ID: 918238623

View in Genome Browser
Species Human (GRCh38)
Location 1:182603001-182603023
Sequence TCCACGGATGAGGGCACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918238623_918238630 -6 Left 918238623 1:182603001-182603023 CCCTGTGTGCCCTCATCCGTGGA 0: 1
1: 0
2: 1
3: 10
4: 123
Right 918238630 1:182603018-182603040 CGTGGATGGACTTGGAGCCCTGG 0: 1
1: 0
2: 2
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918238623 Original CRISPR TCCACGGATGAGGGCACACA GGG (reversed) Intronic
900291426 1:1925235-1925257 TGAAGGCATGAGGGCACACAGGG + Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901570354 1:10155238-10155260 TCCAGGCCAGAGGGCACACATGG - Intronic
904156639 1:28488863-28488885 TTCACGGATGAGGACACTCAAGG + Intronic
905874196 1:41422048-41422070 TCCAGGGCTCAGGGCACAGATGG + Intergenic
909403880 1:75264217-75264239 TCCAGGGATGTGGAGACACAAGG - Intronic
918238623 1:182603001-182603023 TCCACGGATGAGGGCACACAGGG - Intronic
921906845 1:220504478-220504500 TCCTGGGATGAGGGATCACAGGG - Intergenic
922875447 1:228936689-228936711 TCCTCGGGTCAAGGCACACAAGG + Intergenic
1067142931 10:43671280-43671302 CACACAGATGAAGGCACACATGG + Intergenic
1067817537 10:49493724-49493746 TCCACTGATGGGGGCTCATAAGG + Intronic
1070961299 10:80502019-80502041 TCAACAGAGGAGGTCACACATGG + Intronic
1073237404 10:102029722-102029744 TCCTCGAATGAGTGCGCACAGGG + Exonic
1073610357 10:104937024-104937046 TCCACAGATGGGGGCACAGGGGG + Intronic
1076354023 10:129839488-129839510 TCCACAGATGAGGCCACACGGGG - Intronic
1076362575 10:129899654-129899676 TCCACAGGTGAGGACACACCAGG + Intronic
1076562555 10:131376792-131376814 ACCACGGATGAGGGAGCACCAGG + Intergenic
1076562572 10:131376851-131376873 ACCACGGATGAGGGAGCACCAGG + Intergenic
1076562589 10:131376910-131376932 ACCACGGATGAGGGAGCACCAGG + Intergenic
1076562606 10:131376969-131376991 ACCACGGATGAGGGAGCACCAGG + Intergenic
1076562623 10:131377028-131377050 ACCACGGATGAGGGAGCACCAGG + Intergenic
1076562640 10:131377087-131377109 ACCACGGATGAGGGAGCACCAGG + Intergenic
1076562657 10:131377146-131377168 ACCACGGATGAGGGAGCACCAGG + Intergenic
1076562674 10:131377205-131377227 ACCACGGATGAGGGAGCACCAGG + Intergenic
1077000614 11:320419-320441 GCCACTGACGTGGGCACACACGG + Intronic
1077142390 11:1030329-1030351 CCCACGGCTGTGGGCACACGCGG + Exonic
1077647032 11:3934381-3934403 TTCAAGGATGAGGGAACAGAAGG - Intronic
1079164338 11:18024878-18024900 TCTCAGGATGAGGGCACACAAGG - Intronic
1079329653 11:19522966-19522988 TCCACAGTTGAGGACTCACAAGG + Intronic
1081406507 11:42704937-42704959 TCCAAGGATGAGGACACAGATGG - Intergenic
1084043307 11:66555147-66555169 TCGGTGGATGAGGGCACAGAGGG - Exonic
1084520275 11:69658393-69658415 GCCACTCACGAGGGCACACAAGG + Intronic
1098060929 12:66561672-66561694 TTCAGAGATTAGGGCACACAAGG - Intronic
1100829741 12:98506782-98506804 ACCAAGGATGTGTGCACACAGGG + Intergenic
1102082333 12:110108482-110108504 TCCACGGATGAGGAAATAGAGGG - Intergenic
1107257271 13:38443007-38443029 TTCATGGATCAGGGCACCCAAGG + Intergenic
1108596806 13:51956382-51956404 TACATGGACAAGGGCACACAAGG + Intronic
1109827802 13:67745530-67745552 TACACAGCTGAGGGCACACTGGG - Intergenic
1113751628 13:112780510-112780532 TCCACTGATGAAGGGATACACGG - Intronic
1113893029 13:113746473-113746495 GCCAAGGTTAAGGGCACACATGG - Intergenic
1115559386 14:34569352-34569374 TCTAGGGATATGGGCACACATGG - Intronic
1124637677 15:31375299-31375321 TCCACTGAGGCGGGCACACAAGG + Exonic
1126911301 15:53419770-53419792 TCCACAGATGAGGTCCCTCAGGG + Intergenic
1131432479 15:92397734-92397756 TCCATGGAACTGGGCACACAAGG + Intronic
1131514311 15:93066940-93066962 TTCACTGATGAGGAAACACAGGG - Intronic
1131926149 15:97386048-97386070 TCCTTGGATGAGGGCTTACAAGG + Intergenic
1133261188 16:4551371-4551393 TCCAAGCATGAGGTCACCCAAGG + Intergenic
1136991338 16:35152986-35153008 GCCAAGTATGAGGGGACACAGGG - Intergenic
1139452308 16:67040093-67040115 TCCACGGATGAGAAAACACAGGG - Intronic
1142612170 17:1115046-1115068 TCCAGGGGTCAGGTCACACAAGG + Intronic
1148542693 17:48492950-48492972 ACCTCGGAAGAGGGCACACCCGG + Intergenic
1150789466 17:68190103-68190125 TCCAGGCATGGTGGCACACAAGG - Intergenic
1151233459 17:72701310-72701332 TCCACTGAGGAGGGCACACAAGG + Intronic
1152271081 17:79325232-79325254 TCCAGGGATGAGCCCACCCAGGG - Intronic
1154106796 18:11530759-11530781 TCCTCAGTTCAGGGCACACAGGG + Intergenic
1156502588 18:37568847-37568869 TCCACGGATGAAGAGACACCAGG - Intergenic
1162148209 19:8626595-8626617 TCCCCAGCTGAGGTCACACAAGG - Intergenic
1163643352 19:18474251-18474273 CCCATGGCTCAGGGCACACATGG - Intronic
1163668398 19:18613598-18613620 TCCAGGGAGGAGGGGAGACATGG - Intronic
1165700434 19:37933162-37933184 GTCACAGATGAGGTCACACAGGG - Intronic
1167048901 19:47067158-47067180 TCCACGGATTCCAGCACACAGGG - Exonic
925328528 2:3040962-3040984 TGCAAGGATGAGAGCACACGTGG - Intergenic
925744638 2:7033635-7033657 TTCACGGAGGAGGTCACACCTGG - Intronic
926128755 2:10287156-10287178 TCCACGAAAGTGGGCACAGATGG + Intergenic
927085376 2:19669944-19669966 GCCACGAATGAGGGCACCCCGGG - Intergenic
934001143 2:87713831-87713853 TGCACGGATTTGGGTACACATGG + Intergenic
937900082 2:127013150-127013172 TCCACACGTGTGGGCACACATGG - Intergenic
938255358 2:129855168-129855190 ACCAGGGATGTGTGCACACAAGG - Intergenic
938734717 2:134175771-134175793 TCCAGGGAGGTGGACACACATGG - Intronic
940295958 2:152124320-152124342 TCCAGGGATGAGGGTAAAGAAGG - Intronic
947257196 2:228180432-228180454 TCCACTGGCCAGGGCACACATGG - Intronic
948527224 2:238578583-238578605 TCCACGGATGAGTGGAGTCATGG + Intergenic
1168802973 20:655202-655224 ACCAAGGATGATGGCACAAAAGG - Intronic
1172093372 20:32448700-32448722 TCCTCGGATGATGGCAAAGAGGG + Intronic
1172969640 20:38863946-38863968 TCAACTGATGAGGGGATACATGG + Intronic
1174545463 20:51322037-51322059 TGCACGTACGCGGGCACACACGG + Intergenic
1174877959 20:54248098-54248120 GCCAGGGCAGAGGGCACACAAGG - Intergenic
1176210567 20:63919423-63919445 GCCACGGAAGAGGACACACCCGG + Intronic
1176217197 20:63953846-63953868 GCCACGGGAGAGAGCACACAGGG + Intronic
1179239666 21:39579050-39579072 CCCACGGTTGAGGGCACACTGGG - Intronic
1179727689 21:43349449-43349471 TCCTAGGCTGAGGTCACACAGGG - Intergenic
1180139954 21:45887169-45887191 GCCAGGGACCAGGGCACACAGGG - Intronic
1180709067 22:17827530-17827552 GCCACCCATGAGGTCACACACGG - Intronic
1184104670 22:42360395-42360417 TCCCCAGATGAGGGCTCTCAGGG + Intergenic
1184601534 22:45546710-45546732 TAAACAGATGACGGCACACAAGG - Intronic
1184886941 22:47352247-47352269 TCCACAGATGAGGCCAGGCAGGG - Intergenic
1185054065 22:48568929-48568951 GCCAGGGATGAGGGCAGACGAGG + Intronic
949684365 3:6551282-6551304 TCCACTAATGAGGCCACACTGGG - Intergenic
954293682 3:49662713-49662735 ACCACGGACCAGGGCACAGATGG - Intronic
954415181 3:50389897-50389919 TACATGGATGGTGGCACACAAGG + Intronic
958171730 3:89947550-89947572 TGCACAGAAGAGGTCACACAGGG - Intergenic
962374967 3:134851636-134851658 TCCACAGGTCAGGGCACCCAAGG - Intronic
962478739 3:135780265-135780287 TCCACCGATGAGGGCCCCAAGGG - Intergenic
963359936 3:144258624-144258646 TCCACTGATGAGAGAACAAATGG - Intergenic
963554933 3:146775076-146775098 TCCACAGCTGAGGGTACAAATGG + Intergenic
968283843 3:197496711-197496733 GCCATGGATGAGGACACTCACGG + Intergenic
968494221 4:906616-906638 CCCAGGGATGATGCCACACATGG - Intronic
968841698 4:3011656-3011678 TCCCCGCATGAGGGCAAGCAGGG - Intronic
969266002 4:6064500-6064522 CCCACGCATGTGTGCACACACGG - Intronic
969298838 4:6285383-6285405 TCCAGGGATGGGGGCATCCAGGG + Intronic
976796561 4:88940265-88940287 ACCACTGATGAGGGCTCAGAGGG + Intronic
980492134 4:133541928-133541950 ACCAGGGAGGAGGACACACATGG - Intergenic
986011963 5:3724794-3724816 TCCACGGATCAGTGCAAACGTGG - Intergenic
987642766 5:20633496-20633518 TCCAGGGATGTGGAGACACAGGG - Intergenic
988107842 5:26773249-26773271 TCCTCTGCTGAGGTCACACATGG - Intergenic
1005594243 6:27363666-27363688 GCCAGGCATGATGGCACACATGG + Intergenic
1006276228 6:33007370-33007392 TCCTCGGCTGAGGGCACGAAGGG + Exonic
1008403339 6:51090321-51090343 TCCACAGATTCAGGCACACAGGG - Intergenic
1017025406 6:150176870-150176892 TATACGGATGAGGCCACTCAAGG + Intronic
1018331608 6:162733754-162733776 TCAAGAGATGAGGACACACAGGG - Intronic
1025034924 7:55587973-55587995 TCTAGGGATGAGGGCACATGAGG + Intergenic
1025609542 7:63066367-63066389 TCCACTGAAGACGACACACACGG + Intergenic
1027189329 7:75988561-75988583 TCCCGGGGTGGGGGCACACATGG - Intronic
1027437192 7:78176397-78176419 TCCAAGGATGAGGGCTCTCCAGG - Intronic
1028963113 7:96771855-96771877 TCCACTGATGCTGGCACACAGGG - Intergenic
1029444299 7:100604148-100604170 ACGACGGATGAGGGCACAGGAGG + Exonic
1029520969 7:101062060-101062082 TCCACCAATGAGGGCAACCAAGG + Intergenic
1034112101 7:148547188-148547210 TCCAGGGATGAGAGAAGACATGG + Intergenic
1038195054 8:25359722-25359744 TCCACGGATGGGGGCAGGAATGG - Intronic
1039080817 8:33732565-33732587 TTCACGGCTGAGTACACACAGGG + Intergenic
1039977740 8:42381613-42381635 TGCACAGATCAGGGCAGACAGGG - Intergenic
1042268695 8:66934858-66934880 TCCACTGGTGAGGTTACACATGG + Intergenic
1045473842 8:102536903-102536925 GGCACGGATGAGGGCAGAAAAGG - Intronic
1047391509 8:124455755-124455777 GCCAAGGTTGAGGACACACATGG + Intronic
1048180414 8:132189278-132189300 CCCAGGGATGAGATCACACAAGG - Intronic
1049560216 8:143306604-143306626 TGTACAGATGAGGACACACAAGG - Intronic
1052020176 9:23516807-23516829 TCCACTGAGGAGGGAAAACATGG + Intergenic
1057270133 9:93645886-93645908 TCCACTGCTCACGGCACACATGG - Intronic
1060414112 9:123418767-123418789 TTCACAGATGAGGGCAAGCAAGG + Intronic
1187468417 X:19546593-19546615 TCCAGGGATAAGGGCTCACCAGG + Intronic
1188041047 X:25369933-25369955 TCCAGGGATGTGGGGACGCAGGG + Intergenic
1190641701 X:52486624-52486646 TCCACTGAAGAGGACACACATGG + Intergenic
1190644148 X:52509169-52509191 CCCACTGAAGAGGACACACATGG - Intergenic
1190645971 X:52526241-52526263 TCCACTGAAGAGGACACACATGG - Intergenic
1196310763 X:114162423-114162445 TCCAGGGATGTGGAGACACAGGG + Intergenic