ID: 918236140

View in Genome Browser
Species Human (GRCh38)
Location 1:182582471-182582493
Sequence ACATATAAGTCACAGTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918236138_918236140 10 Left 918236138 1:182582438-182582460 CCATACCACTTAGTTTTATGAAG 0: 1
1: 0
2: 0
3: 11
4: 179
Right 918236140 1:182582471-182582493 ACATATAAGTCACAGTTGTTAGG 0: 1
1: 1
2: 0
3: 14
4: 136
918236139_918236140 5 Left 918236139 1:182582443-182582465 CCACTTAGTTTTATGAAGAGTAA 0: 1
1: 0
2: 1
3: 28
4: 275
Right 918236140 1:182582471-182582493 ACATATAAGTCACAGTTGTTAGG 0: 1
1: 1
2: 0
3: 14
4: 136
918236137_918236140 11 Left 918236137 1:182582437-182582459 CCCATACCACTTAGTTTTATGAA 0: 1
1: 0
2: 1
3: 21
4: 188
Right 918236140 1:182582471-182582493 ACATATAAGTCACAGTTGTTAGG 0: 1
1: 1
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918236140 Original CRISPR ACATATAAGTCACAGTTGTT AGG Intronic
902277829 1:15352119-15352141 AAATGTAAGTGACAGTTTTTTGG - Intronic
903537666 1:24077661-24077683 CTAAATAAGTCACAGTTGTTGGG - Intronic
905029790 1:34874305-34874327 ATATTTAAATCACTGTTGTTTGG + Intronic
906624798 1:47316112-47316134 ACAAATAAGACACACATGTTGGG + Intergenic
908381977 1:63605388-63605410 AAATACAAGTCAAAGTTTTTAGG - Intronic
909750258 1:79150856-79150878 ACAAATAAGGCCCAGTTGTATGG - Intergenic
910092666 1:83483888-83483910 CCATATCAGTAAAAGTTGTTTGG + Intergenic
914739697 1:150453586-150453608 ACATATTAATCATAGCTGTTTGG + Intronic
918236140 1:182582471-182582493 ACATATAAGTCACAGTTGTTAGG + Intronic
921502459 1:215922427-215922449 ATATATAAGTCACATTCGTAGGG - Intronic
922425888 1:225492367-225492389 ACATATAATTCCTAGTAGTTAGG - Exonic
923117973 1:230961890-230961912 ACATTTAAGTCTCACTGGTTTGG - Intronic
923322764 1:232852106-232852128 GCATATAATTGACAGTTGTCTGG - Intergenic
1063068619 10:2636441-2636463 ACATATCCGTCTCAGATGTTAGG - Intergenic
1068694149 10:59947848-59947870 ACATATTAATCACTTTTGTTAGG + Intergenic
1070370237 10:75775597-75775619 ACATATGACTCACACATGTTCGG - Intronic
1072656988 10:97336307-97336329 AATTTTAAGTCACAGTAGTTGGG + Intergenic
1072750156 10:97973017-97973039 ACATCTAAGACACCATTGTTTGG - Intronic
1074240441 10:111633573-111633595 ACCTATCAGGCACAGTTGTAAGG - Intergenic
1074953662 10:118365911-118365933 ACATATCATTCACAGTTTTCTGG + Intergenic
1082738046 11:56878538-56878560 GAATATAAGTCACTGTTATTTGG + Intergenic
1083155109 11:60817961-60817983 ACACAGAAGTCACACATGTTTGG + Intergenic
1084139149 11:67212455-67212477 ACAAATAATACACATTTGTTTGG + Intronic
1087007982 11:93487648-93487670 TCAGATAAGTCACATTTTTTTGG + Intronic
1087108058 11:94431796-94431818 TAATATAACTCACAGTTGTTTGG - Intronic
1087151107 11:94860659-94860681 ACATTTAACTTAAAGTTGTTTGG + Intronic
1088378229 11:109165108-109165130 CCATATAAGTCACAATTGCATGG + Intergenic
1088542676 11:110929569-110929591 ACCTATAAGTCAGAGCTGTTAGG + Intergenic
1088547920 11:110980309-110980331 ATATATAAGTCAGACTTCTTGGG + Intergenic
1089592637 11:119554269-119554291 ACATTTCAGTCCCTGTTGTTAGG + Intergenic
1099167747 12:79327496-79327518 CCATAGAAGTCACAGTGGATTGG - Intronic
1101428863 12:104609957-104609979 ACAAATAAATCAAAATTGTTAGG - Intronic
1102507952 12:113395756-113395778 TCATTTAAGTCACTGTTATTTGG + Intronic
1104345039 12:127988408-127988430 ACATATCGGTCTCACTTGTTAGG + Intergenic
1105904469 13:24792585-24792607 ATATATGACTCTCAGTTGTTTGG + Intronic
1107425332 13:40287477-40287499 ACACTTAAGTCACAGTTTCTTGG + Intergenic
1107440470 13:40422908-40422930 ACATCAAAATCACAGTGGTTTGG + Intergenic
1108368182 13:49739291-49739313 AAATATAAGTAACAGGTTTTGGG + Intronic
1110352382 13:74523793-74523815 ACAAATATGTCACAGTTGCCTGG - Intergenic
1110777840 13:79431717-79431739 ACATTTAAGTCATTGTAGTTAGG - Intergenic
1111163670 13:84428611-84428633 ACATCTATATCAGAGTTGTTGGG - Intergenic
1112600466 13:100850532-100850554 AAATATAAATCAATGTTGTTGGG - Intergenic
1115043641 14:28961771-28961793 ACATTTCAGTCATAGTTCTTAGG + Intergenic
1117260425 14:54027300-54027322 ATGTACAAGTCACAGTTGTCAGG - Intergenic
1118365964 14:65096389-65096411 ACATTTAATTCACAGTTGCCTGG - Intronic
1120613073 14:86666551-86666573 ACATATAAGTCACAATTTTGAGG + Intergenic
1120766166 14:88328064-88328086 ACAGAAAAGTTACAGTTGTTTGG + Intergenic
1122160215 14:99778394-99778416 ACATATAAGGCAGAATAGTTGGG - Intronic
1126978564 15:54214863-54214885 ACATCTAAGTCACACTTCTGTGG - Intronic
1127443118 15:59031903-59031925 AAAAATAAGTCAGAGTTTTTTGG + Intronic
1128159305 15:65413089-65413111 AAAAATAAGTCCCAGCTGTTTGG + Intronic
1128981659 15:72192542-72192564 AATAATCAGTCACAGTTGTTTGG + Intronic
1131028193 15:89163001-89163023 ACATATAGGGCACAATGGTTTGG - Intronic
1136384548 16:29915024-29915046 ACATATAAGTCACTGGTGTGTGG + Intronic
1137315247 16:47312807-47312829 AGATAAATGTCACAGTTCTTTGG - Intronic
1139396089 16:66640379-66640401 ACATATAAGGGACAGCTGTCTGG + Intronic
1140104711 16:71949316-71949338 ACATTTAACTGACATTTGTTAGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141893009 16:86939752-86939774 AAATATAAATCAAAGGTGTTAGG + Intergenic
1143395027 17:6587427-6587449 ACATTTTGTTCACAGTTGTTAGG - Intronic
1144236503 17:13266174-13266196 AGATCTAAGTCACAGTATTTGGG + Intergenic
1147508416 17:41043973-41043995 ACACAGAAGTCACTGTTGGTTGG - Intergenic
1148287410 17:46407015-46407037 TCATATATGGCAGAGTTGTTAGG + Intergenic
1148309580 17:46624595-46624617 TCATATATGGCAGAGTTGTTAGG + Intronic
1149818429 17:59750086-59750108 ACAAATAAGACTCAGATGTTAGG - Intronic
1150012344 17:61516539-61516561 ACTTGTGAGTCACAGTTGTCTGG + Intergenic
1153195496 18:2591580-2591602 ATATATAAATCAGAGTTATTTGG - Intronic
1159769660 18:72534718-72534740 ACATATAAATCAAAATTATTAGG + Intergenic
1165551421 19:36589791-36589813 ACATGTATTTTACAGTTGTTAGG - Intronic
1168041740 19:53764386-53764408 ACATCTAAGTGTCAGTTGCTCGG + Intergenic
926053315 2:9758280-9758302 ACAGAAAAGGCACAGTTGTGGGG - Intergenic
927234844 2:20862656-20862678 ACAAAAAAGTCAGAGTTCTTCGG + Intergenic
928570100 2:32598487-32598509 ACCTATAATTCACAGATGTTAGG - Intronic
928998339 2:37321047-37321069 TCATGTAAGTTACAGTTATTAGG - Intronic
933242318 2:79935894-79935916 AAATGCAAGTCACAGTTCTTTGG + Intronic
933391330 2:81671934-81671956 ACATATAAGTCAGCTTTGATTGG + Intergenic
934875617 2:97916905-97916927 AAATATAAGTCATATTTATTGGG - Intronic
936958538 2:118048437-118048459 ACCTTTAAGCCACAATTGTTTGG + Intergenic
939070375 2:137532828-137532850 AGGTAAAAGTCACAGTTATTAGG + Intronic
941235570 2:162968169-162968191 ACTTAAAAGTCTCAGTTGTTTGG + Intergenic
942138390 2:172952455-172952477 CCATAGAAGTCACAGTTGTAAGG + Intronic
943510483 2:188820230-188820252 ACTTATAGGTTACAGTTTTTAGG - Intergenic
943702334 2:191000218-191000240 ACAAATAAGCCTCATTTGTTTGG + Intronic
1169923883 20:10762816-10762838 ACATATATGTAACAGTTCTTGGG + Intergenic
1170902758 20:20481962-20481984 ACATATATCTCAAAATTGTTTGG - Intronic
1172382862 20:34511452-34511474 ACATATAAGTCTCAGAAGGTGGG - Intergenic
1174193332 20:48755739-48755761 ACATTTAAGACACTGTTATTTGG + Intronic
1177582549 21:23044823-23044845 ACATTTTACTCACATTTGTTTGG - Intergenic
1178008314 21:28250428-28250450 ACATATCAGTGACAGTTTTAAGG + Intergenic
949835216 3:8261475-8261497 ACCTATAGGTCACATTTGGTAGG + Intergenic
953478874 3:43231859-43231881 ACAAATAACAGACAGTTGTTTGG + Intergenic
955979852 3:64513917-64513939 AGATATAAGTAAAATTTGTTAGG + Intergenic
956887397 3:73574105-73574127 ACAGAGAAGTAACAGTTGTCAGG + Intronic
958689615 3:97446954-97446976 AAATATAAGTTGCAGTTTTTTGG + Intronic
963094547 3:141522401-141522423 CCATATAGATCACAGGTGTTGGG + Intronic
963522305 3:146370766-146370788 ACATATATTCCACAGATGTTGGG + Intergenic
963617225 3:147556606-147556628 AAATAAAAGCCAAAGTTGTTGGG - Intergenic
967620827 3:191631364-191631386 ACAGTTGAGTCAAAGTTGTTAGG + Intergenic
967827794 3:193892544-193892566 TCACAGAAGTCAGAGTTGTTTGG - Intergenic
967998578 3:195185640-195185662 TCATGTTAGTCACAGGTGTTGGG + Intronic
974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG + Intergenic
983147615 4:164236858-164236880 ATATAAAATTCACAGTTTTTAGG - Intronic
983836971 4:172400482-172400504 TAACATACGTCACAGTTGTTGGG - Intronic
986434195 5:7711878-7711900 ACAGTTAAGTCAAAGTGGTTTGG - Intronic
987356229 5:17065582-17065604 AGATATGAGTCTCCGTTGTTTGG + Intronic
990156354 5:52881842-52881864 ACGTATAACTCACAGTGGCTTGG + Intronic
993038380 5:82783711-82783733 AGTTGTAAGTGACAGTTGTTAGG + Intergenic
993446824 5:88023269-88023291 AATTATATGTCACAGTGGTTTGG + Intergenic
996022276 5:118604450-118604472 ACATGAAAGTCAGGGTTGTTGGG + Intergenic
997907558 5:137834595-137834617 CCAGATAGCTCACAGTTGTTTGG - Intergenic
998662134 5:144250702-144250724 ACTTATTAGTCAGAGTTTTTTGG + Intronic
999198085 5:149796415-149796437 CCTTATAAGCCACAGGTGTTTGG + Intronic
1001356390 5:171028388-171028410 ACATATTAGGCACTGTTGTTTGG + Intronic
1004953386 6:20700406-20700428 ACATTTAAGGCACACATGTTAGG - Intronic
1005631400 6:27711563-27711585 ACTTATAAGTGACTTTTGTTGGG - Intergenic
1010318771 6:74482481-74482503 GCATGCAAGTCACTGTTGTTAGG + Intergenic
1010824758 6:80458923-80458945 AGATATTAGTCACACTTGTCAGG + Intergenic
1013615433 6:111838613-111838635 ACAAATAATTCACAGTTGAAAGG + Intronic
1014532921 6:122580901-122580923 ACATGTGAGTCATAGTTGATGGG + Intronic
1015571986 6:134631307-134631329 AGATATAATTCACAGTTTTATGG - Intergenic
1016063759 6:139657473-139657495 ATATATAAATGTCAGTTGTTTGG - Intergenic
1017357063 6:153521632-153521654 ACATATGAGAAAAAGTTGTTTGG - Intergenic
1018471837 6:164104459-164104481 ATATCTAAGCCATAGTTGTTAGG + Intergenic
1023270614 7:38457973-38457995 ACATATATGTCACCATGGTTTGG + Intronic
1025601306 7:63000257-63000279 ACATGTAAGTCACCGTTTTTTGG - Intergenic
1025973489 7:66350313-66350335 ACATATAAGAATCATTTGTTCGG - Intronic
1027309529 7:76940387-76940409 CCATATCAGTAAAAGTTGTTTGG + Intergenic
1027866694 7:83657693-83657715 ATATTTAAATCACTGTTGTTTGG - Intergenic
1028114136 7:86978441-86978463 AAATATAAGACACACTGGTTGGG + Intronic
1028570071 7:92277271-92277293 ACAAAGAATTCACAATTGTTAGG + Intronic
1032932254 7:136686981-136687003 ATAAAGAAGTCAGAGTTGTTGGG + Intergenic
1033917782 7:146348631-146348653 ATATTTAAATCACACTTGTTTGG + Intronic
1035428514 7:158799108-158799130 ACATTTTATTTACAGTTGTTGGG - Intronic
1036091119 8:5666687-5666709 ACAGATAGGTAACAGATGTTAGG + Intergenic
1040359929 8:46655524-46655546 ACATAAAACTCGCAGTTTTTTGG + Intergenic
1042292600 8:67184977-67184999 ACCTATAAGTCCCAGCTGCTCGG + Intronic
1042659480 8:71138032-71138054 TCATAAAAGTCACTATTGTTGGG - Intergenic
1043250676 8:78069347-78069369 ACAGATATGGCACAGTTGTGAGG + Intergenic
1043333494 8:79145894-79145916 AAACATAAGTGACAGTTATTAGG + Intergenic
1046717039 8:117579328-117579350 CCATATAAGTTACAGTGGGTTGG + Intergenic
1051926046 9:22327441-22327463 AAATATAAGCCACAGTTCTGAGG - Intergenic
1052972071 9:34382672-34382694 AAATATCAGTCACTGTAGTTTGG + Intronic
1055418966 9:76115943-76115965 ACATAAAAGTTAAAATTGTTTGG + Intronic
1058848361 9:108985633-108985655 ACATATAGGACACAGTTCTTTGG - Intronic
1188974867 X:36661126-36661148 AGCCATAAATCACAGTTGTTTGG + Intergenic
1190005325 X:46731216-46731238 ACATTTTAGTCACTGGTGTTGGG + Intronic
1192589576 X:72348800-72348822 GCAGATGAGTCACAGTTGTTGGG - Intronic
1193550094 X:82881391-82881413 ATATATATTTCATAGTTGTTGGG - Intergenic
1193674962 X:84438770-84438792 ACATATACTTCACTGTTGATGGG + Intronic
1194859958 X:98985732-98985754 AATTATAATTCACAGGTGTTGGG - Intergenic
1194876274 X:99192353-99192375 ACATATAAGTCACATTTGTTAGG + Intergenic
1200500282 Y:3940060-3940082 ACATATTATACACTGTTGTTGGG - Intergenic