ID: 918232663

View in Genome Browser
Species Human (GRCh38)
Location 1:182550378-182550400
Sequence CTGTCCCTCAAGGAGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918232655_918232663 24 Left 918232655 1:182550331-182550353 CCCAGTTCAGCAAGTGAAATGGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 918232663 1:182550378-182550400 CTGTCCCTCAAGGAGAGGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 261
918232657_918232663 23 Left 918232657 1:182550332-182550354 CCAGTTCAGCAAGTGAAATGGGA 0: 1
1: 0
2: 0
3: 5
4: 126
Right 918232663 1:182550378-182550400 CTGTCCCTCAAGGAGAGGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 261
918232658_918232663 -4 Left 918232658 1:182550359-182550381 CCTATTGAGATAGAACAGACTGT 0: 1
1: 0
2: 1
3: 18
4: 112
Right 918232663 1:182550378-182550400 CTGTCCCTCAAGGAGAGGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918232663 Original CRISPR CTGTCCCTCAAGGAGAGGGG AGG Intronic
901155677 1:7136356-7136378 CTGGCACACAAGGAAAGGGGTGG - Intronic
901760691 1:11469304-11469326 CTGTCCCTCAGGCAGTGGGGTGG + Intergenic
904090299 1:27940367-27940389 CTGTCTCTCATGGTGAGAGGGGG + Intronic
904118451 1:28179212-28179234 CTGTCCCTCCTGGAGGGTGGTGG - Intronic
904265951 1:29318704-29318726 CAGTCCCTGACGGGGAGGGGTGG - Intronic
904334422 1:29787568-29787590 CTGTGCCTCCAGGAGACCGGTGG - Intergenic
904626421 1:31807382-31807404 CTGTCTCAAAAGGGGAGGGGAGG + Intronic
905539382 1:38747848-38747870 CTGCGGCTCAAGCAGAGGGGAGG - Intergenic
907637107 1:56146305-56146327 CTGAAGCTCAAAGAGAGGGGTGG + Intergenic
908281722 1:62545527-62545549 CTGTCCCTAAAAGAGAGTGAAGG - Intronic
908360977 1:63367943-63367965 CTGGCCCTCAAGAGGAGGGGCGG + Intronic
912517330 1:110224648-110224670 CTGTCCCTCAAGGATGGGAAAGG + Intronic
913114672 1:115685134-115685156 CTGTCCCTCAGAGAGTGGAGAGG - Intronic
916592614 1:166206907-166206929 CTGACCCACCAGGAGAGGAGAGG + Intergenic
917061766 1:171049048-171049070 CTTTCCCTTGAGGAGAGGAGAGG - Intronic
918127473 1:181597038-181597060 CTTTCCTTCAAAGGGAGGGGAGG - Intronic
918232663 1:182550378-182550400 CTGTCCCTCAAGGAGAGGGGAGG + Intronic
920099411 1:203507673-203507695 CTTTCTCTCACGGAGAGGAGGGG - Intronic
920528321 1:206684861-206684883 CGGTCCTTAAAGGGGAGGGGCGG - Intergenic
921054136 1:211531408-211531430 CTGTGCCTCATTGAGATGGGAGG + Intergenic
921406106 1:214781227-214781249 TTGTCCCCCAAGGAGAGAGATGG - Intergenic
921462302 1:215443841-215443863 GTGTCCCCGAAGGAGACGGGGGG - Intergenic
922333982 1:224604389-224604411 CTGTCTCTGACGGGGAGGGGTGG + Intronic
922992317 1:229924854-229924876 CCTTCCCTCAAGGGGAAGGGAGG - Intergenic
1063354972 10:5389534-5389556 TTCTCCCTCAAGGAGTGAGGAGG - Intergenic
1066457606 10:35585519-35585541 CTGTTTCTGAAGGAGAGGCGTGG - Intergenic
1067004264 10:42646251-42646273 GTGTCCCTCAAGGTGAGTGTGGG + Intergenic
1069678508 10:70266765-70266787 CAGGCCCTGAAGGAGATGGGAGG + Intronic
1072090813 10:92125485-92125507 CTGTCCCACTATGAGAGGTGAGG + Intronic
1072346429 10:94512013-94512035 CTGTCCCTAAAGGATAGGGGAGG + Intronic
1072750895 10:97977925-97977947 CTGTTCCTGATGGGGAGGGGAGG + Intronic
1077285251 11:1762728-1762750 CTGTCCTCCTTGGAGAGGGGAGG + Intronic
1077955438 11:7014611-7014633 CTGCCCCTTTAGGAGAGGGGTGG + Intronic
1080094923 11:28394470-28394492 CTGGCTCACAAGGAGGGGGGTGG + Intergenic
1080132944 11:28817873-28817895 CAGTGCCTCAGGGAGAGGGTAGG + Intergenic
1080602084 11:33829978-33830000 AGTTCCCTCAAGGAGAGAGGTGG + Intergenic
1080862219 11:36159838-36159860 CTGGCCCTCCAGGGTAGGGGTGG - Intronic
1081722215 11:45298696-45298718 CTGTGCCTCAAGAGGAGGGCAGG + Intergenic
1081883601 11:46475603-46475625 CTGTCTCTGAAGGAAAGGGTTGG - Intronic
1082079429 11:48000674-48000696 CAGGCCCTGAGGGAGAGGGGCGG - Intronic
1083103351 11:60333567-60333589 CTGGTCCTGAAGGAGAGGGTTGG + Intergenic
1083313922 11:61802565-61802587 CTTTCTCTAAAGTAGAGGGGAGG - Intronic
1083817879 11:65147352-65147374 CCGTCCCTCATGGAAAGGTGGGG + Intergenic
1084390740 11:68875133-68875155 CTGTCACCCAGGGAGTGGGGTGG + Intergenic
1084889867 11:72231369-72231391 CAGTCCGTCAGGAAGAGGGGTGG + Intronic
1085043357 11:73339747-73339769 CTGCCCCTCCTGGAGTGGGGTGG + Intronic
1086879058 11:92132670-92132692 TTGTCCCTAAAGGAGTGAGGAGG + Intergenic
1088792790 11:113241020-113241042 CCTTCCCTGAAGGAGAGGCGAGG + Intronic
1091028000 11:132159179-132159201 CAGCCCCTCAAGGAGAGAGGGGG - Intronic
1091124091 11:133081164-133081186 ATGTCCCTGGTGGAGAGGGGAGG + Intronic
1093086270 12:14869330-14869352 CTCTCCCTGAGGGAGAGGTGTGG - Intronic
1093160514 12:15741288-15741310 CTGTCCCTAGTGGAGGGGGGTGG - Intronic
1093884212 12:24440745-24440767 TACTCCCTCAAGGAGAGGTGAGG + Intergenic
1096153849 12:49331070-49331092 CTCTCCCTCAGGAAGAGGGGAGG + Intronic
1096791235 12:54046516-54046538 ATTTCCCTCAAGGAGAGAAGGGG - Intronic
1097181927 12:57176663-57176685 ATGTCCATCAACGAGGGGGGAGG + Intronic
1097473704 12:60027340-60027362 CTGTCCCCCAAGCACAGGGAGGG + Intergenic
1101163733 12:102006744-102006766 TTGTCCCTCAAATAGAGTGGAGG + Intronic
1101979033 12:109389400-109389422 CTGCCCCTGAAGGTGAGGGGTGG + Intronic
1102077933 12:110074758-110074780 CAGTCACTCAAAGACAGGGGTGG + Intergenic
1102953569 12:117045651-117045673 ATGTCCCTCAAGGACAGGCTTGG + Intronic
1103061801 12:117864118-117864140 CTCTACCTGGAGGAGAGGGGAGG + Intronic
1103154033 12:118667904-118667926 CAGTCCCTCAAGGAGAGCTGAGG - Intergenic
1103233230 12:119350039-119350061 CCTTCCCTCAAGGAGAAGAGTGG + Intronic
1103565025 12:121811243-121811265 CTGGCCCTCAGGCAGAGGGGAGG + Intronic
1104158245 12:126153775-126153797 CTGTCCCTCCAGGTGAGAAGGGG + Intergenic
1105209424 13:18249092-18249114 GTGGCCCAGAAGGAGAGGGGAGG + Intergenic
1105303255 13:19153285-19153307 CTCTGCATCAAGGAGAAGGGTGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1107444557 13:40458584-40458606 ATGGTCCTGAAGGAGAGGGGTGG + Intergenic
1110169804 13:72487173-72487195 ATGTCTTTCAAGGAGATGGGAGG + Intergenic
1111764668 13:92513150-92513172 CTGTTCTTCTAGGAGAAGGGCGG + Intronic
1112494576 13:99894975-99894997 CCGTCCCTGGAGGAGAGGAGGGG - Exonic
1112538136 13:100281484-100281506 ATGTCCCCCAAGGATAAGGGGGG + Intronic
1113777109 13:112954134-112954156 TTGTCACCCGAGGAGAGGGGAGG + Intronic
1115497830 14:34024563-34024585 CTGACCGGGAAGGAGAGGGGAGG - Intronic
1116342378 14:43740355-43740377 CAGTCCCTGAAGGAGAGATGGGG - Intergenic
1116677045 14:47919791-47919813 TGAGCCCTCAAGGAGAGGGGTGG - Intergenic
1117911311 14:60641004-60641026 CTCTCCCGAAAGGAGAGGGGAGG + Intergenic
1118756045 14:68844357-68844379 CTGTCCCAAAAGAAGAGGGGTGG - Intergenic
1119024779 14:71143862-71143884 CTGACCTTCAAGGAGAGGAAAGG + Intergenic
1119474047 14:74917019-74917041 CTGACACTCAAGCAGTGGGGAGG + Intronic
1119727204 14:76928751-76928773 CTGTCCATCAAAGAGGGGGATGG - Intergenic
1119728882 14:76938622-76938644 CAGTCCCTGGAGGAGAGGAGGGG - Intergenic
1122296344 14:100708477-100708499 CTGGCCCTCCAGGTGAGGGCTGG + Intergenic
1124347269 15:28931095-28931117 CTGTGCCTCATGGAGGGGGCTGG - Intronic
1124691743 15:31829187-31829209 CTGTCCTCCAAGGAGAGGGAGGG - Intronic
1124870463 15:33536512-33536534 CTGTCCCTGAAGCAGTGGGATGG - Intronic
1126872629 15:53006137-53006159 GTGTTCCTCAAGGAATGGGGTGG + Intergenic
1128917029 15:71572540-71572562 CTTGCCCTCAGGGAGAGGGGTGG + Intronic
1129112418 15:73345217-73345239 CTGTGATTCAAGGAGAGGGTAGG + Intronic
1129458085 15:75686390-75686412 CTGTGCCTCCAGGAGGGGTGGGG - Intronic
1129704903 15:77788554-77788576 CTGGCCCTCAAGGAGTGCCGAGG - Intronic
1129763701 15:78147813-78147835 CTGTGCCTGAAGGGGAGGGCAGG + Intronic
1130273729 15:82465681-82465703 CTGTGCCTCTAGGAGGGGTGGGG + Intergenic
1130466077 15:84193052-84193074 CTGTGCCTCTAGGAGGGGTGGGG + Intergenic
1130498186 15:84480484-84480506 CTGTGCCTCTAGGAGGGGTGGGG - Intergenic
1130588369 15:85197648-85197670 CTGTGCCTCTAGGAGGGGTGGGG + Intergenic
1130799156 15:87243522-87243544 CTTTCCCTAAAGGAGAAGAGAGG + Intergenic
1130878285 15:88032814-88032836 CTCTCCCTCCTGGGGAGGGGAGG - Intronic
1130966438 15:88700984-88701006 CTGTGCCTCAGGGAGATGGGGGG + Intergenic
1132270623 15:100520760-100520782 CTGTCCCACTAGGAGTGGGCAGG + Intronic
1132598116 16:762392-762414 CTGCCCTTCTGGGAGAGGGGTGG + Intronic
1132763672 16:1523817-1523839 CTGTACCACAAGGTGAGGGCTGG - Exonic
1133737533 16:8627351-8627373 CTGTCCCTCAAACACAGGGAGGG + Intronic
1133976280 16:10601771-10601793 CTGGCCCTCAAGGAGCCGAGAGG + Intergenic
1138371963 16:56534127-56534149 CTCTTCCTCAAGGAGAGGAAGGG + Intergenic
1138553230 16:57758439-57758461 CCCTCCTTGAAGGAGAGGGGCGG + Exonic
1138905352 16:61324845-61324867 CTGTCCCTCAATGATAGAGGTGG + Intergenic
1141842982 16:86586261-86586283 CTTTCTCCCCAGGAGAGGGGTGG - Intergenic
1144036650 17:11371881-11371903 CTTTCCTTTGAGGAGAGGGGTGG - Intronic
1146931783 17:36782953-36782975 CTCTCCCTCTAGGTGTGGGGTGG + Intergenic
1147155843 17:38544156-38544178 GTCTCCCTGCAGGAGAGGGGTGG + Intronic
1147383189 17:40067642-40067664 CTGCCCCTCAAGGTGAAGGAAGG + Intronic
1148439950 17:47706800-47706822 CTAACCCTAAAGGAGAGGAGGGG - Intronic
1149442670 17:56688342-56688364 CTGTCCCTACAGCAGAGTGGAGG + Intergenic
1151512598 17:74570429-74570451 CTGTCCCTCAAGGGCAGCGATGG - Intergenic
1151670741 17:75570482-75570504 CTGGCCCCCCAGGAGAGGTGAGG + Exonic
1152092166 17:78253000-78253022 CTGCCGCTCAAGGAGAGGCTGGG - Intergenic
1152713603 17:81887518-81887540 CTGTGCCTCCAGGTGAGGGGAGG - Intergenic
1152881718 17:82820562-82820584 GAGTCCCACAAGGAGAGGAGAGG - Intronic
1155025387 18:21935917-21935939 GTGTCCCTCATGGAGGGGGGCGG - Intergenic
1155549519 18:26950142-26950164 CTGTTCCTCAAGGTACGGGGAGG + Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157535403 18:48453655-48453677 CTGTCTGTCTAGGAGAGGTGGGG + Intergenic
1158618349 18:59008347-59008369 CTGTCTCCCATGGTGAGGGGAGG - Intergenic
1158950944 18:62494165-62494187 GTGTCCCCCAAGGATAAGGGGGG + Intergenic
1158988760 18:62847261-62847283 CTGTCCAGCAAGGAGAGATGGGG + Intronic
1161851524 19:6740141-6740163 CTGTCCGGCTAGGAGGGGGGAGG + Intronic
1162646372 19:12053050-12053072 CTGTCACTCAGGGAAGGGGGCGG - Intergenic
1164433506 19:28208349-28208371 CTGTCCCAGGGGGAGAGGGGTGG + Intergenic
1164512564 19:28909614-28909636 GTGTCCCTCAGGGAGTCGGGGGG + Intergenic
1164520050 19:28972237-28972259 CTGACACTCAGGGAGAGGGCTGG - Intergenic
1165152696 19:33770331-33770353 CTATCCCTTAAGGAGAGAGCTGG - Intronic
1166258614 19:41622538-41622560 CTCTCCCTCAAGGTGATGTGAGG - Intronic
1166718720 19:44985480-44985502 CTGTCTCTCAGGGAGTGAGGAGG + Intronic
1167491137 19:49793163-49793185 CTGCCTCTCAGGGAGAGTGGGGG - Intronic
1167590880 19:50403586-50403608 CAGACCCTCAAGGTGAGGGCTGG + Exonic
1167772478 19:51529932-51529954 CTGGCCCTCCAGGACAGGGAGGG + Exonic
925057288 2:864969-864991 CTGACTTTCAAGGAGAGGAGGGG + Intergenic
926367812 2:12149342-12149364 CTGTCCTACAAGGAGAAGAGAGG - Intergenic
926590129 2:14732001-14732023 CTGTCCCTGCAAGAGAGGGAAGG - Intergenic
927042271 2:19241413-19241435 CTGCCCCTCAAGGTTGGGGGAGG - Intergenic
927698772 2:25254325-25254347 ATGGCCCTCAGGGGGAGGGGGGG - Intronic
931418300 2:62101938-62101960 CTGACCTTCAGGGAGAGGAGAGG - Intronic
932135602 2:69226104-69226126 CTGTTCCTCAATGAGGGGGTTGG + Intronic
932454940 2:71843555-71843577 CTGTCCCTCCAGGACAGGCCTGG + Intergenic
932626539 2:73300908-73300930 CTTGCCCTCAAGGACAAGGGAGG - Intergenic
932763297 2:74454726-74454748 GAGTTCCTCAAGGACAGGGGCGG + Intergenic
934692657 2:96373570-96373592 GTGACCATCTAGGAGAGGGGAGG + Exonic
934882849 2:97998265-97998287 GTGTCCCTCAGGCACAGGGGAGG - Intergenic
935295317 2:101644225-101644247 TTGTGCCTCAAGGAAAAGGGAGG + Intergenic
935807898 2:106767081-106767103 TTGTGCCTCAAGGAGACAGGAGG - Intergenic
937868071 2:126768768-126768790 CTGTGTCTCCAGGAGAGGTGGGG + Intergenic
938244180 2:129764636-129764658 CTGACCATCTAGGTGAGGGGGGG + Intergenic
938785549 2:134625446-134625468 CTTTCCATCAGGGAGAGGAGCGG + Intronic
941470882 2:165885433-165885455 CTGTTCCTCTAGGTAAGGGGTGG + Intronic
944796868 2:203195930-203195952 CTTTCCCTCAATGACAAGGGTGG - Intronic
946313333 2:218894925-218894947 CAGACCCTCAAGGAGGAGGGCGG + Intronic
947308869 2:228778345-228778367 CTGTCCAGCAAGGAGATGGAGGG - Intergenic
1169052928 20:2595772-2595794 CTGTGTCTCCAGGAGAGGAGTGG + Intronic
1170736475 20:19017600-19017622 CTGAGCCTCTAGGAGAGGAGGGG - Intergenic
1172083330 20:32358970-32358992 CAGCCCCGCAAGGCGAGGGGTGG + Intronic
1172170065 20:32924889-32924911 CTGCTCCTCAAGGAGTGGTGCGG - Intronic
1172697658 20:36833519-36833541 CTGATCCTCAGGGAGAGGGATGG + Intronic
1173001191 20:39106936-39106958 CTGTCACTCAAAGAGAGGCCTGG - Intergenic
1175514639 20:59561240-59561262 CTGTCCCTCCAGCTGAGGTGTGG - Intergenic
1175837966 20:62008450-62008472 CTGTGGGTTAAGGAGAGGGGAGG + Intronic
1176161080 20:63649165-63649187 CTGTCCCTCAAGGAGCAAGTGGG + Intronic
1176376001 21:6087178-6087200 CTGTGCCTCCATGAGCGGGGAGG + Intergenic
1178371213 21:32028995-32029017 CTGTCCCTTAGGCTGAGGGGAGG - Intronic
1178840802 21:36136104-36136126 ATCTTCCTTAAGGAGAGGGGCGG + Intronic
1178967113 21:37131279-37131301 CTGACCTCCAAGGAGAGGAGGGG + Intronic
1179551544 21:42146750-42146772 CTGTCCCTCCTGGGGAGGAGGGG + Intergenic
1179551561 21:42146804-42146826 CTGTCCCTCCTGGGGAGGAGGGG + Intergenic
1179747474 21:43451066-43451088 CTGTGCCTCCATGAGCGGGGAGG - Intergenic
1180947404 22:19704110-19704132 CTCTCCCTCAGGGACCGGGGTGG + Intergenic
1181032375 22:20154759-20154781 GTGTCCCTGAATGAGTGGGGTGG + Intergenic
1181625058 22:24117594-24117616 CTGTCTCTCTGAGAGAGGGGCGG + Intronic
1182427525 22:30282827-30282849 CGGTCCCTCAGGGAGAGGGAGGG - Intergenic
1182436569 22:30334607-30334629 CTGGCCCTCAAGGAGAGAGGCGG - Exonic
1183354603 22:37351429-37351451 CTGTCACTCGAGGAGAGGTGAGG - Intergenic
1183631414 22:39035247-39035269 GGGTCCATCAAGGAGAAGGGTGG - Intergenic
1183637238 22:39071718-39071740 GGGTCCATCAAGGAGAAGGGTGG - Intronic
1183812863 22:40272409-40272431 CTGTCCTTCAAGGAAAGGCCTGG + Intronic
1184075936 22:42177987-42178009 CTGTCCTTCCTGGAGTGGGGTGG - Intronic
1184439626 22:44501131-44501153 CTGACCAGCAAGGAGAGAGGAGG + Intergenic
949918677 3:8984798-8984820 CTGCCCCTCAAGGAAGGGTGGGG - Exonic
950498479 3:13348775-13348797 CCGTGCCTCAAGGAGGGGGAGGG - Intronic
950553657 3:13682469-13682491 CTGCCCCACAGGGAGAAGGGTGG + Intergenic
952040118 3:29251367-29251389 CTGGCCTTCAAGGAGTTGGGGGG + Intergenic
952495811 3:33914869-33914891 GTGGCCATCAAGTAGAGGGGCGG + Intergenic
952496919 3:33924247-33924269 CTGGCCCTCAAGGGGATAGGAGG - Intergenic
952905074 3:38134435-38134457 CTGTATTTCAAGGTGAGGGGTGG + Intronic
953655648 3:44851259-44851281 CTGTCCCTAAAGGGGGGTGGGGG + Intronic
953770507 3:45775849-45775871 CCGTCCCTCCAGGAGAACGGGGG - Exonic
954458822 3:50614477-50614499 CTGTCCTTACTGGAGAGGGGAGG - Intronic
955052085 3:55422909-55422931 CTGTTGCACAAGGAGACGGGTGG - Intergenic
955344557 3:58151451-58151473 GTGTGCCTCAAGGTGGGGGGAGG + Intronic
960725772 3:120668281-120668303 CTGTCCCTGGTAGAGAGGGGTGG + Intronic
961354490 3:126327406-126327428 CTGTCCCTCAGGGAGCTGGAAGG + Intergenic
962685651 3:137845196-137845218 CTGCCTATGAAGGAGAGGGGAGG + Intergenic
965317293 3:167208404-167208426 CTTCTCCTCAAGGAGAGGGAAGG - Intergenic
967631408 3:191746513-191746535 CTGGGCCTGAAGGGGAGGGGAGG - Intergenic
968513747 4:1006941-1006963 CTGTCCCTCAAGCAGAAGGAAGG - Intergenic
969582276 4:8072304-8072326 CAATCCATCAAGGGGAGGGGGGG + Intronic
970368619 4:15386108-15386130 CTGTCCCTCAGAGAGCAGGGAGG + Intronic
970637166 4:18021910-18021932 CGCTCCCTCAGGGAGAGGCGGGG + Intergenic
971400519 4:26271380-26271402 CTCTTCATAAAGGAGAGGGGAGG + Intronic
971582652 4:28362418-28362440 GTGTTCCTCAAGCAGAGGGCAGG + Exonic
976312641 4:83627631-83627653 CTGTTCCTCAAGAGGAGTGGTGG + Intergenic
978003264 4:103583278-103583300 CTGTCCATCATTGAAAGGGGAGG + Intergenic
978157928 4:105510581-105510603 CTGTTCCCCAAGCAGAGGAGAGG - Intergenic
981745918 4:148052272-148052294 CTGGCCCTCAAGGAGTGCTGGGG - Intronic
981761216 4:148197111-148197133 CTGTGCCTCAAGGCCAGGAGAGG + Intronic
983606414 4:169591148-169591170 CTATCCCTAAAGAAGTGGGGGGG - Intronic
983771729 4:171558266-171558288 CTGTCTCTCAAGAAGAGAGTAGG + Intergenic
984847195 4:184117890-184117912 CTGTCCCTCCAGGAGTGGCCGGG - Exonic
985531835 5:438503-438525 CTGACCCTCAGTGACAGGGGAGG - Intergenic
985867851 5:2529286-2529308 CTCTGCCTCAAGTGGAGGGGTGG + Intergenic
988669763 5:33368813-33368835 CTGTCTCTCAAGGAATAGGGAGG + Intergenic
989363873 5:40634380-40634402 CAGTCCCTCATGGCTAGGGGAGG - Intergenic
989772742 5:45164201-45164223 CTTACACTCCAGGAGAGGGGAGG + Intergenic
990149417 5:52800028-52800050 CCGTCCCCAAAGGAGAGGCGGGG - Exonic
990769219 5:59223472-59223494 TTTGCCCTCAAGGGGAGGGGAGG + Intronic
990908252 5:60826162-60826184 ATGGTACTCAAGGAGAGGGGTGG + Intronic
992040818 5:72829535-72829557 GTTTCCCTCAAGGATAGGAGTGG + Intronic
992491374 5:77247730-77247752 CTGGCCCTCAGGGAGGGGGAAGG - Intronic
992570859 5:78055717-78055739 CTCTCCTTCAAGGAGAGAGGTGG + Intronic
995712223 5:115047537-115047559 CAGTCCCACAAGGAGCTGGGAGG + Intergenic
996347560 5:122503134-122503156 CTGTCCCTAAGGGATAGGGTGGG - Intergenic
997453743 5:134003354-134003376 CTATCTCCCCAGGAGAGGGGAGG + Intronic
997622494 5:135307863-135307885 CTGGCCCCCCAGGAGAGAGGAGG - Intronic
998855894 5:146394897-146394919 TTCACCCCCAAGGAGAGGGGTGG + Intergenic
999290182 5:150419855-150419877 TTGTCCCTCAAGGAGGGGGACGG - Intergenic
1000347047 5:160322942-160322964 ATGTCCCTCAAGGCCAGGCGCGG + Intronic
1002293933 5:178218299-178218321 CTGTCCCAGAAGGAGAGGAAAGG + Intronic
1003234392 6:4282701-4282723 CTGACACTCAGGGAGAGGTGTGG + Intergenic
1003257476 6:4487155-4487177 CAGTCCTTCAAGGGGAGGAGGGG + Intergenic
1003523073 6:6875134-6875156 CTGTCACTTAATGAGAGAGGGGG + Intergenic
1007388830 6:41538050-41538072 GTGTCCCACAGGGAGACGGGGGG + Intergenic
1007393754 6:41565552-41565574 ATGTCCCCCCAGGTGAGGGGTGG - Intronic
1007408515 6:41648497-41648519 CTGGAGCCCAAGGAGAGGGGAGG - Intronic
1011088089 6:83565243-83565265 TTGTCCCTGATAGAGAGGGGAGG - Intronic
1013188729 6:107783973-107783995 CTGCCCCTCAAGCTTAGGGGTGG + Intronic
1015254844 6:131166655-131166677 CTGCCCCTCCAGAATAGGGGTGG - Intronic
1015840648 6:137473407-137473429 CTGTGCCTCAGAGGGAGGGGAGG + Intergenic
1018797761 6:167200448-167200470 GTGTCCCTGAAGGATAAGGGGGG + Intergenic
1019406839 7:888472-888494 CTGTCGCTCAGGGAGAAGGTCGG - Intronic
1022846740 7:34217453-34217475 ATGACCCTAAAGGAGAGGTGAGG - Intergenic
1026972795 7:74478194-74478216 CTGTCCCTCCACGCAAGGGGCGG - Intronic
1028542857 7:91963255-91963277 CTGTTCCTCAAGGAGACATGAGG + Intronic
1029618721 7:101676677-101676699 CTGTCCCTCCAGGCGAGGCTGGG - Intergenic
1030827997 7:114185650-114185672 GTTTCCCTGAAGGAGAGGTGTGG - Intronic
1034406253 7:150904420-150904442 ATGTCCCTCCAGGACAGTGGTGG + Intergenic
1035644072 8:1205091-1205113 CTGTCCGTCAAGGAGGGGCCAGG + Intergenic
1037068277 8:14610745-14610767 CACTGCCTCAAGGAGAGGGAAGG + Intronic
1038152985 8:24958902-24958924 CTGCCCAGAAAGGAGAGGGGCGG + Intergenic
1041447260 8:57966181-57966203 CTGACTCACAAGGAGAGAGGAGG + Intergenic
1042212240 8:66392340-66392362 CTATCCTTCTAGGAGAAGGGAGG - Intergenic
1042884298 8:73530908-73530930 CTGTCCCTCAGGGCCAGAGGGGG + Intronic
1043284155 8:78508764-78508786 CTTCCCCTAAAAGAGAGGGGAGG - Intergenic
1044501776 8:92966073-92966095 CTGTCACTCAGGGGCAGGGGCGG + Exonic
1047324056 8:123819451-123819473 CTGTCCCCCGAGGAAAGAGGAGG - Intergenic
1048412140 8:134186138-134186160 ATATCCCCCAAGGAGAGGGAGGG - Intergenic
1049032156 8:140046073-140046095 GTGTTCCTCAGGGAGAAGGGTGG - Intronic
1050276827 9:4009401-4009423 CTGCCACTCAAGAAGATGGGCGG + Intronic
1051098718 9:13496770-13496792 AAGTCACTCAAGGTGAGGGGAGG - Intergenic
1053214247 9:36257988-36258010 CTGTCCCGTTAGGAGCGGGGCGG - Intronic
1053479512 9:38405581-38405603 CCGTCCCTGGAGGAGAGGGCAGG + Intergenic
1057827721 9:98383539-98383561 AGGTCCCTCCAGGAGAGGAGAGG + Intronic
1059284848 9:113163360-113163382 CTGTCCCTCAAAGACAGAAGAGG - Exonic
1059750549 9:117243745-117243767 CTGTACATCATGGGGAGGGGTGG - Intronic
1060903841 9:127287056-127287078 CAGGCCCTTTAGGAGAGGGGAGG - Intronic
1061591973 9:131603583-131603605 CTGTCCCTCATGCAGAGGGAGGG - Intronic
1061611523 9:131749785-131749807 CTGACACCCAAGGAGAGTGGAGG - Intergenic
1062334822 9:136060505-136060527 CTGACCCTCAGGGAGGGGAGAGG - Intronic
1062567107 9:137168276-137168298 CGGTGCCGCAAGAAGAGGGGAGG - Exonic
1186692872 X:11997807-11997829 ATGTACCTCAAGGAGAAGAGAGG + Intergenic
1187191462 X:17039101-17039123 CTGACCAGCAAGGACAGGGGTGG + Intronic
1187325077 X:18278866-18278888 CTGCCACTCGAGGAGAGGAGGGG + Intronic
1188063845 X:25633411-25633433 TTGCCCCTTAAGCAGAGGGGTGG + Intergenic
1188300819 X:28504331-28504353 CTGTCCCTCAATGATAGATGTGG - Intergenic
1192150054 X:68706532-68706554 CTGTCCCCCAGGGAGAGAGGTGG + Intronic
1192952531 X:76032350-76032372 CTGTATCTCTAGGAGAAGGGGGG - Intergenic
1193151799 X:78133125-78133147 CAATCCCTCAAGGATAAGGGGGG + Intronic
1193287649 X:79731789-79731811 CTTTCACTTGAGGAGAGGGGAGG + Intergenic
1196942830 X:120794481-120794503 CAGCCCCTCCAGGAGAGGGAGGG + Intergenic