ID: 918232875

View in Genome Browser
Species Human (GRCh38)
Location 1:182551516-182551538
Sequence GGTTTAATGGAGATAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918232875 Original CRISPR GGTTTAATGGAGATAGAGCA GGG (reversed) Intronic
900132181 1:1091849-1091871 AGTTAAATGGAGATGGGGCAGGG + Intronic
900429617 1:2595545-2595567 GGTTTAATGGGGACAGAATATGG + Intronic
901535266 1:9878671-9878693 AGGTTAATGGAGCAAGAGCATGG + Intronic
902124112 1:14194222-14194244 AGTGGAATGGAGATTGAGCAAGG + Intergenic
905352694 1:37358557-37358579 GGTCTAAGGGACATGGAGCAGGG + Intergenic
905503068 1:38454644-38454666 GGCTTACTGGACATAGAGAAGGG + Intergenic
912095533 1:106137639-106137661 TGTATAATGGAGACAGAGCAAGG - Intergenic
915666193 1:157446839-157446861 GGTTTAGTGAAGATAGTGAAAGG - Intergenic
916354393 1:163888478-163888500 GTTTTAAGGGAGATAGTGCTGGG + Intergenic
917083932 1:171286375-171286397 CTTTTAATGGAGAGAAAGCAGGG + Intergenic
917644658 1:177018235-177018257 GCTTTAATGGAGTTACAGAACGG + Intronic
918186221 1:182129874-182129896 ACTTTAATGGAGAAAGAACAGGG + Intergenic
918232875 1:182551516-182551538 GGTTTAATGGAGATAGAGCAGGG - Intronic
919850138 1:201666956-201666978 GGCTTCATGGAGAGGGAGCATGG - Intronic
920834519 1:209496937-209496959 GATTTAATGGAGGTAGAGAGTGG - Intergenic
923065076 1:230510079-230510101 GGTTTAATGGAGAGACAGGATGG + Intergenic
923266918 1:232323473-232323495 TGTTGAATGGAGATTGAGAAAGG + Intergenic
923954962 1:239006014-239006036 TGGTTAAAGGAGGTAGAGCAAGG - Intergenic
1063635109 10:7775124-7775146 GGGGAAATGGGGATAGAGCAGGG - Intronic
1065762015 10:28991290-28991312 GGATTAAAGGAGATAAAGTATGG + Intergenic
1066702830 10:38148178-38148200 GGTTTAGTGTAGATAAACCAAGG - Intergenic
1069205382 10:65676146-65676168 GTGATAATGGAGCTAGAGCAAGG - Intergenic
1069426748 10:68295075-68295097 AGTTTAATGGACAAAGATCAGGG - Intronic
1071264383 10:83951654-83951676 GCCTTATTGGATATAGAGCAAGG + Intergenic
1072745627 10:97937285-97937307 GGTTTAAAGGAGATGAAGGAGGG - Intronic
1073182226 10:101591065-101591087 TTTTTAGGGGAGATAGAGCAAGG + Intronic
1074300733 10:112231394-112231416 GATTTAAAGGATATAAAGCAGGG + Intergenic
1074340742 10:112626691-112626713 GGTCAAAAGGAGATAGAGCCAGG + Intronic
1074644159 10:115425462-115425484 TGTCTAATAGAGATATAGCATGG - Intronic
1075326500 10:121536487-121536509 GGTGTAATGTAGAGAGAGCGTGG - Intronic
1076604455 10:131680448-131680470 GGTTAAAAGGAGGCAGAGCAAGG - Intergenic
1077797160 11:5504875-5504897 TCTTTAATGAAGCTAGAGCAAGG + Intronic
1078796945 11:14601569-14601591 GGCTTAATGTAAATAGAACAAGG + Intronic
1078918674 11:15806114-15806136 GTTTTCATGAAGAGAGAGCAAGG + Intergenic
1080009287 11:27441285-27441307 GGTTTAATGGAGAATGAGAATGG - Intronic
1084354970 11:68632259-68632281 GGTGGAATGGAGAGAGAGAACGG - Intergenic
1084355966 11:68638896-68638918 GGTGGAATGGAGAGAGAGAATGG - Intergenic
1084627912 11:70323124-70323146 GGTTTAATGGAGGCACAGCCTGG - Intronic
1085636478 11:78163152-78163174 GGATTAAAGGAGACAGTGCATGG - Intergenic
1085830982 11:79900809-79900831 GGTTTCATGGAGGTAGAGAGTGG + Intergenic
1089139267 11:116273195-116273217 GGTTTAGGGGAGAGAGAGGAAGG + Intergenic
1089792259 11:120953627-120953649 GGTTTCCTGGGGATAGGGCAGGG - Intronic
1090557535 11:127892630-127892652 GGTTTCATGGAGAAAGAAGATGG + Intergenic
1090931866 11:131304894-131304916 GGTGTAAGGGAGATAGAGTGTGG + Intergenic
1090943453 11:131409262-131409284 TGTATAATGGAGATTGAGAATGG + Intronic
1093376848 12:18439661-18439683 GGTTTAGTGGAGATAAAGAAAGG - Intronic
1095182445 12:39161571-39161593 GGTTTCATGGAGAAAGCACATGG + Intergenic
1096321620 12:50619149-50619171 GTCTTAATGGACAGAGAGCAAGG - Intronic
1096401275 12:51308623-51308645 GGTTTAATGTAGATCTAGGAGGG + Intronic
1098845908 12:75535396-75535418 GGTTTAATGAAGATTGTTCAAGG - Intergenic
1101856535 12:108448174-108448196 TTTTTAAAGGAGAAAGAGCAAGG - Intergenic
1102725931 12:115064781-115064803 GGTTTAAATGAGATAAAACATGG - Intergenic
1102791710 12:115651936-115651958 GGGTGAATGGAGACACAGCACGG - Intergenic
1103127413 12:118435941-118435963 TGTTTAATAGAGATAGGGGATGG + Intergenic
1104324452 12:127783159-127783181 GGGCTGAGGGAGATAGAGCATGG - Intergenic
1105211084 13:18257509-18257531 GGTGGCATGGGGATAGAGCAGGG + Intergenic
1105974889 13:25464726-25464748 GGTTCAAGGGAGACAGAGAAGGG + Intronic
1108177985 13:47813536-47813558 GGATTAAAGGAGATAGGGCACGG - Intergenic
1108484912 13:50913741-50913763 AGTTTCATGGAGGTAGAGGATGG + Intronic
1108876592 13:55056777-55056799 GGTTCAAAGGAGATAGACAAAGG + Intergenic
1109763546 13:66863314-66863336 GGATTAATTGAGATAATGCATGG + Intronic
1112978417 13:105350860-105350882 TGATTAATGTAGATACAGCATGG - Intergenic
1114708980 14:24758278-24758300 GGTTTATAGGAAATAGAGGATGG + Intergenic
1115816479 14:37169487-37169509 GGTTTATTGGAGAGATACCAGGG - Intronic
1116678105 14:47931615-47931637 GGATTAAATGAGATAAAGCATGG + Intergenic
1118565142 14:67131430-67131452 GGTTTCATGGAAAGAGAGAATGG - Intronic
1119136773 14:72228530-72228552 GGTTCAGTAGAAATAGAGCAAGG + Intronic
1120917891 14:89726070-89726092 AGTTTAATGGAGATACACAAGGG + Intergenic
1121082777 14:91121776-91121798 AGTATACTGGGGATAGAGCAGGG + Intronic
1122057865 14:99117133-99117155 GGATTAAATGAGATAGTGCATGG - Intergenic
1123892914 15:24799178-24799200 GGTTTAAGGGAGGAAGAACACGG + Intergenic
1127637446 15:60884877-60884899 GGTTTTAGGGACATAGAGCAAGG + Intronic
1129486456 15:75878247-75878269 TGTTTTATGGAGTTAGAGCAGGG + Intronic
1131429520 15:92375571-92375593 TGTTTGATGGAGATAGACAATGG + Intergenic
1132726068 16:1338885-1338907 GGTTTCCTGGAGAAAGAGCCGGG - Exonic
1133283701 16:4680931-4680953 GGTTTTGTGGGGACAGAGCAGGG + Intronic
1135979628 16:27137378-27137400 TCTTTAACTGAGATAGAGCAGGG - Intergenic
1138272451 16:55704960-55704982 CATTTAATGGAGAGAGAGTATGG + Intronic
1138356153 16:56382393-56382415 TGTTTAATGGGTATAGAGCAAGG + Intronic
1140282109 16:73564386-73564408 GGGATAATGGAGATGAAGCAGGG - Intergenic
1142012514 16:87723063-87723085 GGTGTAATGGCGCCAGAGCAAGG + Intronic
1144452434 17:15392143-15392165 TGCTTGATGGAGATACAGCAAGG + Intergenic
1147848915 17:43426083-43426105 GGGTAAAAGGAGATAAAGCAAGG + Intergenic
1148579482 17:48733827-48733849 GGGAAAATGAAGATAGAGCAAGG - Intergenic
1153414180 18:4826826-4826848 GGTTTGTTGTAGAAAGAGCAGGG - Intergenic
1155591683 18:27434743-27434765 GGTTTAATGAAGAAAGATCATGG - Intergenic
1157819044 18:50752030-50752052 AGAATAATGGAGACAGAGCAAGG + Intergenic
1157918553 18:51693362-51693384 GGGTTAATGTAGATAGAGGTAGG + Intergenic
1158744705 18:60186895-60186917 AGCATAATGGAGAAAGAGCATGG + Intergenic
1160090939 18:75826041-75826063 GGTTTAATTGAGAAACAGCAGGG - Intergenic
1166695912 19:44851347-44851369 GGTTTGAGGGAGGAAGAGCAGGG - Intronic
1167940942 19:52945372-52945394 GGTTTAATGGATTTAGGGCTGGG - Intronic
925688890 2:6499883-6499905 GAATTCATGGAGATGGAGCAAGG - Intergenic
929944021 2:46356877-46356899 GGTATAAGGGAGATAGCTCATGG + Intronic
932431208 2:71674709-71674731 GGGGTAATGGGGATAGAGCCTGG - Intronic
934062360 2:88306899-88306921 GGTGAAAAGGAGATAGAGGATGG - Intergenic
937320977 2:120960624-120960646 GGTTTGATGGAGACAGAGACAGG - Intronic
937321206 2:120961879-120961901 GGTTTGATGGAGACAGAGACAGG - Intronic
940020353 2:149149796-149149818 GGTTGCATGGAGATAAAGAAAGG - Intronic
942529577 2:176895016-176895038 GGCTCAATGGAGGTAGAGCAGGG - Intergenic
943017728 2:182533772-182533794 AGTTTAATGTTGATAGATCAAGG + Intergenic
945497997 2:210533234-210533256 GGTTAAATGTAGATACAGTAAGG + Intronic
947363366 2:229368412-229368434 GGTGGAATGGAGAGAGAGTATGG - Intronic
947985360 2:234443125-234443147 GTTTTAAGGGAGAGAGAGAATGG + Intergenic
948734466 2:239992082-239992104 AGTTTACTGGAGATATACCATGG - Intronic
1172002776 20:31793215-31793237 GGGTTAACGGAGATAGGACAAGG - Intronic
1172657212 20:36544473-36544495 GGATTAAAGGAGATAAAGCATGG + Intronic
1173859909 20:46276562-46276584 GGATTAAAGGAGATAGAACCTGG - Intronic
1175457021 20:59123254-59123276 GGTTTAAGGGAGAGAGAGAAAGG + Intergenic
1176040477 20:63062898-63062920 TGTTTAATGGGGACAGAGCCTGG - Intergenic
1177630122 21:23715588-23715610 GCTTGAATGTAGACAGAGCATGG - Intergenic
1178390205 21:32191985-32192007 TGTTTGAAGGAGAAAGAGCATGG - Intergenic
1178490095 21:33044469-33044491 TGTTAAATGGAAGTAGAGCAGGG - Intergenic
1180072225 21:45442259-45442281 GATTTAAAGGAGAAAAAGCAAGG - Intronic
1180765160 22:18341927-18341949 GGTGGCATGGGGATAGAGCAGGG - Intergenic
1180813870 22:18777757-18777779 GGTGGCATGGGGATAGAGCAGGG + Intergenic
1181200055 22:21212092-21212114 GGTGGCATGGGGATAGAGCAGGG + Intronic
1181510078 22:23385167-23385189 GGTTTACTGGGGACAGGGCAGGG - Intergenic
1181701680 22:24624867-24624889 GGTGGCATGGGGATAGAGCAGGG - Intronic
1184509470 22:44925127-44925149 GGTTTTGTGGAGATGGTGCAGGG + Intronic
1203226781 22_KI270731v1_random:82832-82854 GGTGGCATGGGGATAGAGCAGGG - Intergenic
1203263969 22_KI270734v1_random:3444-3466 GGTGGCATGGGGATAGAGCAGGG + Intergenic
950310574 3:11954310-11954332 GGATTAAATGAGATAGTGCATGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950772696 3:15324684-15324706 GTTTTAATGGAGAAAGTGCTGGG + Intronic
950955664 3:17051101-17051123 AACTTAATGGAGATAGAGAATGG + Intronic
952189359 3:31006176-31006198 GGTGTTATGGAGATAGGGAATGG + Intergenic
952270392 3:31825202-31825224 GGTTTTCTGGAGATAGAGCAAGG + Intronic
952838414 3:37624435-37624457 GGTTTAGTGGAAAGAGAGTAAGG - Intronic
955674188 3:61433382-61433404 GTTTTTAAGGTGATAGAGCAAGG + Intergenic
955993470 3:64653750-64653772 TGTTTTTTAGAGATAGAGCACGG - Intronic
957491145 3:80928982-80929004 GGTTTACTGGAATGAGAGCAAGG + Intergenic
957761245 3:84559701-84559723 GATTTTGTGGAGATAGAGAAGGG - Intergenic
959255295 3:104003328-104003350 GGTTTCATGGAGTAAGAGCCTGG - Intergenic
962424560 3:135258306-135258328 GGTTTAAATGAGATAGTGTATGG + Intronic
962605350 3:137028278-137028300 GAAGTCATGGAGATAGAGCATGG + Intergenic
963228362 3:142886016-142886038 GGTTTAAAGGAGGTAGATCCTGG + Intronic
963568744 3:146964652-146964674 GATTTAAAGGAGAGAGAGAAAGG + Intergenic
964213811 3:154256900-154256922 GGTTTCATGGAGATGAAGGATGG + Exonic
965973421 3:174590795-174590817 GGATTAATTGAGATAATGCATGG + Intronic
971976746 4:33699575-33699597 GGTTTACTGGAATGAGAGCAAGG + Intergenic
973960592 4:56105984-56106006 GTTTTAACGGAGACAGAGCTTGG - Intergenic
974866983 4:67592995-67593017 GCTTTAATTGAGGGAGAGCAAGG + Intronic
977660448 4:99579376-99579398 GGTGTAATGGAGGAAGAGCAGGG - Intronic
981816795 4:148840160-148840182 TTTTTAAGGGAGACAGAGCAGGG - Intergenic
989730140 5:44639186-44639208 GGTTGAATGAGAATAGAGCAGGG - Intergenic
993691927 5:91012454-91012476 GCTATAATGGAAATAAAGCAAGG - Intronic
993748221 5:91629125-91629147 AGTTTAATGTAGGTAGAGAATGG + Intergenic
995530113 5:113083998-113084020 GGTTTATTGGAGATAGACTTTGG + Intronic
996315265 5:122153892-122153914 GGTTTAATGGACAAAGAACATGG - Intronic
997379990 5:133428745-133428767 AGTTTAGTGGCCATAGAGCAAGG - Intronic
998503685 5:142654920-142654942 GGGTTGATGAAGATAGAGCCAGG + Intronic
999048336 5:148493801-148493823 GGGTTAATGGAGACAAAGGAAGG + Intronic
999649577 5:153752146-153752168 GGTTTAATGGGAATACAGAAGGG + Intronic
1003250098 6:4420311-4420333 GGTTAGAGGGAGATAGAGCTGGG - Intergenic
1003874649 6:10424971-10424993 GGTTTTTTGGAGAAGGAGCAAGG - Intergenic
1007139186 6:39554484-39554506 GGTTTCCTGGAGATGGAACAGGG - Intronic
1008170840 6:48203450-48203472 GATTTATTGGAGATAGAGTCAGG + Intergenic
1008564325 6:52752189-52752211 GATCTCAGGGAGATAGAGCAGGG - Intronic
1012042581 6:94228061-94228083 GGGTTAATGAAGAAAGAGTAAGG - Intergenic
1014249311 6:119099483-119099505 GGTCTTATTGAGATGGAGCAGGG - Intronic
1014810056 6:125875135-125875157 GGTTTATTTGAGATTGACCAGGG - Intronic
1015609201 6:134997282-134997304 GGTGGAATGGACAGAGAGCAAGG - Intronic
1018735881 6:166686903-166686925 GGTTTGAAGGAGAAAGAACAGGG + Intronic
1020540610 7:9458226-9458248 GGTTGTATGGAGAGAGAGAATGG + Intergenic
1021336368 7:19407653-19407675 GATTTAGTGTAGATAGAGAAAGG - Intergenic
1021391328 7:20096235-20096257 AGTTGAATGGAGGTAGATCAGGG - Intergenic
1022205761 7:28162047-28162069 GGTTTAATGGAGAGAGTAGATGG - Intronic
1023098366 7:36686939-36686961 TGTTTAAATGAGATAGTGCAAGG + Intronic
1023681996 7:42696757-42696779 GGATTAAAGGAGATAGGGCATGG - Intergenic
1024286906 7:47765710-47765732 TGTGAAATGGAGACAGAGCAGGG - Intronic
1026461475 7:70618873-70618895 GGATTACTGGAGGGAGAGCAGGG + Intronic
1028489805 7:91398707-91398729 GGTGTAAAGGAGGAAGAGCATGG - Intergenic
1028569596 7:92271977-92271999 GATTTCATGGAGATAGAAAATGG + Intronic
1030136677 7:106258346-106258368 AGTTTGGTGGAGATAGAGTAAGG - Intronic
1033104007 7:138502512-138502534 ATTTAAATGGAGATATAGCATGG - Intronic
1033943699 7:146687383-146687405 GGTTTAAATGAGATAGTACATGG + Intronic
1035483716 7:159206267-159206289 GGTGTAAAGGAGAGAGAGAAGGG + Intergenic
1037747654 8:21659744-21659766 CGTTTCCTGGAGAAAGAGCAAGG - Intergenic
1041032374 8:53750654-53750676 TGTTTGATGGAGATAGAGATGGG + Intronic
1042841298 8:73126568-73126590 GCCTTAAAGGAGATAAAGCAGGG + Intergenic
1044703957 8:94990496-94990518 GGTTTAGTGAAAAGAGAGCAGGG - Intronic
1047271193 8:123360794-123360816 TATTTAAGGGAGATAGAGCAAGG - Intronic
1047669010 8:127124469-127124491 GGTGTGTTGGAGAAAGAGCATGG - Intergenic
1047916373 8:129588116-129588138 TGATTAATGGAGATATATCATGG - Intergenic
1058226229 9:102367998-102368020 TGTTTAATGGAAAGAGGGCAAGG + Intergenic
1058734338 9:107880297-107880319 GGTATTATGGAGACAGAGCTTGG - Intergenic
1188710323 X:33389188-33389210 GATTTAATTTAGATAGAGGAAGG + Intergenic
1191085754 X:56565233-56565255 GCTTTAATGCAGATCCAGCAGGG + Exonic
1191227154 X:58055249-58055271 GGTTTACTGGAGTAAGGGCAAGG + Intergenic
1191780207 X:64856480-64856502 GTGTTAGTGGAGATAGAGAAGGG - Intergenic
1193915985 X:87364495-87364517 GGTTTACTGGAGTGAGGGCAAGG + Intergenic
1196121285 X:112053659-112053681 GCTTGAATGGAGATATAGGAAGG + Intronic
1196864775 X:120060881-120060903 GATCTAATGAAGATAAAGCATGG + Intergenic
1196878326 X:120175450-120175472 GATCTAATGAAGATAAAGCATGG - Intergenic
1197473580 X:126892457-126892479 GGTTTCACTGAGATAGAGAATGG - Intergenic
1197792316 X:130268528-130268550 GGTTTTCTGGAGGTAGAGCCTGG - Intronic
1198014445 X:132594406-132594428 GGATTAATGTAGAAAGAGCATGG - Intergenic
1199237919 X:145511691-145511713 TGTTGAATGGGGATAGATCAAGG - Intergenic
1200813964 Y:7512740-7512762 GGTTTACTGGAATTAGGGCAAGG + Intergenic
1201538677 Y:15082203-15082225 GAATTAATGGAGAAAAAGCATGG + Intergenic
1201926469 Y:19293371-19293393 GGTTTACTGGAAAGAGGGCAAGG + Intergenic
1202033010 Y:20597746-20597768 GATATCATGGAAATAGAGCATGG + Intergenic
1202033023 Y:20597841-20597863 GATATCATGGAAATAGAGCATGG + Intergenic
1202074654 Y:21026031-21026053 GGTATAGTGGACATAGATCAGGG + Intergenic