ID: 918235289

View in Genome Browser
Species Human (GRCh38)
Location 1:182574454-182574476
Sequence GTGGACCACCCCACAGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918235289_918235293 -5 Left 918235289 1:182574454-182574476 CCCTCCTCTGTGGGGTGGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 918235293 1:182574472-182574494 TCCACACACTCCACAGTCCTGGG 0: 1
1: 0
2: 2
3: 33
4: 330
918235289_918235292 -6 Left 918235289 1:182574454-182574476 CCCTCCTCTGTGGGGTGGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 918235292 1:182574471-182574493 GTCCACACACTCCACAGTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918235289 Original CRISPR GTGGACCACCCCACAGAGGA GGG (reversed) Exonic
902361304 1:15943917-15943939 GGGGGCCACCCCACAGAGCTCGG + Intronic
904901331 1:33859653-33859675 GAGTCCCACTCCACAGAGGAAGG + Intronic
905238915 1:36570178-36570200 GTGACCCACCCCAGAGGGGAGGG + Intergenic
915053591 1:153103608-153103630 GTGAACATCCCCACAGAGGCAGG + Intronic
918235289 1:182574454-182574476 GTGGACCACCCCACAGAGGAGGG - Exonic
919810706 1:201407252-201407274 CTGGTCCAGGCCACAGAGGATGG - Exonic
920243826 1:204573285-204573307 CTGGCCCAGGCCACAGAGGAGGG - Intergenic
920920159 1:210292207-210292229 GAGGACCACCCCCCAGCGGCGGG + Intergenic
1063445541 10:6112340-6112362 GTGGGCGACGCCACAGAGAAAGG + Exonic
1069950625 10:72015865-72015887 GTGGAACACCCCACAGAGAGTGG + Intergenic
1069960238 10:72075144-72075166 GGGGTCCACCCCACAGGAGATGG + Intronic
1071551015 10:86566218-86566240 GTGGATCTCCTCACAGAGTAAGG + Intergenic
1071603484 10:86970232-86970254 GTGGACCAGGCCACAGAGGCGGG + Exonic
1073411425 10:103345314-103345336 GGGGACCACTCCACAATGGAAGG + Intronic
1073472529 10:103731746-103731768 GTGGAAAATCCCACAGTGGAAGG + Intronic
1074713749 10:116199323-116199345 GTGGACCACCCCAGAGGAGGAGG - Intronic
1076522073 10:131087694-131087716 GGGGGCCTCCCCACAGAGCAGGG + Intergenic
1077306213 11:1869773-1869795 ATGGGGCGCCCCACAGAGGAGGG + Intronic
1082877080 11:57999665-57999687 GTGGACCCCACCACAGCTGAAGG - Intergenic
1083922506 11:65788201-65788223 GGAGCCCACCCCACAGCGGAGGG + Intronic
1087301554 11:96442143-96442165 GTGGAGAATCCCAGAGAGGAGGG + Intronic
1089981042 11:122772732-122772754 GTGGTCCTTCCCACAGGGGAGGG - Intronic
1093392271 12:18637069-18637091 GTGGACCACCAGTCAGAGTAGGG - Intronic
1099128845 12:78800826-78800848 GTGAACCCTCCCACACAGGAGGG + Intergenic
1100297233 12:93274311-93274333 GAGGAACATCCCACTGAGGATGG + Intergenic
1101216629 12:102592589-102592611 GTGCTCCACCCCTCACAGGAAGG + Intergenic
1101432893 12:104641487-104641509 CTGTTCCACCCCTCAGAGGAGGG - Intronic
1102519632 12:113470514-113470536 GTGAATCACGCCACAGAGAAAGG - Intronic
1104982857 12:132581918-132581940 GAGGCCCAGCCCAGAGAGGAGGG - Intronic
1105572868 13:21620521-21620543 GTGGACCACCAGACACGGGAGGG + Intergenic
1110811056 13:79810791-79810813 ATTGACCTCCCCACAGAGAAGGG + Intergenic
1111104025 13:83622404-83622426 GTGTTCCACCCCTCACAGGAGGG - Intergenic
1112576623 13:100642112-100642134 GTGGAGAACGCCACAGAGGCAGG + Intronic
1113391094 13:109897869-109897891 GAGGGCCATCCCACAGTGGAAGG - Intergenic
1114712555 14:24793335-24793357 GGGGACCATGCCACAGGGGAAGG + Intergenic
1117460375 14:55939295-55939317 ATGGACCAGACCACAGAAGAGGG + Intergenic
1118355799 14:65012591-65012613 GTGGAGCACCCTAGATAGGATGG + Intronic
1118922998 14:70167110-70167132 GTGGACTACAAAACAGAGGATGG - Exonic
1121863694 14:97342615-97342637 CTGGCCCTCCCCACAGAGTAAGG - Intergenic
1122040371 14:98983572-98983594 GTGGCCCCTCCCACAGAAGAGGG + Intergenic
1123449253 15:20349875-20349897 GGGGACCCCCCCACCGCGGAGGG - Intergenic
1124360415 15:29032839-29032861 GTGGAGCAGCCCACAAAGAAAGG - Intronic
1125426841 15:39557275-39557297 GTAGTCCACCCCAGAGAAGACGG + Intergenic
1129826372 15:78637598-78637620 CTGGCCCTACCCACAGAGGAAGG - Intronic
1130273297 15:82463494-82463516 CTGAACCACCTCACAGTGGAAGG - Intergenic
1130465648 15:84190865-84190887 CTGAACCACCTCACAGTGGAAGG - Intergenic
1130487043 15:84403955-84403977 CTGAACCACCTCACAGTGGAAGG + Intergenic
1130498617 15:84482671-84482693 CTGAACCACCTCACAGTGGAAGG + Intergenic
1130587938 15:85195460-85195482 CTGAACCACCTCACAGTGGAAGG - Intergenic
1132060561 15:98688960-98688982 GTCGCCCACCACACAGAGGAAGG - Intronic
1132941424 16:2510307-2510329 GTGGAGCCCACCACAGAGGCAGG + Intronic
1137595050 16:49717941-49717963 CTGGACTACCCCACAGAGGGAGG + Intronic
1137754564 16:50891254-50891276 ATGGACCAGACCACAGAGGCTGG + Intergenic
1138074756 16:54031113-54031135 GTGGACAACCCCACAGAGCCAGG + Intronic
1139322044 16:66122708-66122730 AGGGATCACCCCACAGAGGTGGG + Intergenic
1141749211 16:85946971-85946993 GTGGACCAGCACAGGGAGGAGGG - Intergenic
1142031128 16:87839103-87839125 GTGGAGGACCCCACGGGGGAAGG - Intronic
1142273335 16:89102493-89102515 CTGGGCCTCCCCACTGAGGAAGG - Intronic
1143606987 17:7992764-7992786 CTTGACCACCCCACAGAGCTGGG - Intergenic
1145046226 17:19618957-19618979 GAGGACAACCACACAAAGGAAGG - Intergenic
1146478017 17:33178744-33178766 GAGGACAGCCCAACAGAGGAGGG + Intronic
1148162106 17:45456138-45456160 GTGGACCACTGCATATAGGATGG - Intronic
1148785326 17:50143526-50143548 GTGGCCCACCCCACCAAGGATGG + Intronic
1150393339 17:64802786-64802808 GTGGACCACTGCATATAGGATGG - Intergenic
1151161857 17:72172646-72172668 TTGGACCACCCCAAACAGGGAGG + Intergenic
1152176648 17:78792399-78792421 GTAGAGGTCCCCACAGAGGATGG + Intronic
1152563316 17:81089394-81089416 GTGGACCACAGCACTGAGGCAGG - Intronic
1153781554 18:8499502-8499524 GTGGCCCCACCCACAGAGTATGG + Intergenic
1153802669 18:8684905-8684927 TTTGAAGACCCCACAGAGGAAGG - Intergenic
1155500535 18:26482805-26482827 ATGGACCAACCCAGAGAGGGTGG + Intronic
1156505345 18:37587158-37587180 GAGGGGCAGCCCACAGAGGAAGG - Intergenic
1162419852 19:10559886-10559908 GTGGACGACTCCTCAGACGAAGG - Exonic
1163218138 19:15895631-15895653 CAGGTCAACCCCACAGAGGAGGG - Exonic
1163457288 19:17414904-17414926 GTGAACCACCCCACTGATCAAGG - Intronic
1163593212 19:18205601-18205623 CTGGAGCCCCCCACAGAGCACGG - Intergenic
1163829307 19:19540233-19540255 GTGGACCACCCCGGAGGCGACGG + Exonic
1164743936 19:30597182-30597204 GGGGACCATCCCACAGAAGTTGG - Intronic
1165119853 19:33552057-33552079 GTGGACCAGGCCACAGCCGAAGG + Intergenic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167632292 19:50632569-50632591 GTGGGCCGCCCAGCAGAGGATGG + Exonic
1168468326 19:56621564-56621586 CTGGACGACCCCACAGAAAAGGG + Exonic
925541432 2:4971921-4971943 GTGGACCATAGCACAGAGGGCGG + Intergenic
926076830 2:9949703-9949725 TTGGACCAGGGCACAGAGGAGGG + Intergenic
927434255 2:23053597-23053619 GAGGACCACCCCTCAGAGCCAGG - Intergenic
927906545 2:26862734-26862756 CTGGACCTCCACACAGAGGCTGG - Intronic
931289740 2:60862015-60862037 GGGCACCAACCCAGAGAGGAAGG - Intergenic
933992265 2:87642355-87642377 GGTGAAGACCCCACAGAGGAGGG + Intergenic
935593697 2:104863678-104863700 GTGGCCCAGCCCACAGACCAGGG + Intergenic
935889205 2:107657655-107657677 AGGGACCACCCCAGGGAGGAGGG - Intergenic
936301585 2:111308484-111308506 GGTGAAGACCCCACAGAGGAGGG - Intergenic
937128102 2:119487363-119487385 GTTGCCCACTCCACAGAGCATGG - Intronic
938080617 2:128368101-128368123 GGTGACCATCCTACAGAGGAAGG + Intergenic
947991238 2:234489229-234489251 GATGCCTACCCCACAGAGGATGG - Intergenic
1171531503 20:25856411-25856433 GTGGCCCATCCCACAGCAGATGG + Intronic
1175152597 20:56946822-56946844 CTGGAGCATCCCACAAAGGATGG - Intergenic
1175390805 20:58626162-58626184 TTGTCCCACCCCAGAGAGGAAGG + Intergenic
1178032010 21:28538650-28538672 GTGGACCACTAGACAGGGGAGGG - Intergenic
1180173164 21:46071366-46071388 GTGGAGGAACCCACAGAGGAGGG + Intergenic
1180228503 21:46412610-46412632 CAGGACGACCCCACAGAGCAAGG - Intronic
1183504084 22:38199437-38199459 GTGGACCAAGGCACAGAGGCAGG + Intronic
1184361649 22:44022667-44022689 GTGGATCACTCAGCAGAGGACGG - Intronic
949209222 3:1477983-1478005 GTGGACCTCACCACAGCTGAAGG + Intergenic
950717852 3:14862446-14862468 GGGGACCACTCCTCAGTGGAGGG + Intronic
953412232 3:42697078-42697100 GTTGACAACACCAAAGAGGACGG + Exonic
953551428 3:43906676-43906698 GTGGAACATACCACTGAGGAAGG - Intergenic
955931518 3:64062250-64062272 ATGGACCACCCTAAAAAGGAGGG - Intergenic
956733645 3:72218986-72219008 TTTGATCACCCCAAAGAGGAAGG + Intergenic
959543939 3:107571628-107571650 GTGGATCTCCCCACAGAGTGAGG + Intronic
962628155 3:137248255-137248277 GTGGACCAGCACAGTGAGGAAGG - Intergenic
968006548 3:195247143-195247165 GTGTTCCACCCCAAAAAGGAGGG + Intronic
968229434 3:196996619-196996641 CTGGGTCACCCCACAGATGAAGG + Intronic
968582960 4:1403450-1403472 GGGGACCACCCCGCAGGGCACGG - Exonic
969029181 4:4197580-4197602 GTGGCCCTCAGCACAGAGGATGG + Exonic
969147219 4:5134428-5134450 CTGCATCATCCCACAGAGGAAGG - Intronic
969530687 4:7728669-7728691 GAGCACCACCTCACAGGGGAGGG + Intronic
977229496 4:94434649-94434671 CTGCATCACCCCACAGTGGAAGG - Intergenic
978985983 4:115013584-115013606 GTGGTCCACCACTCAGAGTACGG + Intronic
981352835 4:143752455-143752477 GAGGCCCAGCCCAGAGAGGAGGG - Intergenic
983343957 4:166502619-166502641 GTGGACCACCCCTCAGGGAGAGG - Intergenic
986197310 5:5549798-5549820 GAGGACCAGCCCACAGATGGTGG + Intergenic
992354575 5:75967687-75967709 GTGGACCCCACCACAGATCAAGG + Intergenic
995956490 5:117782968-117782990 GTGGACAAATCCACAGAGCAGGG - Intergenic
996230819 5:121061274-121061296 GCTGACCACACCACAGAGAAGGG + Intergenic
997296960 5:132774499-132774521 GTGGAGCAGCCCTCTGAGGAGGG - Intronic
997305161 5:132830934-132830956 CTGGACCTCCCCACCGAGGGAGG - Intergenic
998174955 5:139895987-139896009 CAGGCCCACCCCAAAGAGGATGG - Intronic
1002441696 5:179267600-179267622 GGAGAGCAGCCCACAGAGGAGGG + Intronic
1004129783 6:12908669-12908691 GTGGAGGACCACACAGAGGCTGG - Intronic
1006189159 6:32197023-32197045 GTGGACGCTCGCACAGAGGACGG - Exonic
1010093037 6:72006840-72006862 GTGGAGCCCACCACAGATGAAGG + Intronic
1011125975 6:84008256-84008278 GTCAAACACCCCACAGAGTAAGG + Intergenic
1013287877 6:108696481-108696503 GTGGGGCACACCACAGTGGAAGG - Intergenic
1015754872 6:136597049-136597071 GTGGTCAGCCCCATAGAGGAGGG - Intronic
1017964679 6:159253906-159253928 ATGGCCCACCCCAGAGGGGACGG - Intronic
1018784271 6:167095950-167095972 GTGGACCACATCCCAGAGGATGG - Intergenic
1019163173 6:170082309-170082331 CTGCACCACCCCACAGCAGAAGG - Intergenic
1019737164 7:2656290-2656312 CTGGACCGCCCCCCAGAGGCAGG - Intronic
1020092302 7:5348586-5348608 CTGGGCCACCTCAGAGAGGAAGG + Intronic
1028523003 7:91752848-91752870 GCGGCCCAGCCCAGAGAGGAGGG - Intronic
1030265842 7:107621054-107621076 CTGAACCAGCCCACAGAGGTAGG - Exonic
1031080791 7:117255194-117255216 GTGTATTCCCCCACAGAGGAGGG + Intergenic
1032612237 7:133427269-133427291 GTGGATCACCCTACTGAGAAAGG - Intronic
1035495270 7:159319876-159319898 GTGGAGCCCCCAACACAGGAAGG + Intergenic
1035702159 8:1644324-1644346 GTTTGCAACCCCACAGAGGACGG - Intronic
1037675843 8:21050169-21050191 GTGCACCAGCCGAGAGAGGAAGG - Intergenic
1040063132 8:43121669-43121691 ATGGACCACCACACAGTGGGTGG - Intronic
1044479128 8:92664334-92664356 GTGGACCACTTCAGAGGGGAGGG + Intergenic
1047299126 8:123597760-123597782 GAGGAGCTCCCAACAGAGGACGG + Intergenic
1055381873 9:75716211-75716233 GTGATGCACCCCACAGAGGGGGG - Intergenic
1057215651 9:93227022-93227044 GTGGCGCAGCCCTCAGAGGAGGG - Intronic
1057532802 9:95868257-95868279 ATGGAACTTCCCACAGAGGAGGG - Intergenic
1058779455 9:108318511-108318533 GTAGTCCACCCCAGGGAGGAAGG - Intergenic
1060554791 9:124502761-124502783 GGGGACCTCCTCACAGAGGGAGG + Intronic
1061268401 9:129521954-129521976 CTGGCCCACCCCAGAAAGGATGG - Intergenic
1061492916 9:130956195-130956217 GTGGCCGCCCCCACTGAGGAGGG + Intergenic
1185795245 X:2959153-2959175 TTGGACCACCCAGCAGAGCAAGG + Intronic
1186952634 X:14644072-14644094 GTGGACCACACCAGAGTAGAAGG - Intronic
1190054002 X:47171401-47171423 TGGGACCTGCCCACAGAGGACGG - Intronic
1190633463 X:52411567-52411589 ATGAAACCCCCCACAGAGGATGG - Intergenic
1200126394 X:153816824-153816846 GTGGTCCAGACCACAGATGATGG + Intronic