ID: 918236415

View in Genome Browser
Species Human (GRCh38)
Location 1:182584751-182584773
Sequence CCTAATCATCGCTGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918236415 Original CRISPR CCTAATCATCGCTGAAGCCC TGG Intronic
903913291 1:26744682-26744704 CCCAAGCTTCCCTGAAGCCCAGG + Intronic
910124666 1:83827347-83827369 CCTAATGAACTCTAAAGCCCAGG + Intergenic
911095474 1:94051401-94051423 GCTGATCATGGATGAAGCCCTGG - Intronic
912494256 1:110081236-110081258 CCTAATCCTAGCTCAATCCCAGG - Intergenic
913230780 1:116739363-116739385 TCTGATCATCACTGAAGCCCTGG + Intergenic
913978720 1:143488538-143488560 CCCAATCCTCTCTGAAGTCCTGG - Intergenic
914073129 1:144314186-144314208 CCCAATCCTCTCTGAAGTCCTGG - Intergenic
914106025 1:144652174-144652196 CCCAATCCTCTCTGAAGTCCTGG + Intergenic
916021604 1:160797250-160797272 CACCATCATCCCTGAAGCCCTGG - Intronic
916735161 1:167601279-167601301 CCTAAACAGCTCTGAAGCCTGGG - Intergenic
918236415 1:182584751-182584773 CCTAATCATCGCTGAAGCCCTGG + Intronic
923291159 1:232547546-232547568 CCTAATGATCACTGTGGCCCGGG + Intronic
1069939888 10:71948161-71948183 CCTGTTCATCTCTCAAGCCCAGG + Intergenic
1073301638 10:102474543-102474565 CCTAATCACCCCTGACACCCTGG - Intronic
1074533469 10:114312473-114312495 CCTAATCAGCTCTGCAGCCCAGG + Intronic
1074920363 10:118002654-118002676 CCCCATCATCCCTGAAGTCCTGG + Intergenic
1075182445 10:120223949-120223971 GCAAATCATTGCTGAATCCCTGG - Intergenic
1077613560 11:3659840-3659862 CATGCTCATCGCGGAAGCCCAGG - Exonic
1079840196 11:25387546-25387568 ACTAATTATTGCTAAAGCCCAGG - Intergenic
1080862126 11:36159237-36159259 CCGAAGCATCGCTTGAGCCCAGG + Intronic
1083304976 11:61757405-61757427 CCTAATCACCCCAGAAACCCTGG - Intronic
1084068772 11:66720490-66720512 CCTACTCTTCCCTGCAGCCCAGG - Intronic
1088120337 11:106361515-106361537 TCAAATCATAGCTCAAGCCCAGG - Intergenic
1090178716 11:124674308-124674330 CGGGATCATCGCTGGAGCCCAGG + Exonic
1104517399 12:129440648-129440670 CCAACCCATAGCTGAAGCCCAGG + Intronic
1105401922 13:20103975-20103997 CCTGAAGATCGCTTAAGCCCAGG - Intergenic
1115396843 14:32918423-32918445 TCTCATCATCTCTGAAGCTCAGG - Intergenic
1117570976 14:57049054-57049076 CCTACTCATCTTTGAACCCCAGG - Intergenic
1119721748 14:76896408-76896430 TCTAATCATCCCAGAAGCCCTGG - Intergenic
1125468307 15:39976776-39976798 CCTCGTCATCGCTGGAGCCCGGG - Exonic
1127277363 15:57459089-57459111 GCTTATCATCTCTGAAGCCTTGG + Intronic
1130574035 15:85074582-85074604 GCTACTCATAGCTGGAGCCCAGG + Intronic
1142737160 17:1908299-1908321 CCTAATCCGCGCTGATCCCCGGG - Intergenic
1144066585 17:11629840-11629862 CCTCAGCATCTCTGAAACCCTGG - Intronic
1145007969 17:19348190-19348212 CCTGATCATAGCTGGGGCCCTGG - Intronic
1146283952 17:31561752-31561774 CCTAAAAATCTCTAAAGCCCTGG - Intergenic
1146499951 17:33355704-33355726 CCTAATCATAGCCTGAGCCCTGG + Intronic
1149685411 17:58531955-58531977 CCTTACCATGGCTGCAGCCCGGG + Intronic
1151596795 17:75082872-75082894 CCTAGTCATCTGAGAAGCCCTGG - Intergenic
1151713062 17:75817733-75817755 CCTAACCAGCTCTGCAGCCCAGG - Intronic
1155002967 18:21704533-21704555 CATAAGCGACGCTGAAGCCCAGG + Exonic
1158634751 18:59146894-59146916 CAGAATCATCGGGGAAGCCCTGG - Intronic
1162592174 19:11599113-11599135 CCCAAACAGCCCTGAAGCCCAGG - Intronic
1163237418 19:16037698-16037720 CCTAATCAGGGCTGCATCCCCGG - Intergenic
1163995128 19:21038518-21038540 CAGAATAATCGCTGAAACCCAGG - Intronic
929528225 2:42726242-42726264 CCTAAACATCTCAGCAGCCCCGG - Intronic
934183445 2:89649617-89649639 CCCAATCCTCTCTGAAGTCCTGG - Intergenic
934293728 2:91723789-91723811 CCCAATCCTCTCTGAAGTCCTGG - Intergenic
934547682 2:95232222-95232244 AATAATCATCAGTGAAGCCCAGG - Intronic
937386434 2:121437849-121437871 CCTAAGCATGGCAGGAGCCCTGG - Intronic
946210207 2:218141571-218141593 CACAATAATCGCTTAAGCCCAGG + Intergenic
947457655 2:230270224-230270246 CCCAATCTTCCATGAAGCCCAGG + Intronic
1170439729 20:16366701-16366723 CCTAATCACAGCTGAAACCAAGG + Intronic
1173310039 20:41889161-41889183 GCTTCTCATCCCTGAAGCCCTGG - Intergenic
1177842943 21:26254932-26254954 TCTAATCAATGTTGAAGCCCTGG + Intergenic
1180801433 22:18633902-18633924 CCTAGCCATCGCTGGGGCCCAGG - Intergenic
1181220288 22:21361359-21361381 CCTAGCCATCGCTGGGGCCCAGG + Intergenic
1182771905 22:32802163-32802185 CCTAAGCAGCGCTGCAGTCCTGG - Intronic
958252718 3:91289120-91289142 CCAAAGAATCGCTTAAGCCCAGG - Intergenic
961007110 3:123412466-123412488 CCAAACCATCCCTGCAGCCCTGG - Intronic
963467831 3:145704788-145704810 ACTAAACATCAATGAAGCCCAGG - Intergenic
967191808 3:186991300-186991322 CCTAGCCTTCTCTGAAGCCCAGG - Intronic
973983145 4:56323576-56323598 CAAAATCACAGCTGAAGCCCAGG - Intronic
975491435 4:74993369-74993391 CCTAAAGATGACTGAAGCCCTGG + Intronic
975828579 4:78345129-78345151 TCTAATCATAGCTGTAGCCTTGG - Intronic
982236424 4:153254926-153254948 CCTAAGTATAGCTGAAGCCTGGG - Intronic
985634759 5:1030570-1030592 CCAAATCATCTCTAAAACCCAGG - Intronic
990944353 5:61234027-61234049 TCTAATCATCTCTGTCGCCCAGG - Intergenic
999038267 5:148378070-148378092 CCTAGTCATCTCTGCAGCCCTGG + Intergenic
999227132 5:150034998-150035020 CCTATTCATCTCTGAAAGCCTGG - Intronic
999323641 5:150630016-150630038 CCTCATCATCCCTGAAGCTTAGG + Intronic
999487055 5:152007534-152007556 CCTAATCTTCAGAGAAGCCCTGG + Intergenic
1006736131 6:36273931-36273953 CGTAATTATCGCAGAAGTCCAGG + Intronic
1007349071 6:41255582-41255604 CCTATTCCTCACTGAAGCCCTGG - Intergenic
1008534937 6:52500461-52500483 CCCAAACATCCCTGAAGCCCAGG + Exonic
1008964467 6:57300368-57300390 CCCACTCAGAGCTGAAGCCCAGG - Intergenic
1012665606 6:101964641-101964663 CCTAACCATTGCTGCAGCACTGG + Intronic
1012895205 6:104940235-104940257 CAAAATCATATCTGAAGCCCAGG - Intergenic
1013182598 6:107730950-107730972 CCTGATCCTTGCTGAAGCCTGGG + Intronic
1019767843 7:2864493-2864515 CCTCATCTTAGCTGAATCCCTGG - Intergenic
1024237557 7:47409519-47409541 ACTACTCATCACTGAAGACCTGG + Intronic
1031158327 7:118136412-118136434 CACAATCATGGCAGAAGCCCAGG - Intergenic
1040979503 8:53231659-53231681 CTTAATCAACACTGAATCCCTGG + Intronic
1042024737 8:64411099-64411121 CCTAACCATTGCTGAGCCCCAGG - Intergenic
1042862553 8:73328788-73328810 CCGAAGAATCGCTTAAGCCCAGG + Intergenic
1049403401 8:142440878-142440900 CCCAGTGACCGCTGAAGCCCTGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1058441031 9:105007382-105007404 CTTATTCATCTCAGAAGCCCCGG - Intergenic
1061070437 9:128306826-128306848 CACAAGAATCGCTGAAGCCCAGG - Intergenic
1061484531 9:130913730-130913752 CCTAATCCTAGCAGAAGCTCAGG + Intronic
1185807503 X:3072113-3072135 CCTAATCATGGTTGATGACCTGG + Exonic
1187245712 X:17551341-17551363 CCAAATCATCACTCAAGTCCTGG + Intronic
1190909801 X:54760400-54760422 CCTAAACATCATTGAATCCCGGG - Intronic
1193108663 X:77705307-77705329 CCTAAGCATGGCTGTAGACCTGG - Intronic
1196914348 X:120516840-120516862 CAGAAAGATCGCTGAAGCCCAGG + Intergenic
1197415467 X:126166958-126166980 CCCTATCATCACTGCAGCCCTGG - Intergenic
1198563390 X:137877795-137877817 AATGATCATCTCTGAAGCCCTGG + Intergenic
1199298014 X:146181129-146181151 CCTGATCATCGCTCAAGACCAGG - Intergenic