ID: 918236828

View in Genome Browser
Species Human (GRCh38)
Location 1:182589212-182589234
Sequence CGGGCTGCAAGCAGTCTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918236828_918236835 17 Left 918236828 1:182589212-182589234 CCTGGAAGACTGCTTGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 918236835 1:182589252-182589274 GCGTCACTGAGTCAGCAGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 127
918236828_918236836 29 Left 918236828 1:182589212-182589234 CCTGGAAGACTGCTTGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 918236836 1:182589264-182589286 CAGCAGGGCGGAGCCAAGAAAGG 0: 1
1: 0
2: 1
3: 27
4: 228
918236828_918236833 13 Left 918236828 1:182589212-182589234 CCTGGAAGACTGCTTGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 918236833 1:182589248-182589270 TGCTGCGTCACTGAGTCAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 95
918236828_918236834 14 Left 918236828 1:182589212-182589234 CCTGGAAGACTGCTTGCAGCCCG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 918236834 1:182589249-182589271 GCTGCGTCACTGAGTCAGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918236828 Original CRISPR CGGGCTGCAAGCAGTCTTCC AGG (reversed) Exonic
900581318 1:3411252-3411274 GGGGCTGGAAGCAGTCTGTCTGG - Intronic
901638719 1:10682402-10682424 CGGGCCCCCAGGAGTCTTCCGGG - Intronic
902682475 1:18053290-18053312 CGTGCTCCAAGCATTCTCCCGGG + Intergenic
903607203 1:24583794-24583816 CGGGAGGTAAGCAGTATTCCTGG - Intronic
905372535 1:37491477-37491499 CTGGCCTCAAGCAGTCCTCCTGG - Intergenic
906109648 1:43313988-43314010 CGGGCTGCAAGCATGCACCCAGG - Intronic
907339479 1:53724746-53724768 CTGGCTTCAAGCAATCCTCCTGG + Intronic
911004169 1:93200201-93200223 CTGGCTTCAAGCAATCCTCCTGG + Intronic
912698159 1:111856620-111856642 GGGGCTGGCAGCAGGCTTCCTGG - Intronic
915366184 1:155317937-155317959 CTAGCTGCAAGCTTTCTTCCTGG + Exonic
915626858 1:157119134-157119156 CGGGCTCCAAGCAGTGTGCTAGG + Intergenic
918236828 1:182589212-182589234 CGGGCTGCAAGCAGTCTTCCAGG - Exonic
919983002 1:202654011-202654033 CTGGCTGAAAGCAGGCTGCCAGG - Intronic
921869624 1:220125727-220125749 CTCGCTGCAACCTGTCTTCCAGG - Intronic
924286804 1:242495447-242495469 CGAGCTGTAAGCAGTATCCCAGG + Intronic
1066198707 10:33126258-33126280 TGGGCTGAAAGCAGGCTTCCGGG + Intergenic
1066793202 10:39089150-39089172 CAGGCTGGAAACAGTCTTTCTGG + Intergenic
1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG + Intergenic
1072895747 10:99365138-99365160 CTGGCAGGAAGCAGTGTTCCTGG - Intronic
1075468051 10:122666160-122666182 AGGGCTGCAGGCCTTCTTCCTGG + Intergenic
1076429347 10:130390962-130390984 CAGGCTGCAAGATGTCTTACGGG + Intergenic
1076885117 10:133258670-133258692 CAGGCTGCAAGCGGTGCTCCTGG - Intergenic
1078577829 11:12516591-12516613 CGGGCTGCAAGCCTCCTGCCAGG + Intronic
1082778953 11:57271280-57271302 CAGGCTGGAATCAGACTTCCTGG - Intergenic
1083590270 11:63889530-63889552 CGGGGTGGAGGCTGTCTTCCGGG + Intronic
1084435426 11:69136631-69136653 CAGGCTGCATGCAGCCTTGCTGG + Intergenic
1090963851 11:131581207-131581229 CGGGTTGCTGGCAGTCTTCCTGG + Intronic
1096127344 12:49129629-49129651 CGGGCTGGATGCCGTGTTCCAGG + Exonic
1096134302 12:49186740-49186762 CGGGCTGGATGCCGTGTTCCAGG + Exonic
1096144605 12:49269536-49269558 CGGGCTGGATGCCGTGTTCCAGG - Exonic
1098613910 12:72498598-72498620 CTGGCAGCTAGTAGTCTTCCTGG - Intronic
1101989095 12:109469765-109469787 CAGGCTGAAAGCAGTCAACCAGG - Intronic
1102171639 12:110847002-110847024 CGCGCAGCAAGCAGTCCTCCCGG + Exonic
1103270187 12:119667444-119667466 GGGGGTGCAGGCAGTCTTGCAGG - Intergenic
1104965412 12:132506856-132506878 GGGGAGGCAAGGAGTCTTCCTGG + Intronic
1106255076 13:28014965-28014987 CTGGCTTCAAGCAATCTTCCTGG - Intronic
1110858153 13:80319641-80319663 GGGGTTGGAAGCAGTTTTCCAGG + Intergenic
1113398800 13:109973115-109973137 CGGGCTGGAAGCAATGTCCCAGG - Intergenic
1117351454 14:54885588-54885610 TGTGCTGCAAGCTTTCTTCCTGG - Intronic
1119406930 14:74404879-74404901 CTGGCAGCAAACAGTCTTCAGGG + Intergenic
1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG + Intronic
1125009053 15:34850299-34850321 CGGGCTGCATGCCGTGTTCCAGG + Intergenic
1128190274 15:65686929-65686951 CTGGCTTCAAGCAATCCTCCTGG + Intronic
1129975308 15:79816692-79816714 AGAGGTGCCAGCAGTCTTCCTGG + Intergenic
1130445525 15:83997852-83997874 AGGACTGGAAACAGTCTTCCTGG - Intronic
1133041967 16:3065634-3065656 CCTTCTGCACGCAGTCTTCCTGG - Exonic
1134764395 16:16743971-16743993 CGGGCTGCAGGATGTCTACCTGG + Intergenic
1134886450 16:17797448-17797470 CGGGCTGCCAGCAGAACTCCCGG + Intergenic
1134981663 16:18615243-18615265 CGGGCTGCAGGATGTCTACCTGG - Intergenic
1136579444 16:31142773-31142795 CGGGCAGGAAGTAGTGTTCCGGG + Exonic
1140405400 16:74707311-74707333 CTGGCTTCAAGTAGTCCTCCTGG + Intergenic
1140462375 16:75149893-75149915 CCGGGTTCAAGCAGTCCTCCTGG + Intronic
1140904991 16:79402431-79402453 GAGGCTACAAGCATTCTTCCAGG + Intergenic
1141805549 16:86339045-86339067 CTGGCTGCCCCCAGTCTTCCAGG + Intergenic
1141873593 16:86806425-86806447 TGGGCTGGAAGCAGTCTGCAGGG + Intergenic
1142852636 17:2711589-2711611 CGGCCTGCGAGCCGTGTTCCCGG + Intronic
1142976602 17:3648376-3648398 CTGGCTGGAAGCCGTCTTCTGGG - Intronic
1143162811 17:4882342-4882364 ATGGCTCCAACCAGTCTTCCTGG - Intronic
1146000573 17:29128065-29128087 CCCGCGGCAAGCAGTCTTCTGGG - Intronic
1147757637 17:42779493-42779515 CTGGCTGCAGGCAGCCTTCCAGG + Exonic
1149329833 17:55569347-55569369 TTGGCTTCAAGCAGTCCTCCTGG + Intergenic
1149819748 17:59764550-59764572 CTGGCTTCAAGCAGTCATCCTGG + Intronic
1151979505 17:77500119-77500141 CTGGCTGCAAGCAGCCAGCCCGG - Exonic
1152392364 17:80010390-80010412 GGGGCTGCAAGCAGGCTGCGAGG + Exonic
1152673813 17:81626220-81626242 CGGGGTTCAAGCGGTTTTCCTGG - Intronic
1157613948 18:48976006-48976028 CGGGCCGTATGCCGTCTTCCCGG + Intergenic
1163690743 19:18736964-18736986 CGGGCAGCACTCAGTCTCCCAGG - Intronic
1165430221 19:35767878-35767900 CGGGCTGCAGGCAGGCTCCAGGG - Exonic
1166353786 19:42215309-42215331 CGTGGTGCAGGCATTCTTCCAGG - Intronic
1167190622 19:47986508-47986530 CTGGGTTCAAGCAGTCCTCCTGG - Intronic
1167292204 19:48630507-48630529 CGGGCTGCAGCCAGTATGCCAGG + Exonic
1168301446 19:55407398-55407420 CGGGCGGCCCGCAGTCTCCCTGG - Intronic
926334102 2:11850310-11850332 CGGGCTGCAGGCACACTTCCAGG - Intergenic
929793506 2:45040776-45040798 AGGGTTGCAAGCAGGCTCCCTGG + Intergenic
930632534 2:53769280-53769302 CTGGCCTCAAGCAGTCCTCCTGG - Intronic
932071423 2:68624536-68624558 AGGCTTTCAAGCAGTCTTCCAGG + Intronic
932174259 2:69585288-69585310 CTGGCTTCAAGCAATCCTCCTGG + Intronic
932781777 2:74563150-74563172 CTGGGTTCAAGCAGTCTTCCTGG - Intronic
934563188 2:95323689-95323711 CGGGATGCCACCTGTCTTCCAGG + Intronic
935331079 2:101978594-101978616 TGGGCGGCAAGCAGTCATCTTGG - Intergenic
937986936 2:127642199-127642221 GGGGCTGCACGCTGTCTTCCAGG - Exonic
940859118 2:158754000-158754022 CTGGCTGCAAGCAGACATTCTGG - Intergenic
941371394 2:164669533-164669555 TGGGCAGCAAGCAGTGTTCTTGG - Intronic
949051127 2:241897961-241897983 CTGGGCTCAAGCAGTCTTCCTGG + Intronic
1170718583 20:18854613-18854635 CTGGCTGCAAGCAGTGACCCCGG + Intergenic
1171109970 20:22471827-22471849 CTGGGTGCTAGCAGGCTTCCTGG - Intergenic
1173221873 20:41137912-41137934 CGGGGTGCAAGCAGTCGGGCCGG - Intronic
1174588576 20:51627346-51627368 CGTCCTCCAAGAAGTCTTCCTGG - Intronic
1174737033 20:52973787-52973809 CGGGCTGCAGGCAGGCTTTGGGG + Intronic
1174767585 20:53268521-53268543 CGGGATGGAACCGGTCTTCCTGG + Intronic
1175066939 20:56297059-56297081 AGGGCAGAAATCAGTCTTCCTGG + Intergenic
1175138318 20:56841502-56841524 CAGGCTGCAGCCACTCTTCCCGG + Intergenic
1175183016 20:57161676-57161698 CGAGCTGCAGGCAGTGTTCTGGG - Intergenic
1175773097 20:61635921-61635943 GGGGCTTCCCGCAGTCTTCCAGG + Intronic
1176074211 20:63241101-63241123 CGGGCTGCAAGCACTGCTGCTGG - Exonic
1184334095 22:43843184-43843206 CTGGCCTCAAGCAGTCCTCCCGG - Intronic
952767543 3:36967913-36967935 CCCACTGCAAGCAGTCATCCTGG - Intergenic
957284721 3:78203537-78203559 AGAGCTGCAAGGAGGCTTCCAGG + Intergenic
957362409 3:79176113-79176135 CTGGCTGCCTGAAGTCTTCCAGG + Intronic
961564571 3:127754404-127754426 AGGACTGCAAGCCGTCTTCAGGG + Intronic
967633680 3:191776749-191776771 AGGGCAGCAAGCAGTATACCTGG - Intergenic
969440481 4:7213891-7213913 TGGGCTGGAAGCTGGCTTCCTGG + Intronic
969521860 4:7682748-7682770 AGGGGTGAAAGGAGTCTTCCTGG + Exonic
975577362 4:75876382-75876404 CCGGCAGCAAGCAGGCCTCCTGG - Exonic
979514719 4:121594661-121594683 CAGGCTGCCCACAGTCTTCCTGG - Intergenic
981120141 4:141040128-141040150 CGGGGTTCTTGCAGTCTTCCAGG - Intronic
983550596 4:169013529-169013551 CTGCCAGCAAGCAGTCTCCCAGG + Intergenic
986051265 5:4092302-4092324 CGGGCAGCAAGTAGTCCTCTGGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
993845822 5:92942081-92942103 AGAGCTGCTAGCAGGCTTCCAGG - Intergenic
997661153 5:135590458-135590480 GGGGCTCCAAGCAGTTTTACAGG - Intergenic
997995215 5:138579883-138579905 CTGGCCTCAAGCAGTCCTCCTGG + Intergenic
1001605725 5:172958702-172958724 GGGCCTCCAGGCAGTCTTCCAGG + Intergenic
1003672787 6:8174872-8174894 TGGGGTGCAAGAAGTCTTCATGG + Intergenic
1005743169 6:28811832-28811854 AGGGAAGCAAGCAGTATTCCTGG - Intergenic
1006760407 6:36455700-36455722 CTGGCTGCAACCTGTCTTACGGG - Intronic
1011710914 6:90053505-90053527 CTGGCCTCAAGCAATCTTCCTGG + Intronic
1013934429 6:115576513-115576535 CGGGCTCAAGCCAGTCTTCCTGG - Intergenic
1015388697 6:132655575-132655597 GGGGCTCCAAGCAATCCTCCTGG + Intergenic
1016672929 6:146729670-146729692 CTGGCTTCAAGCAATCCTCCTGG + Intronic
1017430935 6:154369977-154369999 CGGCCTACAAGCACTCTACCAGG + Intronic
1022099597 7:27161257-27161279 CGGGCTCCACGCAGACTCCCCGG - Intergenic
1023468110 7:40481103-40481125 CTGGCTTCAAGCAATCCTCCTGG - Intronic
1024462166 7:49670149-49670171 CAGGCTGCACTCAGCCTTCCTGG - Intergenic
1027173374 7:75888312-75888334 CAGGCTCCAAGGAGTCCTCCAGG + Exonic
1030454622 7:109758102-109758124 AGGGCTTCAAGCAATCTTCTTGG + Intergenic
1031262355 7:119537168-119537190 CGGTCTATAAGGAGTCTTCCTGG - Intergenic
1033375613 7:140759066-140759088 CTGGCTGCATGCAGTGTTACGGG + Intronic
1034274450 7:149817931-149817953 CGGCCTCGAAGCAGTCGTCCAGG - Intergenic
1035971850 8:4258171-4258193 CTGGCCTCAAGCAATCTTCCTGG + Intronic
1038185387 8:25269112-25269134 CAGGAAGCAAGAAGTCTTCCAGG - Intronic
1041346249 8:56901634-56901656 CTAACTGCAAGCAGTCTTCTTGG - Intergenic
1047274590 8:123396127-123396149 CGGGCTGCCGGCAGTCCCCCCGG + Intronic
1049331791 8:142058523-142058545 CCGCCTGCAGGAAGTCTTCCAGG - Intergenic
1051661332 9:19429747-19429769 CGCCCTGCTAGCATTCTTCCTGG + Intronic
1053262246 9:36678498-36678520 CTGGGCTCAAGCAGTCTTCCCGG + Intergenic
1058910898 9:109518978-109519000 GGGGCTCCAGGAAGTCTTCCTGG - Intergenic
1058985686 9:110207175-110207197 CTGGCTGCCAGCACTGTTCCTGG - Intronic
1060294370 9:122333274-122333296 CCGACTGCAGGAAGTCTTCCAGG + Intergenic
1187142715 X:16609540-16609562 AGGGTTGCAAACTGTCTTCCAGG - Exonic
1187370250 X:18699482-18699504 CGCGCTGCCAGCAGTTTCCCTGG - Intronic
1190126261 X:47708301-47708323 AGGGATGCAAGGAGTGTTCCTGG + Intergenic
1191257003 X:58283894-58283916 CGAGCTGCAAGAAGTACTCCAGG - Intergenic
1192211161 X:69128884-69128906 GGCGCTGCACGCATTCTTCCCGG + Intergenic
1198727384 X:139691918-139691940 CCTCCTGCAAGCAGTCTTCGTGG - Intronic
1201777216 Y:17679296-17679318 CGGGTTGCAATCACTCTTTCTGG - Intergenic
1201824341 Y:18226696-18226718 CGGGTTGCAATCACTCTTTCTGG + Intergenic