ID: 918240318

View in Genome Browser
Species Human (GRCh38)
Location 1:182615057-182615079
Sequence GCTGATGGTGCCACAGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918240318_918240321 2 Left 918240318 1:182615057-182615079 CCGGGCTCTGTGGCACCATCAGC No data
Right 918240321 1:182615082-182615104 CTTGCGCAGGACACAGACGTCGG No data
918240318_918240323 29 Left 918240318 1:182615057-182615079 CCGGGCTCTGTGGCACCATCAGC No data
Right 918240323 1:182615109-182615131 CGCGCCGCAGCCCTCGGCCCCGG No data
918240318_918240322 23 Left 918240318 1:182615057-182615079 CCGGGCTCTGTGGCACCATCAGC No data
Right 918240322 1:182615103-182615125 GGCTCACGCGCCGCAGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918240318 Original CRISPR GCTGATGGTGCCACAGAGCC CGG (reversed) Intergenic
No off target data available for this crispr