ID: 918238661

View in Genome Browser
Species Human (GRCh38)
Location 1:182603188-182603210
Sequence CTCAGGGCTCCGAGAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918238661 Original CRISPR CTCAGGGCTCCGAGAGGGAA GGG (reversed) Intronic
900346983 1:2214739-2214761 GCCAGGACTCCGAAAGGGAAGGG - Intergenic
900438861 1:2643559-2643581 CTCAGAGCTCCCAGAGGGACTGG - Intronic
901378834 1:8859299-8859321 CACAGGGCTGCCAGTGGGAAGGG - Intergenic
901501155 1:9653135-9653157 CTCAGGGCTCTCGGAGGGGAAGG + Exonic
902322370 1:15677170-15677192 CTTAGTGCACCTAGAGGGAAAGG - Intergenic
902709774 1:18230785-18230807 GGCAGGGCTTCCAGAGGGAATGG + Intronic
903378651 1:22882246-22882268 CTGTGGGATCAGAGAGGGAAGGG - Intronic
904472010 1:30741838-30741860 CTCAGGACTGCAAGAGGGCAGGG - Intronic
904864223 1:33563985-33564007 CTCTGTGCTCCAAGAGAGAATGG + Intronic
905065263 1:35175518-35175540 ATAAGGGCTCCAAGAGTGAAGGG + Intergenic
906511440 1:46412344-46412366 CTGTGGGCCCCGAGAGGGCAGGG - Intronic
906681059 1:47725640-47725662 CTGAGGGCTCAGAAAGGGGAAGG - Intergenic
907245229 1:53104064-53104086 CTCTGGGGGCAGAGAGGGAAAGG - Intronic
907598791 1:55745831-55745853 CTCAGGGCCCAGACAGAGAATGG - Intergenic
910513811 1:88036461-88036483 GTCAGAGCTCCCAGAGGGAGGGG + Intergenic
912697566 1:111852913-111852935 CTCAGGACTTGGGGAGGGAAAGG - Intronic
912701581 1:111882128-111882150 ACCAGAGCTCAGAGAGGGAAGGG - Intronic
913407869 1:118516179-118516201 TTAAGGGCTGCCAGAGGGAAAGG - Intergenic
914431860 1:147625880-147625902 CTCTTGGCTCTGAGAGGGAAAGG + Exonic
915196137 1:154191371-154191393 CTCAGGGCTCCAAGAGCCCAGGG - Intronic
915974263 1:160374843-160374865 CTCAGGGATCCCTGAGGGGAGGG - Intergenic
916256280 1:162790872-162790894 ATCAGGGGTCCGAGAGAGCAGGG + Intronic
916720945 1:167484396-167484418 CTCTGGGCTCCCAAAGGGGAAGG - Intronic
918238661 1:182603188-182603210 CTCAGGGCTCCGAGAGGGAAGGG - Intronic
918955275 1:191199268-191199290 CTCAGGACTACTAGAAGGAAAGG - Intergenic
919883487 1:201916166-201916188 CTCAGCACTCCGAGAGGCCAAGG - Intronic
920086677 1:203422530-203422552 GTCAGGGATGCTAGAGGGAAAGG - Intergenic
920135494 1:203765808-203765830 CTCAGGGGTGCTAGGGGGAAAGG + Intronic
920258754 1:204674573-204674595 CCCAGGGCTGTGGGAGGGAAGGG - Intronic
920379120 1:205525749-205525771 CTTTGGGCTCCTGGAGGGAAAGG - Intronic
921382702 1:214541446-214541468 CTCAGGGATGTGGGAGGGAAGGG - Intronic
921677281 1:217990474-217990496 CTCAGGGAGCCAAGAGGGACAGG + Intergenic
1063108740 10:3016996-3017018 ACCAGGGCCCCGAGAGGGAAGGG - Intergenic
1063366906 10:5496584-5496606 CTCAGGGCTCTGAACAGGAAGGG - Intergenic
1063859767 10:10294919-10294941 CCCTGGGCTCCGAGAGTGCAGGG + Intergenic
1064016418 10:11776058-11776080 CTCAGGGCTCTGAGTGGCACAGG - Intergenic
1066179779 10:32949412-32949434 CTCAGGGCACAGAAATGGAAAGG + Intronic
1066722742 10:38356525-38356547 ATCAGGGGTCCGAGAGAGCAGGG + Intergenic
1067208657 10:44240760-44240782 CTCAGGGATACCAGAGGGGAAGG - Intergenic
1067279351 10:44859593-44859615 CTCAGGGCGCTGGGATGGAAGGG - Intergenic
1067942715 10:50669767-50669789 CTCAGGACCCCAAGAGAGAATGG - Intergenic
1069614641 10:69799273-69799295 TTCAGGGCTCCCAGAAGAAAGGG - Intergenic
1070045749 10:72834541-72834563 CTTAGGGGTCAGAGAGAGAAAGG + Intronic
1070863958 10:79694730-79694752 CTCAGGACCCCAAGAGAGAATGG - Intergenic
1070987611 10:80701858-80701880 CCCAGGGATCAGAGAGGGAAGGG + Intergenic
1071458777 10:85872014-85872036 CTCAGGACTACCAGATGGAATGG + Intronic
1071467109 10:85951211-85951233 CTCTGGGCTCCAGGAGGGCAAGG + Intronic
1071630856 10:87216956-87216978 CTCAGGACCCCAAGAGAGAATGG - Intergenic
1072048665 10:91682045-91682067 CTCAGGGCACAGACAGGGAGGGG - Intergenic
1072301294 10:94064859-94064881 CTCAGGGCTCTGCCAGGAAAAGG - Intronic
1072616035 10:97049406-97049428 CCCAGGGCAGAGAGAGGGAAAGG - Intronic
1074444969 10:113514142-113514164 CACTGGGCACTGAGAGGGAAGGG + Intergenic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1075443463 10:122497592-122497614 CTCAGGGCTCAGGGAGGCAAAGG - Intronic
1075711055 10:124530662-124530684 CCCAGGGCCCCGAGAGGCAGAGG - Intronic
1076032848 10:127174194-127174216 CTCAGGGCTCGCAGAGTGAAGGG + Intronic
1076209656 10:128629974-128629996 CTCAGGGACCCGAGAGGCAGAGG + Intergenic
1076587268 10:131558048-131558070 CTCAGGCCTCTGAGAGAGGAGGG + Intergenic
1076620225 10:131782511-131782533 CTCAGAGCTCTTAGAGGAAATGG + Intergenic
1076662306 10:132063643-132063665 CTCTGGGCTCCGGGAGAGAACGG + Intergenic
1077571904 11:3346441-3346463 CTTAGGGCTGGGGGAGGGAAGGG + Intronic
1077633514 11:3826720-3826742 CTTAGGGCTCAGAAAGGGAGAGG - Intergenic
1078452811 11:11453030-11453052 CTCAGGGCTGGGTGAGGGCAGGG - Intronic
1081547761 11:44083749-44083771 CTCCTGGCTCTGAGAGGGACGGG - Exonic
1083472364 11:62892567-62892589 CTGAGGGCTCAGAGAAGTAAAGG + Intergenic
1083503671 11:63135034-63135056 CTTAGTGGTCCGAGAGGAAAAGG - Intronic
1083593917 11:63910068-63910090 CCCAGGGCTGGGAGAGGGGAGGG + Exonic
1084382184 11:68819835-68819857 CTCATGGCTCAAAGAGGGAGAGG - Intronic
1084580434 11:70019916-70019938 CTGAGGCCTCGGAGTGGGAAGGG + Intergenic
1084674454 11:70625969-70625991 CTCAGCCCTCCGAGCGGGAGGGG - Intronic
1084753500 11:71220122-71220144 CTCAGGAGGCCGAGATGGAAAGG + Intronic
1084767275 11:71320876-71320898 CTCCGAGCTCCGTGAGGGCAGGG + Intergenic
1084859049 11:72006322-72006344 CTGAGGGCTTCGGAAGGGAATGG - Intronic
1084904679 11:72336386-72336408 CCCAGTGCTCTCAGAGGGAAGGG - Intronic
1085053750 11:73392560-73392582 CTCTGGGGTCTGAGAGGGAGAGG + Intronic
1089560292 11:119340201-119340223 CCCGGGGCTCCGGGAGAGAAAGG - Exonic
1089780021 11:120867118-120867140 CTGTGGCCTCCGAGAGGGAAGGG + Intronic
1090116945 11:123983540-123983562 CTAAGGGCTGCCAGAGAGAAAGG - Intergenic
1091085187 11:132714893-132714915 CTGAGGGCTTGGAGAGGAAATGG + Intronic
1091580684 12:1786809-1786831 CTCAGGCCTCCCAAAGGGAGTGG - Exonic
1092126544 12:6078770-6078792 GTCACGGCTCTGAGAGGGGAGGG - Intronic
1092826381 12:12403708-12403730 CCCAGGGCTGAGGGAGGGAATGG - Intronic
1094054813 12:26257883-26257905 CTAAGGGCAGCCAGAGGGAAAGG + Intronic
1094289084 12:28825977-28825999 CTCTGGGGTCCTAGATGGAAGGG - Intergenic
1094331345 12:29297615-29297637 CTTGGGGCTCAGAGAGGGCAAGG - Intronic
1095773647 12:45990119-45990141 CGCGGGGCAGCGAGAGGGAAAGG + Intronic
1096369195 12:51054587-51054609 CTCAGGGCTCCAAGAGTGAGGGG + Intronic
1096757190 12:53809519-53809541 CTGAGGGCTCCCCGAGGGCAAGG + Intergenic
1100956457 12:99914667-99914689 ATCAGGGCTCTGATAGGGAAAGG + Intronic
1103659687 12:122503829-122503851 CTCAGGGCTCCCAAAGTGATGGG - Intergenic
1105288648 13:19030214-19030236 ATCAGGGCTCTCAGAGGGACTGG + Intergenic
1105706661 13:22971578-22971600 CTCAGGGCTCTGAGGGGGACTGG - Intergenic
1106227317 13:27794958-27794980 CTGAGGGTTCCGAGAGGCACTGG - Intergenic
1106316651 13:28600108-28600130 AGCAGGGCTGCGGGAGGGAAGGG + Intergenic
1109687696 13:65843415-65843437 CCCAAGCCTCCGAGAGGGCAGGG - Intergenic
1110402521 13:75110222-75110244 CTAAGGGCAGCGAGAGAGAAAGG + Intergenic
1112151184 13:96766053-96766075 CCCAGGGCTACAAAAGGGAATGG - Intronic
1113650515 13:112031124-112031146 CTTAGGGCTCCCACAGGGAGAGG + Intergenic
1113673686 13:112194150-112194172 CTCAGGGCGCAGAGGGGGACAGG - Intergenic
1113813868 13:113158642-113158664 CCCAGCGCTCCGGGTGGGAATGG + Exonic
1113892197 13:113742368-113742390 TTCAGGGCTCCCAGCAGGAAAGG - Intergenic
1119709270 14:76809549-76809571 CTCAGGGCCCCGAGGGGCCATGG + Exonic
1122047916 14:99036470-99036492 CTCAGGACTCCCAGCTGGAAGGG - Intergenic
1123919162 15:25058425-25058447 CTCAGGACACCCAAAGGGAATGG - Intergenic
1126183250 15:45806551-45806573 CACAGGGTTCCAAGAGGAAATGG + Intergenic
1128262156 15:66240066-66240088 CTCAGGGCAGGGAGAGGGAGAGG - Intronic
1128751355 15:70152398-70152420 CTCAGGGCCCCCAGAGAGACTGG + Intergenic
1129892585 15:79081464-79081486 TGCAGGGCTCTGAGTGGGAAAGG - Intronic
1131942794 15:97585478-97585500 CTCCGGGCTCCTGGAGGGAGAGG - Intergenic
1132391900 15:101445286-101445308 CCCAGGTCACCCAGAGGGAAGGG - Intronic
1132500576 16:282996-283018 CCCAGGGCACCGAGAGAGACAGG - Exonic
1132515479 16:363928-363950 CTGAGGGCTCCGAGAGGCTGGGG + Intergenic
1132942525 16:2515049-2515071 TTCAGGCCTCAGGGAGGGAAAGG - Intronic
1133267134 16:4591987-4592009 ACCAAGGCTCAGAGAGGGAAGGG + Intronic
1134215477 16:12313659-12313681 CTCAGGGCCCCATGAGGGCAGGG + Intronic
1135561284 16:23478846-23478868 CCCAGGGCCCGGAGAGAGAATGG - Intronic
1136135679 16:28255578-28255600 GTCAGGGGTGGGAGAGGGAAAGG + Intergenic
1137629120 16:49929839-49929861 CTCAGGTCCAGGAGAGGGAATGG + Intergenic
1139467853 16:67163853-67163875 GTAAGCGCTCTGAGAGGGAACGG + Exonic
1141284746 16:82661040-82661062 GTCAGGTCTCCGTGAAGGAAAGG + Intronic
1142118585 16:88374477-88374499 CTGGGGGCCCCGACAGGGAAAGG + Intergenic
1142164560 16:88579233-88579255 CCCAGGGCTGGCAGAGGGAAAGG + Intronic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142276841 16:89123241-89123263 TTCAGGGCTCCCAGAGGGGTGGG + Intronic
1142810208 17:2392652-2392674 CTCGGGGCGCCGAGCGGGAGAGG - Intronic
1143024829 17:3935378-3935400 CACAGGGCTGAGAGAGGAAAAGG - Intronic
1143302075 17:5917901-5917923 CTGAAGGCTTCGAGTGGGAAGGG - Intronic
1144058615 17:11561913-11561935 CTCTGAGCTCTGGGAGGGAAGGG + Exonic
1144239730 17:13298517-13298539 CTCATGGCCCGGAGGGGGAAGGG + Intergenic
1144437969 17:15258366-15258388 CCCAAGGCACCCAGAGGGAAAGG - Intronic
1145397333 17:22506293-22506315 CTCAGGGCTCCGCGTGGAGAGGG - Intergenic
1146723118 17:35137184-35137206 CTCAGGGTTCCTGGAGAGAAGGG + Exonic
1146729349 17:35180837-35180859 CTCAGGGCCCCTACAGGGAGGGG - Intronic
1147424948 17:40342010-40342032 CGCAGGGAACCGAGAGGGAGAGG - Intronic
1148735402 17:49862317-49862339 CTGGGGGCTCCCAGAGGGCAGGG - Intergenic
1148770235 17:50062265-50062287 CTCAGGGCTCAGAGAAGGAAAGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1152660370 17:81539292-81539314 ATCAGGGCTCGGAGAGTGAGGGG - Intergenic
1152756563 17:82089467-82089489 CCAAGGGAACCGAGAGGGAATGG + Intronic
1152887115 17:82859023-82859045 CTCGGGGCCCCGAGAGGCCATGG + Intronic
1154454761 18:14510616-14510638 TACAGAGCTCCCAGAGGGAAGGG - Intronic
1154471085 18:14702425-14702447 ATCAGGGCTCTCAGAGGGACTGG - Intergenic
1155071997 18:22324932-22324954 CAGAGGTCTCCAAGAGGGAAAGG - Intergenic
1157960689 18:52150365-52150387 TCCAGGGCTCCCAGATGGAAGGG + Intergenic
1161218709 19:3107861-3107883 TTCAGGGCGCGGTGAGGGAAGGG + Intronic
1161945618 19:7434670-7434692 CTCTTGGCTCCGAGAGAGACAGG - Intronic
1162057128 19:8071489-8071511 CCCAAGGCTCAGACAGGGAAGGG + Intronic
1162349853 19:10142214-10142236 CTCAGGCCTGCGAGCGGGAGAGG + Exonic
1162380550 19:10329302-10329324 CGCAGGGCTGGGAGAGGGAGTGG - Intronic
1162953140 19:14083682-14083704 CTCAGAGCTGCGAGAAGAAAGGG + Intronic
1163558967 19:18007981-18008003 CCCCGGGGTCCGCGAGGGAAGGG + Intronic
1165125818 19:33596394-33596416 CTCAGGGCTCCAAGAGCGCCAGG + Intergenic
1165275231 19:34745196-34745218 CTCAGGGCTCTTAAAGGGTATGG - Exonic
1166213999 19:41323992-41324014 CTCATGCCTCTGAGATGGAATGG + Exonic
925066172 2:930377-930399 CGCAGGACCCCGAGAGTGAACGG + Intergenic
926049860 2:9737722-9737744 GTCAGGGGTACTAGAGGGAATGG - Intergenic
926638959 2:15214736-15214758 CTCTGAGCTCTGAGAGGGAAGGG + Intronic
926727146 2:16007533-16007555 TTCTGGGCTCCTTGAGGGAAGGG - Intergenic
927810156 2:26176008-26176030 CTAAGGGCTCCTGGAGGGCAGGG + Intronic
929075541 2:38076484-38076506 CTCAAGTCGCGGAGAGGGAAGGG - Intronic
929564098 2:42974111-42974133 GACAGGGCTCAGAGAGGGAGAGG + Intergenic
929829995 2:45339437-45339459 CTCCGTGCTCACAGAGGGAAAGG - Intergenic
930205883 2:48586467-48586489 CTTAGGGATCCCAGAGGAAAGGG + Intronic
930917095 2:56705946-56705968 GTCAGGGCTCCAACACGGAAAGG + Intergenic
931846372 2:66207917-66207939 TTAAGGGCAGCGAGAGGGAAAGG + Intergenic
932775345 2:74525111-74525133 CTCCGGGCTGCAAGAGGGTAGGG + Exonic
934774407 2:96927987-96928009 CTGCGAGCTCCGGGAGGGAAAGG + Intronic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
941326824 2:164126081-164126103 CTCAGGGCTCTGAGAGAGTCTGG + Intergenic
941348887 2:164406685-164406707 CACAGGGCTCCAAGATGGAATGG + Intergenic
941883176 2:170502251-170502273 CATATGACTCCGAGAGGGAAAGG - Intronic
945090916 2:206174837-206174859 CTCAGGGCTCCAAGAGGCCAAGG - Intergenic
946397786 2:219451883-219451905 CTCAAGGCTGAGAGTGGGAAGGG - Intronic
947437800 2:230087887-230087909 CTCAGGGCTCCAAGTGCGAGTGG + Intergenic
948491385 2:238315332-238315354 CTCAGAGCTCAGAGACGGATGGG + Intergenic
948698778 2:239747754-239747776 CTCAGGGCTCTCAGAGACAAGGG + Intergenic
1168834467 20:868912-868934 ATTAGGGCTCAGAGAGGGAAAGG - Intergenic
1169056366 20:2624723-2624745 GTGAGGGGTCCAAGAGGGAAGGG + Intronic
1169393075 20:5205915-5205937 CTAGGGGCACAGAGAGGGAAGGG + Intergenic
1169914637 20:10673387-10673409 CCCAGGGCGCCGCGAGGGGAGGG + Intronic
1172444645 20:34986687-34986709 CTGAGGGCACTGAGAGTGAAGGG - Intronic
1172988244 20:39010667-39010689 CCCAGGGCTCTGAGAGACAAAGG + Intronic
1173590032 20:44217475-44217497 CTCAGAGCTCCAGGAGGGGAGGG + Intergenic
1173817401 20:45998539-45998561 CTCAGGGCTCCCAGAGACCAAGG - Intergenic
1174178771 20:48661917-48661939 ATCAAGGCTCGGAGAGGTAAAGG + Intronic
1175828703 20:61950816-61950838 CCCAGGGCTGGGGGAGGGAAGGG - Intergenic
1175887792 20:62302390-62302412 CGCAGGGGTCCGGGAGGGCAGGG - Intronic
1175933661 20:62505268-62505290 CTCAGTGCCCCCAGAGGGGAGGG + Intergenic
1175999624 20:62826058-62826080 CTCAGGTCCCCCAGAGGGAGGGG - Intronic
1176061752 20:63175625-63175647 CTCAGGACTCCAAGAGGGGCCGG + Intergenic
1176254415 20:64143490-64143512 CTCAGTGCTCTGCGAGGTAATGG - Intergenic
1176386554 21:6140998-6141020 TTCAGGGCCCACAGAGGGAAGGG - Intergenic
1176803402 21:13455508-13455530 ATCAGGGCTCTCAGAGGGACTGG + Intergenic
1176819403 21:13642692-13642714 TACAGAGCTCCCAGAGGGAAGGG + Intergenic
1179111747 21:38452790-38452812 CTCAGGGCTCTGAGAAGGCCTGG + Intronic
1179522196 21:41953119-41953141 CCCTGGGCTCCGCGAGGGACAGG - Intronic
1179524377 21:41966103-41966125 CTCAGGGCTCTGAGAGGACATGG + Intergenic
1179736919 21:43397254-43397276 TTCAGGGCCCACAGAGGGAAGGG + Intergenic
1179765883 21:43572623-43572645 CTCAGGTGTCCGAGAGGACAAGG + Intronic
1180044546 21:45298786-45298808 CTGAGGGTTCCTACAGGGAACGG - Intergenic
1181816107 22:25437927-25437949 CTGAGGGATCCGGGAGGGGAGGG - Intergenic
1181876452 22:25944386-25944408 TTCGGGGCTCAGAGAGGGATGGG - Intronic
1182020147 22:27074901-27074923 CTAAGGGCTAGGAGAGGAAAGGG + Intergenic
1182044263 22:27262138-27262160 CTGAGGCCCTCGAGAGGGAAAGG - Intergenic
1182520641 22:30882672-30882694 CTCAGGGCCCTGGGAAGGAACGG + Intronic
1183728976 22:39606372-39606394 CTCAGGACTCCAAGAGGCCACGG - Intronic
1183827196 22:40397769-40397791 CTCATGGCTACCTGAGGGAAAGG - Intronic
1183985451 22:41567612-41567634 GGCAGGGCCCAGAGAGGGAAAGG + Intronic
1184405555 22:44298662-44298684 CACAGGACTCAGGGAGGGAAGGG + Intronic
1184722965 22:46326208-46326230 CTTCGGGCTCCCAGTGGGAATGG - Intronic
1185401408 22:50619963-50619985 CTCAGGGCTGCAAAAGGGAGGGG + Intergenic
949119744 3:372014-372036 CTCAGGGCAGCCAGAGAGAAAGG - Intronic
949695836 3:6694499-6694521 CTCAAGGCTCCAGTAGGGAAGGG - Intergenic
949917487 3:8975916-8975938 CTCAGGCCTAAGAGAGAGAATGG + Intergenic
950259733 3:11535306-11535328 CTGAAGGCTCTCAGAGGGAAAGG + Intronic
950424566 3:12918124-12918146 ATCAGGGCTCAGAGAAGGAAGGG - Intronic
950454144 3:13082749-13082771 CACAGGTCTCCGAGAGCCAAGGG - Intergenic
950918138 3:16666044-16666066 CTAGGGTCTCCCAGAGGGAAAGG - Intronic
954146915 3:48639024-48639046 CACAGGAGTCCGAGAGGGACTGG - Intronic
954440169 3:50517417-50517439 CTCCTGCCTCAGAGAGGGAAGGG - Intergenic
954574030 3:51665019-51665041 CTTAGGGCTCCTACAGAGAAAGG - Exonic
956678869 3:71759486-71759508 CTCTGGGCTCCCAGAGTGCATGG + Intergenic
956915418 3:73865976-73865998 CAGAGGGCTCTGAGAAGGAAGGG + Intergenic
959145208 3:102535687-102535709 CTCAGAGCTCAGAGAGAGTAGGG - Intergenic
960041680 3:113156227-113156249 CCCAGGGCTGGGAGTGGGAATGG + Intergenic
961075434 3:123977626-123977648 CTTGGGGCTTCAAGAGGGAAGGG + Intronic
961308254 3:125974890-125974912 CTTGGGGCTTCAAGAGGGAAGGG - Intronic
963561815 3:146875735-146875757 CTCAGGCCTCCTGGAGGAAATGG + Intergenic
963953986 3:151233060-151233082 CTCTGAGCTCCAAGAGGGCAGGG - Intronic
966265482 3:178036813-178036835 CTCAAGGCATCGATAGGGAAAGG + Intergenic
967680961 3:192363381-192363403 CCCAGGGCTCCAACAGGGGATGG - Intronic
968066285 3:195761512-195761534 CTCAGGGCTCCCTGGGGGAATGG + Exonic
968584980 4:1412118-1412140 CTAAGGGCACCGAGAGGACATGG - Intergenic
968727673 4:2255830-2255852 CCCAGGGCACCGAGAGGGCATGG + Intronic
969394329 4:6910439-6910461 GTCAGGGCTCCGAGATGAAAGGG - Intronic
970584178 4:17499667-17499689 CTCAGTGCTCCGGGAGGCCAAGG + Intronic
978149455 4:105415560-105415582 CTCAGGCCCCCGAGAGTGCAGGG + Intronic
982094867 4:151912460-151912482 GTCAGGGCTCCCAGTGAGAAGGG - Intergenic
982584617 4:157221611-157221633 GTCAGTGCCCCGGGAGGGAAAGG - Intronic
982927965 4:161363850-161363872 CACAGGGCTCCCCGAGGAAAGGG - Intergenic
985261344 4:188117928-188117950 CTGAGGACTCCGTGAGGGAAGGG + Intergenic
985295292 4:188431407-188431429 CCCAGGGCTGAGAGAGGGAATGG + Intergenic
985406986 4:189647634-189647656 CTCAGGGCCCCTTAAGGGAAGGG - Intergenic
985515845 5:344171-344193 CTCAGGGCCCCGAGGGCGCAGGG - Intronic
986253433 5:6081958-6081980 CACAGGGCTCAGGCAGGGAATGG + Intergenic
986284069 5:6347175-6347197 CTCAGGGCCCCCCAAGGGAAGGG + Intergenic
989860791 5:46372965-46372987 CTCAGGGCAGCCAGAGAGAAAGG + Intergenic
991607683 5:68419965-68419987 CTCAGAGCCCTTAGAGGGAAAGG + Intergenic
992484013 5:77178767-77178789 CTCAAGGCTCAGTTAGGGAAGGG + Intergenic
993021592 5:82597922-82597944 CCCAGGGCTCAGAGAAGGACTGG - Intergenic
993541799 5:89160915-89160937 CTCAGGGCAGCCAGAGAGAAAGG + Intergenic
993873348 5:93277469-93277491 CTCAGGGACCCCAGAAGGAAAGG - Intergenic
994242850 5:97444688-97444710 GACAGAGCTCTGAGAGGGAAGGG - Intergenic
996023599 5:118618921-118618943 CTCAGTGCTGCTATAGGGAAGGG - Intergenic
997641447 5:135451372-135451394 CTCAGGCCTCTGATAGTGAAAGG - Intronic
999055419 5:148570313-148570335 CTCTGAGCTCCCTGAGGGAAGGG - Intronic
999120250 5:149204201-149204223 CTGAGGGATCTGAGAGGGACAGG + Intronic
999285698 5:150392974-150392996 CTCAGGGCTCTATGAGGGGACGG - Intronic
1001594978 5:172892489-172892511 CCCAAGGCTCCGAGAGGTCAAGG - Intronic
1002028613 5:176412417-176412439 CTCAGGGCTCCAGCACGGAATGG + Intronic
1002787060 6:410082-410104 CTCAGGACTCTGAAAAGGAACGG + Exonic
1004525579 6:16404416-16404438 CTGGGGGCTCTGGGAGGGAAAGG - Intronic
1005278516 6:24245235-24245257 CTCAGTGCTTCAAGAGGAAATGG + Intronic
1006146523 6:31962964-31962986 CGCTGGGCACAGAGAGGGAAGGG - Exonic
1006618442 6:35345526-35345548 CTCAGTGCTCTGAGAGGCCAAGG - Intronic
1009325738 6:62345931-62345953 GACAGAGCTCCCAGAGGGAAAGG + Intergenic
1011861278 6:91760214-91760236 CTGAGGGCTACCTGAGGGAACGG - Intergenic
1012939947 6:105404828-105404850 CTCTGGGCCCTGAGAGGTAAAGG + Intergenic
1013031656 6:106339555-106339577 CTCAGAGCTCCGGGAGGCATAGG - Intergenic
1013648615 6:112170717-112170739 CTCAGGGCTCCAAAAAGTAAGGG - Intronic
1013722772 6:113050719-113050741 CTCAGGGCTTCCAAAGGGAAAGG + Intergenic
1014126516 6:117782568-117782590 CTCAGTGTTCTGAGAGGCAAAGG - Intergenic
1016110671 6:140219376-140219398 CTTAAGTCTCCGAGAGGGTATGG + Intergenic
1017094099 6:150789049-150789071 CTCAGGAATCAGAGAGGGAGAGG + Intronic
1020006334 7:4785402-4785424 CTCAGGGCTCCTGGAAGGAGGGG - Exonic
1020107887 7:5430609-5430631 CTGGGGGCTCCCAGAGGCAAAGG - Intergenic
1021355588 7:19650624-19650646 GACAGAGCTCCCAGAGGGAAAGG + Intergenic
1021914762 7:25420224-25420246 CTCTGAGCTCCTAGAGGCAAGGG + Intergenic
1022682595 7:32564008-32564030 GTCAGGGCTCCGAAAGGTATAGG - Intronic
1023886196 7:44358746-44358768 CTAAGGGCAGCTAGAGGGAAGGG - Intergenic
1024530719 7:50390246-50390268 CCCAGGGCTCCCAGAGGTCAGGG - Intronic
1026857185 7:73762565-73762587 GGAAGGGCTCCAAGAGGGAAGGG - Intergenic
1026858728 7:73770987-73771009 GACAGGGCTCGGAGAGGGGAGGG - Intergenic
1027221392 7:76216485-76216507 ATCAAGGCTCAGAGAAGGAAGGG - Intronic
1028953656 7:96665084-96665106 CTCAGGGCTCCCATAGGCACTGG + Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1034087912 7:148337213-148337235 CTCAGGGAGCAGAGAGGGAGGGG - Intronic
1034831599 7:154313064-154313086 ATCAGGCCTCTGAGTGGGAAAGG + Intronic
1035604966 8:924364-924386 CCCAGGGCTCCGAGAGGATCTGG - Intergenic
1036489178 8:9209053-9209075 CCCAGGGCTCTGAGAGGCCAAGG - Intergenic
1036805379 8:11828423-11828445 CACAGGGCTCAGAGAAGGGAAGG + Intronic
1037407739 8:18562041-18562063 CAGATGGCTCCAAGAGGGAAAGG + Intronic
1039583186 8:38683466-38683488 CTGAGGGGTCCCAGAGGGACAGG - Intergenic
1039904868 8:41779180-41779202 CTCAGGGATAGGAGAGGGATGGG - Intronic
1040091839 8:43407042-43407064 CTCAGGGCAGCCAGAGAGAAAGG - Intergenic
1040608394 8:48958302-48958324 TTCAGGGCACCCAGAGAGAAAGG - Intergenic
1041481058 8:58320202-58320224 TTCAGAGCTCCCAGAGGGAGAGG - Intergenic
1042696127 8:71556804-71556826 CACAGCGCTCCGAGAAGGAGCGG + Intronic
1044534759 8:93345857-93345879 CTTAGGGCTCCAAGATGGAAAGG + Intergenic
1044534809 8:93346181-93346203 CTGAGGGCTCCAAGATGGAAAGG + Intergenic
1044933733 8:97274787-97274809 CTCAGGGATAAGAGAGGGAAAGG + Exonic
1045547287 8:103140577-103140599 CTCAGGGCTCCGTGACGGCCCGG - Intronic
1045639020 8:104226542-104226564 CTGAAAGCTCTGAGAGGGAAAGG - Intronic
1049049732 8:140185241-140185263 CTCAGAGCCCCGGGAGGGCAGGG - Intronic
1049059235 8:140263306-140263328 CTCAGAGCTCCGGGAGGACAGGG + Intronic
1049069442 8:140345430-140345452 CTCAGGGCCCAGAGATGGGACGG - Intronic
1049174750 8:141184962-141184984 CTCTGAGCTCCCAGAGGGCAGGG + Intronic
1049205168 8:141360319-141360341 GTCAGGGCTCAGAGTGGGACAGG - Intronic
1049315981 8:141967872-141967894 CTCGGGGCAGGGAGAGGGAAAGG + Intergenic
1049372339 8:142273805-142273827 CTCAGGGGTGCAAGAGGAAAAGG - Intronic
1051796158 9:20872820-20872842 CTTAGGTCTTGGAGAGGGAATGG - Intronic
1053307853 9:36996543-36996565 CTCAGAGCTCCCAGAAGGGATGG - Intronic
1054760292 9:68998778-68998800 TTCTGGGCTCTGAGGGGGAATGG + Intronic
1057264150 9:93603066-93603088 CCCAGGGCCCTGAGAGGAAAGGG - Intronic
1057436090 9:95041936-95041958 CTTAGGGATCTGGGAGGGAACGG + Intronic
1058779223 9:108316769-108316791 CTCTGTGCTCCTTGAGGGAAAGG - Intergenic
1058898918 9:109424546-109424568 CTCAGGGTTCCAGGAGCGAAAGG - Intronic
1059657502 9:116369659-116369681 CCCAGGGCCCACAGAGGGAAGGG - Intronic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060152364 9:121296822-121296844 GTGAGGGCTCCCAGAGGGCAAGG + Intronic
1061088156 9:128411390-128411412 ATCAGGGCTGAGAGAGGGAAGGG + Intergenic
1061262675 9:129488660-129488682 CTCAGGGCCCCGAGACGGGCCGG - Intergenic
1061649196 9:132032793-132032815 CGCAGGGCTGTGAGAGGGAGGGG - Intronic
1062006787 9:134242468-134242490 ATCAGGGCTCAGAGAGAGAAAGG + Intergenic
1062610638 9:137371840-137371862 CTCAGGGCACCGAGAAGTCATGG + Intronic
1062637985 9:137501478-137501500 CTCAGGGCTGCCTGAGGGGAGGG + Intronic
1203527955 Un_GL000213v1:106878-106900 TACAGAGCTCCCAGAGGGAAGGG - Intergenic
1186013864 X:5168431-5168453 CCCAGCGCTTTGAGAGGGAAAGG - Intergenic
1188694359 X:33171607-33171629 CTGAGGGATCTGTGAGGGAAAGG - Intronic
1190131120 X:47749768-47749790 GTCAGGGCTCTGACTGGGAAAGG - Intergenic
1191743820 X:64464528-64464550 ATCAGAGCTCCCAGAGGGAGGGG - Intergenic
1192559945 X:72121275-72121297 CTTAGGGCTTGCAGAGGGAAGGG - Intergenic
1193715123 X:84928012-84928034 GTCAGTGCTCCTAGAGGGAGGGG - Intergenic
1194448722 X:94016414-94016436 CAGAGGGCTCCCAGCGGGAATGG + Intergenic
1198705461 X:139443618-139443640 GACAGAGCTCCCAGAGGGAAGGG + Intergenic
1199830883 X:151547845-151547867 TTAAGGGCTGCGAGAGAGAAAGG + Intergenic
1199886949 X:152029775-152029797 CTGATGGCTGGGAGAGGGAAAGG - Intergenic
1199937707 X:152591807-152591829 CTCATGACTCAGAGAAGGAAAGG + Intergenic
1200116557 X:153772134-153772156 CTCAGGGCTCAGGGACGGAGGGG - Intronic
1200794213 Y:7325865-7325887 CTCAGGGCCCCGCCAGGGCAGGG - Intergenic
1201645136 Y:16222260-16222282 CTCAGGGCAGCCAGAGAGAAAGG - Intergenic
1201657677 Y:16363062-16363084 CTCAGGGCAGCCAGAGAGAAAGG + Intergenic