23754883 CACATTGTTTTCCATTCGCCCGG + Exonic
1138253937 16:55535556-55535578 CATATTATCTTTCACTTACCAGG + Intronic
1138409338 16:56825971-56825993 CAAATAATTTTTCAATTACAGGG + Intronic
1138716801 16:59032974-59032996 CACTTTATTTCTCGATTACCAGG - Intergenic
1138882847 16:61036770-61036792 CAACTTATTTTTCATTTGACTGG - Intergenic
1140873371 16:79127308-79127330 GACATTATTATGCATTTACAAGG + Intronic
1140965279 16:79959970-79959992 AACATTATTTGTTTTTTACCTGG + Intergenic
1141379888 16:83566759-83566781 CTCATCATTTTTCATCTGCCTGG + Intronic
1203026895 16_KI270728v1_random:522518-522540 AACATTTTTTTTTATTTAGCAGG - Intergenic
1203044826 16_KI270728v1_random:811913-811935 AACATTTTTTTTTATTTAGCAGG + Intergenic
1144175324 17:12699567-12699589 CACCTTATTTCATATTTACCAGG + Intronic
1145210318 17:21008273-21008295 AACATTAGTTTTCATTTCTCTGG - Intronic
1146095083 17:29922128-29922150 CACATGCTGTTTCCTTTACCTGG - Intronic
1146588817 17:34110120-34110142 CACTTTATTTTTATTTTACTTGG - Intronic
1147398827 17:40166563-40166585 CATTTTATTTTTCATTTTCAAGG + Intronic
1147537526 17:41330408-41330430 AACATTATTATTCAGTTAACAGG - Intergenic
1148601115 17:48895017-48895039 CAGAGTATTCTGCATTTACCAGG + Intronic
1150859319 17:68785138-68785160 CAAATTTTTTTTCATTTTCAAGG - Intergenic
1152942332 17:83179258-83179280 CACATTTCTTTTTATTTACACGG + Intergenic
1153373995 18:4355134-4355156 CACATAAATTTTCATTTCCCTGG - Intronic
1155031395 18:21987901-21987923 AACATAAATTTTCATTTCCCTGG - Intergenic
1155097541 18:22572713-22572735 CACATTAGTTTTCATCAAACGGG - Intergenic
1155761737 18:29576485-29576507 AACATTATTTTTTATTATCCTGG - Intergenic
1156019400 18:32582511-32582533 GACCTTATTTTTCAGTTTCCAGG - Intergenic
1156680932 18:39587390-39587412 CACCTTATTTTGCCTTTTCCAGG + Intergenic
1157279542 18:46336775-46336797 CACTTCATTTTTCAGTTATCTGG + Intronic
1158031356 18:52968739-52968761 CAAATTATTTTGTATTTATCTGG - Intronic
1158530262 18:58254762-58254784 CACAGCATTTTTCATTTAAAAGG - Intronic
1159152589 18:64538972-64538994 TCCATTGTTTTTCAGTTACCTGG + Intergenic
1159737902 18:72125078-72125100 AACATTATTTTTAAGATACCAGG + Intergenic
1160182398 18:76646883-76646905 CATCTTATTTTGCATTTTCCTGG - Intergenic
1161639979 19:5416054-5416076 AACATAAGTTTTCATTTCCCTGG + Intergenic
1164469233 19:28514645-28514667 CACATTATTTTGAAATAACCTGG - Intergenic
1165646661 19:37444888-37444910 TACACTATTTAACATTTACCTGG + Exonic
1166954966 19:46457602-46457624 GACATGAATTTTCATTTTCCGGG + Intergenic
926351097 2:11995350-11995372 CACAGTATTTTTTTTTTACAAGG - Intergenic
926409456 2:12587707-12587729 GACATTATCTTTCTTTTACCTGG - Intergenic
927621192 2:24661122-24661144 CACATTGTTTTTCAAATAACAGG + Intronic
929951773 2:46416469-46416491 GACATTCTCTGTCATTTACCTGG - Intergenic
931241368 2:60455537-60455559 CAGATTATGTTTGATTTACATGG - Intronic
931591722 2:63891221-63891243 CACAGTATTTTTCATTTCAGTGG - Exonic
932339067 2:70948492-70948514 CTCATTATTTGTCATCTCCCTGG - Intronic
933530405 2:83502741-83502763 GACTTTATTTTTCCTTTACCAGG - Intergenic
934101833 2:88660575-88660597 CACATTCTGTTCCATTTATCTGG - Intergenic
935720557 2:105975372-105975394 TACATAATTTTTCATTTATTAGG + Intergenic
936174606 2:110208814-110208836 CTCATTAGGTTTCCTTTACCAGG - Intergenic
936416194 2:112315155-112315177 AACATTATTTTTCATGCACCTGG - Intronic
937493015 2:122389278-122389300 AACCTTGTTTTTCATTTACGCGG - Intergenic
938256729 2:129865072-129865094 CACACATTTTTTCATTTTCCTGG - Intergenic
939127598 2:138195789-138195811 CTCATTATTGTTGATTTACCTGG + Intergenic
939863652 2:147448098-147448120 CACATCATTTTTCCTTTATTTGG + Intergenic
939945224 2:148400889-148400911 AACATTATTTTCCATTAACTAGG - Intronic
940024931 2:149196091-149196113 TACATAATTTTTCAGTTTCCAGG + Intronic
940506679 2:154564061-154564083 CATTTTGTTTTTCATTTACATGG + Intergenic
940534298 2:154919705-154919727 CACATTATTTTCAATTAACTAGG - Intergenic
941409401 2:165134702-165134724 CAACTTATTTTACATTTACCAGG - Intronic
943057495 2:183000165-183000187 AACACTATTTTTTATTTGCCAGG - Intronic
944620037 2:201504956-201504978 CACAGAATATTTCTTTTACCTGG - Intronic
945514335 2:210744095-210744117 CACAACAATCTTCATTTACCTGG - Intergenic
945773796 2:214079656-214079678 CACATTATCTTTCATCTTGCCGG - Intronic
945887737 2:215394509-215394531 CAGCTTATTTTTCTATTACCTGG + Exonic
947479559 2:230486213-230486235 CACATTTTTTTTTATGTTCCGGG + Intronic
1169078824 20:2781734-2781756 CACATAAGTTTTCATTTTTCTGG - Intergenic
1170036651 20:11996756-11996778 AACATTATTTATCATTTATTGGG - Intergenic
1170258996 20:14381576-14381598 AACATTATTTATCACTTACAAGG + Intronic
1171113580 20:22505168-22505190 CACTTTTATTTTCAGTTACCTGG - Intergenic
1171341092 20:24430563-24430585 CTCCATATTTTTCAGTTACCCGG + Intergenic
1173014480 20:39212505-39212527 CAAATTTTTTTTAATTAACCAGG - Intergenic
1175044240 20:56089288-56089310 GATATTATTTATCATTTACTAGG - Intergenic
1175663816 20:60841054-60841076 AACATAAGTTTTCATTTTCCTGG + Intergenic
1177559212 21:22729044-22729066 CACATTATTTTTGCCTTTCCTGG + Intergenic
1177577065 21:22971828-22971850 CACTTTATTTTTTATTTAGTTGG + Intergenic
1177585616 21:23090719-23090741 AACATTATTTTACATTTATAAGG + Intergenic
1177593972 21:23211914-23211936 AATATTATATTTCTTTTACCTGG + Intergenic
1177606975 21:23392608-23392630 CACCTTATTTTTTTTTTACTAGG - Intergenic
1178625324 21:34211743-34211765 ATGATTATTTCTCATTTACCTGG + Intergenic
1179243646 21:39612278-39612300 TACATCAGTATTCATTTACCTGG + Exonic
1181693377 22:24579210-24579232 CTAATTATTCCTCATTTACCAGG - Intronic
1182056445 22:27359072-27359094 CACATTAAATTTCAATGACCTGG - Intergenic
1182131765 22:27858708-27858730 GAGATTATTTTTCATTTCACAGG - Intronic
1183657915 22:39200863-39200885 AACATAAGTTTTCATTTCCCTGG - Intergenic
1184440270 22:44507754-44507776 AACATAATTTTTCATTTCTCTGG - Intergenic
1184705076 22:46205946-46205968 CCCATTCTTTTTCTTTTAACTGG + Intronic
949657377 3:6236228-6236250 AACATAAGTTTTCATTTATCTGG + Intergenic
951173784 3:19575449-19575471 TACATTAGTTTGCATTTATCAGG + Intergenic
951178288 3:19627888-19627910 CACATTATTTATATTTTGCCAGG + Intergenic
951245737 3:20339745-20339767 CACACTCTTTTTCTTTTGCCAGG + Intergenic
952055416 3:29439047-29439069 CACACAATGTTTCCTTTACCTGG - Intronic
955017332 3:55085026-55085048 CACACTCTCTTTCATTTTCCTGG - Intergenic
955111669 3:55957015-55957037 GACATCATTTGTCATTTACCAGG + Intronic
955127695 3:56130353-56130375 CACATTGGTGTTCAGTTACCGGG + Intronic
956402964 3:68899304-68899326 CATATTATATTTTATTTAGCTGG - Intronic
957443566 3:80285724-80285746 CACATTGTTTTTCTTTTCTCAGG + Intergenic
957515688 3:81247884-81247906 CACATTAGGTTTGATTAACCAGG - Intergenic
957915615 3:86684592-86684614 AACATAAGTTTTCATTTTCCTGG + Intergenic
958664339 3:97115358-97115380 TACATTTTTTTTCTTTCACCTGG - Intronic
959082766 3:101819487-101819509 AACATGATTTTTCATCTACAGGG + Intronic
959466484 3:106693622-106693644 CATATTATTTTTCATATAGCTGG - Intergenic
960523638 3:118683908-118683930 CGCAGTATTTTTCATCCACCTGG + Intergenic
961202715 3:125056901-125056923 CAGTTTATTATTCATTTACTGGG - Intergenic
963795478 3:149627092-149627114 CAAATTATTTATTATTTATCTGG - Intronic
965005808 3:163020685-163020707 CAGATTATTATTTATTTACAGGG + Intergenic
965925463 3:173973621-173973643 CACAGAATTTGTCTTTTACCAGG - Intronic
966164548 3:177002621-177002643 CACATCATTCTTCATCAACCTGG + Intergenic
968250286 3:197204131-197204153 CACATAATTTTTCCTATACATGG - Intronic
969834146 4:9825582-9825604 AACATTATTTTTCATTTGGATGG + Intronic
970080685 4:12281582-12281604 CTCTTTTTTTTTAATTTACCAGG - Intergenic
970639357 4:18046938-18046960 CACTTTATTTTTCTTTTTCTGGG + Intergenic
970870712 4:20813892-20813914 CACATGCTTTTTTATTTAGCTGG + Intronic
971687858 4:29792686-29792708 CAAATTATTTTTCATATTCTGGG + Intergenic
972372787 4:38441083-38441105 CAGATTAGTTTGCATTTTCCAGG + Intergenic
973107215 4:46355110-46355132 CACTTTCTTTCTCATTTGCCTGG + Intronic
973221069 4:47728426-47728448 CATTTTGTTTTTCATTTACCTGG + Intronic
973339394 4:48987911-48987933 CACAATATTTTTCATTATACAGG + Intronic
974239396 4:59226268-59226290 CACATTCTATTTCTTCTACCTGG - Intergenic
974273835 4:59689164-59689186 CAAATTATTCTTCATTTCTCAGG - Intergenic
974393418 4:61304075-61304097 CACTGTATCTCTCATTTACCTGG - Intronic
975085860 4:70338947-70338969 TACTTTATTTTTCATTTACAAGG + Intergenic
975174918 4:71277125-71277147 GACATTAGTTTTCATTTCTCTGG + Intronic
975381130 4:73701638-73701660 TACTTTAGTTTTAATTTACCTGG - Intergenic
976229529 4:82827192-82827214 TATATTATTTTTCAATTACATGG - Intronic
976417407 4:84793973-84793995 TAAATTATTTATCATTTAGCAGG + Intronic
976757628 4:88515582-88515604 CACATGCTTTTTCTTTTGCCTGG + Intergenic
977690971 4:99910198-99910220 CACCTAATTTTTCATTCAGCAGG - Intronic
977766218 4:100800762-100800784 ACCATTATTATTCATTTTCCTGG + Intronic
977780262 4:100972741-100972763 CAGATTTTTTTTCATTTGCCTGG + Intergenic
978539958 4:109805751-109805773 TTCATTATTCTACATTTACCAGG + Intergenic
978615618 4:110592328-110592350 CAAAATATTTTACAATTACCAGG + Intergenic
979148945 4:117283467-117283489 CATATTATTATTAATTAACCTGG + Intergenic
980082671 4:128360763-128360785 CACATTCTCTCTCTTTTACCTGG + Intergenic
980350139 4:131673716-131673738 CACAATATTTCTGATTTACATGG + Intergenic
980485498 4:133451555-133451577 AACATTATTTTTCTTCTTCCTGG - Intergenic
981242670 4:142496721-142496743 CACATTATGTTTCCTATAGCTGG - Intronic
981282861 4:142979725-142979747 CACATTACTTTACAAATACCAGG + Intergenic
982710060 4:158749057-158749079 CACATCCTTTACCATTTACCAGG + Intergenic
982755374 4:159211988-159212010 TACAGTACTTTCCATTTACCAGG + Intronic
983145139 4:164204448-164204470 CATATTATTTTCCCTTTGCCTGG - Intronic
983605690 4:169580823-169580845 CATATCAGATTTCATTTACCTGG + Exonic
984408715 4:179367938-179367960 CACATTAATTATCATCTAACAGG + Intergenic
984446487 4:179843204-179843226 CTAATTATTTTTAATTTACACGG - Intergenic
984605704 4:181783487-181783509 CACATTATTTTTTCTTTTCAAGG + Intergenic
985946631 5:3190068-3190090 CACATTATTTTTTATTCAAAGGG - Intergenic
987801355 5:22700800-22700822 TACTTTATATCTCATTTACCTGG - Intronic
988006003 5:25411578-25411600 CAAATGATAGTTCATTTACCTGG + Intergenic
989021227 5:37012022-37012044 CATCTTATTTTGCATTTTCCTGG + Intronic
989526818 5:42463183-42463205 TAAATTATATTTCATTCACCAGG - Intronic
989710054 5:44387948-44387970 CACATTTTGTTTCTTTTCCCTGG - Intronic
990613217 5:57481042-57481064 CACAATATATTTTATTTCCCTGG + Exonic
990791028 5:59480302-59480324 AACATTATTGTTCATATACATGG + Intronic
991314561 5:65286144-65286166 CAAATTGTCTTTTATTTACCTGG - Intronic
992957419 5:81924230-81924252 AACATAATTTTTCAATTACTTGG - Intergenic
993109330 5:83636514-83636536 GACATTATTTATCTTTTCCCTGG + Intergenic
993644104 5:90441729-90441751 AACTTTTTTTTTCATTTTCCAGG + Intergenic
993677635 5:90836239-90836261 AACATAAGTTTTCATTTATCAGG - Intronic
993697424 5:91078364-91078386 CACAGTTTATTTTATTTACCAGG - Intronic
994330332 5:98497369-98497391 CAGTTTATTTTTAATTTACAGGG + Intergenic
994891834 5:105646262-105646284 CACAATGTTTTTTATTTACCTGG - Intergenic
995222682 5:109668578-109668600 CATATTATTTTTCATATGTCTGG + Intergenic
996096413 5:119403743-119403765 AACATAATTTTTCATTTCTCTGG + Intergenic
996709699 5:126532154-126532176 TACATGATTTGTGATTTACCTGG + Intergenic
996833838 5:127769343-127769365 CACATTAATTCTGATTTGCCTGG + Intergenic
997082455 5:130756281-130756303 AACATTATTTTTATTTTACCTGG + Intergenic
997810595 5:136963937-136963959 CACAACATTTATCATTTACCAGG - Intergenic
999402453 5:151276301-151276323 CAGATTAGTTTTCATTTTCCAGG + Intergenic
1003119237 6:3306351-3306373 CAAATTATTTTTCCCTTACCTGG - Intronic
1003261493 6:4520867-4520889 ACCATTATTTTCCATTTGCCTGG - Intergenic
1005145212 6:22681968-22681990 AACATAAGTTTTCATTTATCTGG - Intergenic
1006235165 6:32624320-32624342 CATATTATTTTACATATAACAGG + Intergenic
1006902076 6:37509410-37509432 CACATTCTTTAGCATTTGCCCGG + Intergenic
1007760347 6:44129485-44129507 CCCATTATTGATCAATTACCAGG - Intronic
1008217338 6:48809691-48809713 TACATTATTTTTCACTTCCTGGG - Intergenic
1010347602 6:74830305-74830327 CAAAGTATTTTTCATTTAACAGG + Intergenic
1010391993 6:75348603-75348625 TAAATTATTTTTCACTTTCCAGG - Intronic
1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG + Intergenic
1012219612 6:96632780-96632802 AACATAAGTTTTCATTTCCCTGG + Intergenic
1013380470 6:109564762-109564784 CAGATAATTTTTCAATTTCCAGG + Exonic
1013443982 6:110202400-110202422 CACATTACTTTAGATTTACATGG - Intronic
1013708417 6:112867567-112867589 TGCATTATTTTTTACTTACCTGG - Intergenic
1015159222 6:130133430-130133452 CCCATTTGTTTTCATTGACCAGG + Exonic
1015738426 6:136426605-136426627 CACATTATTCTTCACTTATCTGG - Intronic
1016579120 6:145608534-145608556 AACATTTCTTCTCATTTACCGGG - Intronic
1017375226 6:153760814-153760836 CAGATTTTTTTTAATCTACCTGG - Intergenic
1018405842 6:163481658-163481680 CACTTTAGTTTTCATTTTCTTGG + Intronic
1018505534 6:164463882-164463904 CTCATTATTTATTATTTTCCTGG + Intergenic
1020827823 7:13053836-13053858 CACTTATTTTTTCATTCACCAGG - Intergenic
1021243443 7:18233294-18233316 CTCATTATTTTTCATTTTTGAGG + Intronic
1021256520 7:18399137-18399159 GAAATTATTTTTTATTAACCAGG - Intronic
1021856373 7:24860909-24860931 GACATAAATTTTCATTTATCTGG + Intronic
1021890899 7:25185319-25185341 AACATTAGTTTTCATTTTTCTGG + Intergenic
1021974620 7:25999583-25999605 CAAAATATTACTCATTTACCTGG - Intergenic
1022307430 7:29160529-29160551 CTCATTATATTTCACTGACCAGG - Intronic
1022608342 7:31839669-31839691 CACATATGTTTTCATTTATCTGG + Intronic
1023625164 7:42108306-42108328 CATATCATTTTTAATTTATCAGG - Intronic
1023978037 7:45047222-45047244 AACATAAATTTTCATTTCCCTGG - Intronic
1024081618 7:45861061-45861083 CACATTATTTTTCTTCCTCCAGG + Intergenic
1026669861 7:72380545-72380567 CCCATGACTTCTCATTTACCTGG + Intronic
1028088814 7:86671950-86671972 CACATTATTCTTTATTAAACAGG + Intronic
1028687973 7:93613850-93613872 CACAGTATTTGTCATTTTGCAGG + Intronic
1029050082 7:97676940-97676962 CACAGTATTTTTTATTTTGCTGG - Intergenic
1031038791 7:116817239-116817261 CACATTATTCTTCTTTGACATGG - Intronic
1031351691 7:120739963-120739985 CAAATAATTATTTATTTACCAGG - Intronic
1031618954 7:123912941-123912963 CATATTGTTTACCATTTACCTGG + Intergenic
1032059645 7:128714006-128714028 CTCATTATCTTTTGTTTACCAGG - Intronic
1032343652 7:131099439-131099461 AACATTTTTTTTTATTTAGCTGG + Intergenic
1032552529 7:132798002-132798024 CACATTATTTTAAATTTAATGGG + Intronic
1032574032 7:133033552-133033574 CCCACTTTTTTTCATTTATCAGG - Intronic
1033268351 7:139907283-139907305 CACATAATTTTTTATTTTTCAGG + Intronic
1034041732 7:147884857-147884879 CACATTATTCATCCATTACCCGG - Intronic
1036580561 8:10070982-10071004 AACATAAGTTTTCATTTATCTGG + Intronic
1039256636 8:35726130-35726152 CAGATCAATTTTCTTTTACCAGG + Exonic
1039889680 8:41675815-41675837 CACATCAGTTTGCATTTCCCAGG + Intronic
1040116800 8:43630958-43630980 CACCTTACTTTTGATTTATCAGG + Intergenic
1040131340 8:43800537-43800559 AACATTTCTTTTCATTTAGCAGG + Intergenic
1040343920 8:46467049-46467071 AACATTTTTTTTCATTCAGCAGG - Intergenic
1040757870 8:50802745-50802767 AACATGAGTTTTCATTTATCTGG + Intergenic
1041353842 8:56978659-56978681 CACATTTTTTTTTTTTTACCTGG - Intronic
1041694095 8:60717241-60717263 TACACTATCTTTCATTTACAAGG - Intronic
1042091070 8:65160336-65160358 CTCATTTTTTTACATTTCCCGGG - Intergenic
1042588874 8:70375037-70375059 ATCTTTTTTTTTCATTTACCAGG - Intronic
1042742458 8:72066029-72066051 CCAGTTATTTTTCTTTTACCTGG + Intronic
1042765656 8:72318655-72318677 CAGAATATTTTTAAATTACCTGG + Intergenic
1043115314 8:76244977-76244999 GACATTATTTTTCATTTGGTAGG - Intergenic
1043795275 8:84529603-84529625 CACGTTATTGTTCATATATCTGG + Intronic
1044381888 8:91543476-91543498 CAGATAATTGTTCATTCACCTGG - Intergenic
1044416276 8:91943963-91943985 CAAATTATTTTTCTTCTACTTGG - Intergenic
1045163059 8:99570948-99570970 CTCATTATTTTTAATTTTCCAGG + Intronic
1045829051 8:106436023-106436045 CACATTTTTTTTCCTTTCCAAGG + Intronic
1047487664 8:125346583-125346605 CACATTCTATTTCTTTTATCTGG - Intronic
1050303147 9:4279539-4279561 TACATTATTTTTCTTAAACCAGG - Intronic
1050485066 9:6125625-6125647 CACTTGATTTTTCATTTCTCTGG - Intergenic
1050689703 9:8212036-8212058 CACAATTCTATTCATTTACCTGG - Intergenic
1051848172 9:21476472-21476494 CACATTATTCAACATTTAACAGG - Intergenic
1051857727 9:21588596-21588618 AATATTATTTTTCATGTTCCAGG + Intergenic
1052446325 9:28566007-28566029 GAAACTTTTTTTCATTTACCAGG + Intronic
1052477442 9:28978270-28978292 CACATTAATTTTCTTCTCCCTGG + Intergenic
1052499275 9:29268495-29268517 CACATTATTTTTTTCTTACAAGG - Intergenic
1053819268 9:41950393-41950415 AACATTAGTTTTCATTTCTCTGG - Intronic
1054109531 9:61094055-61094077 AACATTAGTTTTCATTTCTCTGG - Intergenic
1054611326 9:67237070-67237092 AACATTAGTTTTCATTTCTCTGG + Intergenic
1055409274 9:76010491-76010513 CACCTTATTTTTCATTAAAAGGG - Intronic
1055515457 9:77028895-77028917 TATATTATTTTTCATTTGCAAGG - Intergenic
1055689915 9:78818593-78818615 CACATTATGTCGGATTTACCAGG - Intergenic
1055689943 9:78819133-78819155 CACATTATGTTGGATTTACCAGG + Intergenic
1056502188 9:87220941-87220963 TTCATTATTTTTCATTTATAAGG + Intergenic
1056736398 9:89213623-89213645 CACATAAGTTTTCATTTCTCTGG - Intergenic
1057532795 9:95868193-95868215 CATTTTGTTTTTAATTTACCTGG + Intergenic
1058581405 9:106462368-106462390 CACATTACTTTTCCTTTCCACGG + Intergenic
1058789465 9:108427813-108427835 CAGTTTGTTTTTCATTCACCTGG + Intergenic
1059074178 9:111173663-111173685 CATTTTAATTTTCATTTTCCTGG - Intergenic
1062241433 9:135541644-135541666 GACATCAGTTTTCATTTCCCTGG + Intergenic
1186063744 X:5739372-5739394 CACAAGATCTTTCATTTAACAGG - Intergenic
1186716059 X:12252931-12252953 CAAATTATATTTGAGTTACCTGG + Intronic
1187630930 X:21170999-21171021 CAGATGATTTTTCATTATCCTGG - Intergenic
1188156748 X:26750111-26750133 CAGATTAATTCTAATTTACCAGG + Intergenic
1188401557 X:29751768-29751790 CAAATTATTTTTTAATTAGCTGG + Intronic
1190471971 X:50790994-50791016 AAAATTATTTTTTACTTACCAGG + Intronic
1190742470 X:53298858-53298880 CTCACTATTTTTAATTTCCCAGG + Intronic
1191026368 X:55918321-55918343 TACATCATTTTTCATGTTCCTGG + Intergenic
1192202578 X:69076173-69076195 CTCATGATATTTCATTTATCTGG - Intergenic
1193206883 X:78759754-78759776 CAGATGATTTACCATTTACCAGG - Intergenic
1193371212 X:80699282-80699304 CACACAACTCTTCATTTACCTGG + Intronic
1193386735 X:80882244-80882266 CTCTTTCTTTTTGATTTACCTGG + Intergenic
1193709933 X:84867699-84867721 AACATGAGTTTTCATTTCCCTGG + Intergenic
1195007328 X:100698895-100698917 CAAATTATTTTTCCTTTGTCAGG - Intronic
1195487544 X:105426367-105426389 TACATGAGATTTCATTTACCTGG + Intronic
1196167682 X:112553369-112553391 CATTTTCTTTTTCTTTTACCTGG + Intergenic
1196216406 X:113057403-113057425 CTCTTTATTTTTAATGTACCAGG + Intergenic
1196535643 X:116840301-116840323 CACAATATTATTCATTCACAGGG + Intergenic
1197252390 X:124229465-124229487 CTCATTAGTTTGCATTTACTAGG - Intronic
1198347560 X:135773705-135773727 AACATGAACTTTCATTTACCAGG + Intergenic
1198349465 X:135790966-135790988 AACATGAACTTTCATTTACCAGG + Intergenic
1198351370 X:135808239-135808261 AACATGAACTTTCATTTACCAGG + Intergenic
1198353279 X:135825505-135825527 AACATGAACTTTCATTTACCAGG + Intergenic
1198355186 X:135842759-135842781 AACATGAACTTTCATTTACCAGG + Intergenic
1198357096 X:135860042-135860064 AACATGAACTTTCATTTACCAGG + Intergenic
1198359010 X:135877321-135877343 AACATGAACTTTCATTTACCAGG + Intergenic
1198748171 X:139911746-139911768 CACAGGATTTTTTATTTTCCTGG - Intronic
1199417299 X:147599914-147599936 GACTTGGTTTTTCATTTACCAGG - Intergenic
1200963556 Y:9016358-9016380 CAGAATATATTTCATTTCCCAGG - Intergenic
1201538094 Y:15073526-15073548 CATCTTCTTTTTCATTTACAAGG - Intergenic
1201554806 Y:15256793-15256815 CACATTACTTTTCCTTCACTTGG - Intergenic
1201630493 Y:16066491-16066513 TACATCATTGTTCATTTACTGGG - Intergenic
1202163373 Y:21958938-21958960 AGCATAATTTTTCTTTTACCAGG + Intergenic
1202227983 Y:22627430-22627452 AGCATAATTTTTCTTTTACCAGG - Intergenic
1202315174 Y:23568746-23568768 AGCATAATTTTTCTTTTACCAGG + Intergenic
1202555627 Y:26101847-26101869 AGCATAATTTTTCTTTTACCAGG - Intergenic