ID: 918240551

View in Genome Browser
Species Human (GRCh38)
Location 1:182616463-182616485
Sequence CTGAGCACAGCGGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 429}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918240542_918240551 1 Left 918240542 1:182616439-182616461 CCCAGTGCTGCTGAGCATACAGA 0: 1
1: 0
2: 5
3: 51
4: 365
Right 918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG 0: 1
1: 0
2: 2
3: 45
4: 429
918240543_918240551 0 Left 918240543 1:182616440-182616462 CCAGTGCTGCTGAGCATACAGAC 0: 1
1: 0
2: 1
3: 17
4: 237
Right 918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG 0: 1
1: 0
2: 2
3: 45
4: 429
918240540_918240551 15 Left 918240540 1:182616425-182616447 CCTCTGGCACCATTCCCAGTGCT 0: 1
1: 0
2: 1
3: 18
4: 264
Right 918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG 0: 1
1: 0
2: 2
3: 45
4: 429
918240541_918240551 6 Left 918240541 1:182616434-182616456 CCATTCCCAGTGCTGCTGAGCAT 0: 1
1: 0
2: 4
3: 34
4: 303
Right 918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG 0: 1
1: 0
2: 2
3: 45
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918240551 Original CRISPR CTGAGCACAGCGGAGGGGGA GGG Intergenic
900162528 1:1231205-1231227 CGCAGCACAGCGGAGCGGGCCGG + Intronic
900501248 1:3005752-3005774 AAGAGCCCAGCGCAGGGGGAAGG - Intergenic
901129729 1:6954790-6954812 CTGAGCACAGCTGAGCTGGCGGG + Intronic
901510825 1:9717322-9717344 CTGAGCTCTGCAGAGGGGAAGGG - Intronic
903009414 1:20319491-20319513 CAGAGCAGAGCGGAAGGTGAGGG + Exonic
903392117 1:22971942-22971964 ATGAGCTCAGCCTAGGGGGAGGG + Intergenic
903524091 1:23979943-23979965 CTGCAAACTGCGGAGGGGGAGGG + Intronic
903892189 1:26577286-26577308 CTGAGCAAAGATGAGGGGGTGGG + Intergenic
904265174 1:29314456-29314478 TTGTGCAGAGCTGAGGGGGAAGG - Intronic
904289865 1:29478241-29478263 ATGGACACAGCGGAGGGGGAGGG - Intergenic
904327502 1:29736870-29736892 GTGAGGGCAGTGGAGGGGGAGGG - Intergenic
904842666 1:33383287-33383309 CAGAGGACAGGGGAGAGGGAGGG - Intronic
904860553 1:33534467-33534489 CTGAGCAGAGCAGGGAGGGAGGG - Intronic
905241926 1:36587117-36587139 CTGTGCATATCGGAGGGGGCGGG + Intergenic
905553040 1:38859364-38859386 CTGAGAACCGGGGAGGGGGCGGG + Intronic
905863860 1:41366447-41366469 CTGGGCACGGCGGCGGGGGAGGG - Intronic
906296360 1:44651339-44651361 CCGAGCACATGGGAGAGGGAAGG - Exonic
906301102 1:44682359-44682381 CTGACCTCAGAGGAGGAGGAAGG + Intronic
906443386 1:45871583-45871605 CTGAGCTAAGCAGAGGGGGCTGG - Intronic
908119724 1:60974757-60974779 CAGAGCACAGCAGGGGGAGATGG + Intronic
913223629 1:116679535-116679557 CTGAGGACAGCTGTGGGGGAAGG + Intergenic
913565245 1:120067384-120067406 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
913632884 1:120726175-120726197 CTCAGCAGAGCAGAGGTGGAGGG - Intergenic
914285834 1:146226742-146226764 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
914546866 1:148677495-148677517 CTCAGCAGAGCAGAGGTGGAGGG + Intronic
914619698 1:149393177-149393199 CTCAGCAGAGCAGAGGTGGAGGG - Intergenic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
914920570 1:151844630-151844652 GTGAGAACAGTGGAAGGGGAGGG - Intergenic
915076193 1:153309684-153309706 CAGAGGACTGGGGAGGGGGAGGG + Intronic
916290803 1:163164292-163164314 CTGACCACAGAGGATGGGTATGG + Intronic
917516652 1:175714181-175714203 CTGAGGACAGCAGAGGGAGTGGG - Intronic
917959021 1:180127948-180127970 CTGGGCACAGCTGAGCTGGAAGG - Intergenic
918240551 1:182616463-182616485 CTGAGCACAGCGGAGGGGGAGGG + Intergenic
918454123 1:184689440-184689462 CTGGGGACAGCAGAGGAGGAAGG - Intergenic
920378727 1:205523396-205523418 AGGAGCACAGCGCTGGGGGAGGG + Intronic
920690189 1:208140413-208140435 CTGAGCCCAGCAAAGTGGGAAGG - Intronic
922455690 1:225771803-225771825 CTGAGAACAGTGGGGAGGGAAGG - Intergenic
922901322 1:229138910-229138932 CTGTGCCCAGAGGAGAGGGAAGG - Intergenic
923036848 1:230290469-230290491 CTGAGCACAGAGAACGGAGATGG - Intergenic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1063114654 10:3065675-3065697 CTGAGCCCAGCGGTGGGTGCAGG + Intergenic
1063117557 10:3082554-3082576 CTGAGCACAGCCGAAGAGGTGGG + Intronic
1063451533 10:6153550-6153572 CTCAGGAAAGAGGAGGGGGAGGG + Intronic
1063493927 10:6489643-6489665 GTGAGCACAGTGGAGGGGCAGGG + Intronic
1065489545 10:26268856-26268878 CTGTGCACAGCAGAGGGTCATGG + Intronic
1066249751 10:33621412-33621434 CTCAGCACAGCAGATGGGGGTGG + Intergenic
1067271570 10:44796107-44796129 ATGAGCACAGCGGAGGGGATGGG + Intergenic
1067343104 10:45419822-45419844 CTGAGCTCAGTGGACGGGCAGGG + Intronic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1071475129 10:86019283-86019305 CAGAGCACAGCTGGGGTGGAGGG - Intronic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1074240457 10:111633726-111633748 CTGATCACAGGGGAAGGGAAAGG - Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075136602 10:119791995-119792017 CAGAGCACTGGGGAGAGGGACGG + Exonic
1075730513 10:124632816-124632838 CTGAGCACAGCCCAGAGTGATGG - Intronic
1075841805 10:125511247-125511269 CTGAGCACCGCGACGGGGGCGGG - Intergenic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1076367853 10:129933876-129933898 CTGAGCAGAGAGGAGGGGAGAGG - Intronic
1076451647 10:130560766-130560788 CTGAGCACAGAGGAGGCTGATGG - Intergenic
1076919759 10:133445502-133445524 CTGAGCTCAGCGGTGGGTGTCGG + Intergenic
1078008031 11:7547255-7547277 GTGAGCTCAGGGTAGGGGGATGG + Intronic
1078100704 11:8328823-8328845 GTGAGCAGAGAGGATGGGGAGGG - Intergenic
1078927836 11:15890403-15890425 GTGTGCACAGAGGAGGGAGAAGG - Intergenic
1080642912 11:34168144-34168166 CTGGGCACAGGGCATGGGGAAGG + Intronic
1080683734 11:34498610-34498632 CTGAGCAGAGGAGAGGGTGATGG + Intronic
1080809560 11:35689796-35689818 CTGAGGACTGGGCAGGGGGAAGG - Intronic
1081782838 11:45725232-45725254 CTTAGGCCAGCGGAGGTGGAAGG + Intergenic
1081979806 11:47259272-47259294 CTGGGCTCAGGGGAGAGGGATGG - Intronic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1083470610 11:62881503-62881525 CTGGGGACAGGGGAGGGGGTCGG - Intronic
1083578795 11:63812048-63812070 CAGAGCAGAGCAGAGGGGCACGG + Intergenic
1084123475 11:67083226-67083248 CTGAGGACAGCGGGGAGGGGAGG - Intergenic
1084209582 11:67614848-67614870 CTGAGCAGAGATGAGGGGGCAGG - Intergenic
1084477778 11:69398713-69398735 CTGAGGACAGCCGAGGCTGAGGG + Intergenic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085265419 11:75235330-75235352 CTGGGCACAGCTGAGGAAGAGGG + Intergenic
1085386665 11:76161700-76161722 CAGAGCAGAGGGGAGGGGGTGGG - Intergenic
1085454348 11:76657231-76657253 CTGAGCACAGAGAAGGGGAGGGG + Intergenic
1085512447 11:77095284-77095306 CTGAGCTCAGAGAAGGGGGTGGG - Intronic
1085850781 11:80117152-80117174 TTGAGCACAAAGGAGGAGGAGGG - Intergenic
1087123386 11:94598547-94598569 GTGGGCAAAACGGAGGGGGAGGG - Intronic
1089216142 11:116835774-116835796 CTGAGCACCGGGAAGGGGGGCGG + Exonic
1089288081 11:117420360-117420382 CTGGGCCCAGTGGAGGTGGATGG - Intergenic
1089579293 11:119471408-119471430 GGGAGCACAGCGGACGGGGAGGG - Intergenic
1090837439 11:130463536-130463558 CTGAGAACAGGGGATGGGAAGGG - Intronic
1093140956 12:15509781-15509803 CTGTGCACAGAGGAGAGTGAGGG + Intronic
1094487023 12:30933498-30933520 CTCAGCACTGGGGATGGGGAAGG + Intronic
1095868456 12:46999159-46999181 CTGAGCAGAATGGAGTGGGATGG + Intergenic
1096465230 12:51844964-51844986 CTCAGCACATCAGAGAGGGATGG + Intergenic
1096557244 12:52410927-52410949 CTGATGACAGAGGAGTGGGAGGG - Intergenic
1096578097 12:52567159-52567181 CTGATGACAGCTGAGGAGGAGGG + Exonic
1096792950 12:54056374-54056396 CTCAGCACAGAGGAGGGAGAAGG - Intergenic
1096870550 12:54589637-54589659 CTGGGCACTGGGGAGGGGTAGGG + Intergenic
1099511061 12:83537909-83537931 CTGAGCACACTGAAGGGGAATGG + Intergenic
1100010637 12:89948732-89948754 CTGAGCAAAGCATAGGGAGACGG + Intergenic
1100384306 12:94091553-94091575 CTGAGTGGAGGGGAGGGGGATGG + Intergenic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1103209793 12:119157781-119157803 CTGGGCAGAGGGGAGGGGGCTGG - Exonic
1103309006 12:119989655-119989677 CTGAGCCCGGGGGCGGGGGAGGG + Intergenic
1104822707 12:131687470-131687492 CTGGGCACTGCATAGGGGGAGGG - Intergenic
1105210123 13:18252668-18252690 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106382648 13:29255214-29255236 CTGAGCAGAGCAGAGACGGAAGG + Intronic
1106412050 13:29517301-29517323 ATGAGAACAGCTAAGGGGGAAGG + Exonic
1112310368 13:98312821-98312843 GTGAGCCCAGCTGAGGGAGAAGG - Intronic
1112414410 13:99192282-99192304 CAGAGCGTGGCGGAGGGGGAGGG + Intergenic
1112433537 13:99373889-99373911 CTGGACACAGAGGAGGGGGCAGG + Intronic
1113485452 13:110649445-110649467 CACAGCACAGGGGAGGGAGATGG + Intronic
1115081172 14:29452125-29452147 CTGAGCACAGCCAACTGGGATGG + Intergenic
1118270839 14:64340706-64340728 CTGAGCACAGCAGGATGGGAGGG - Intergenic
1118733913 14:68688963-68688985 CTGAGCATGGCTGAGGAGGAGGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120818719 14:88891926-88891948 CTGAGCCCAGTGAAGGGGAAAGG - Intergenic
1121120537 14:91373132-91373154 CTGAGCCCAGGGGCTGGGGACGG - Intronic
1121285736 14:92734374-92734396 CTTAGGAAAGCGGAGGCGGATGG + Intronic
1121611342 14:95282939-95282961 CAGAGGACTGGGGAGGGGGAGGG + Intronic
1122256752 14:100483750-100483772 CTAAGCTCAGCCCAGGGGGAGGG + Intronic
1122390805 14:101381642-101381664 CTAAGCACAGGGGAGTGGAATGG - Intergenic
1122652197 14:103232082-103232104 CTGAGCCCAGTAGAGGGAGAGGG - Intergenic
1122977105 14:105175241-105175263 CTGAGCACAGCCGGGAGGCATGG - Intronic
1123006531 14:105326493-105326515 CTGAGCACCAAGGAGAGGGATGG + Intronic
1202904299 14_GL000194v1_random:59620-59642 CTGGGCACAGTGGGGAGGGAGGG + Intergenic
1124109501 15:26773076-26773098 CGGAGGAGGGCGGAGGGGGAGGG + Intronic
1124118153 15:26866990-26867012 CCGAGCTGGGCGGAGGGGGAGGG - Exonic
1124208657 15:27744225-27744247 GTGGGGCCAGCGGAGGGGGATGG + Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125891593 15:43270758-43270780 CTCAGCACAGGGGAGGGGACAGG + Intergenic
1127242556 15:57133456-57133478 CTGAGGACCTCGGAGGGGGCAGG - Intronic
1128514951 15:68336163-68336185 ATGAGCACAGCAGAGGGCAATGG + Intronic
1129035859 15:72648073-72648095 CAGAGGACAGCTGAGGGGCAGGG - Intergenic
1129214026 15:74089143-74089165 CAGAGGACAGCTGAGGGGCAGGG + Intergenic
1129399986 15:75276220-75276242 CAGAGGACAGCTGAGGGGCAGGG - Intronic
1129462386 15:75706082-75706104 CTGTGCACAGGGAAGGGGCAGGG + Intronic
1129472908 15:75765069-75765091 CAGAGGACAGCTGAGGGGCAGGG + Intergenic
1129650622 15:77485224-77485246 CTGAGCACAGAGGAGAGAGGAGG - Exonic
1129665851 15:77578954-77578976 CCGTGCCCAGCCGAGGGGGAAGG - Intergenic
1129720410 15:77875005-77875027 CTGAGGTCAGCGGAGGGGCTGGG - Intergenic
1129722469 15:77885349-77885371 CTGTGCACAGGGAAGGGGCAGGG - Intergenic
1130635969 15:85620283-85620305 CTGTGCACAGTGGAGGATGAGGG + Intronic
1131212545 15:90510372-90510394 CAGGGCACAGGGGAGGGTGAGGG - Intergenic
1132347311 15:101116132-101116154 CTGAGAACAGTGGTGGGGGAAGG - Intergenic
1132598084 16:762254-762276 CTGAGGGCAGGGGAGAGGGAAGG + Intronic
1133908339 16:10041782-10041804 CTGAGCTCAGCGGAGTAGGTTGG - Intronic
1134237738 16:12480766-12480788 CTGAGCTCTGAGGAGTGGGAGGG + Intronic
1134242052 16:12513388-12513410 CTGAGTAGAGGGGAGGGGAAGGG - Intronic
1135617073 16:23920710-23920732 CAGAGCCCAGGGGAAGGGGATGG + Intronic
1136222037 16:28835227-28835249 CTGAGCACACCAGAGGGGGCTGG - Intronic
1136401528 16:30021780-30021802 CTGAGCACTAAGGAGGGGGCGGG + Intronic
1137633731 16:49967411-49967433 CTGAACACAGCTGAGAGGGCAGG + Intergenic
1139838727 16:69861069-69861091 CTGTGCACAGTGGAGGTTGATGG + Intronic
1139939818 16:70597091-70597113 CAGAGCACAACGGAGGAGAAGGG - Intronic
1140134932 16:72197608-72197630 CTGACCCCAGTGGAGGAGGAGGG - Intergenic
1140743387 16:77961288-77961310 CTTAGCAAAGCGGAGTGGGCAGG - Intronic
1140817727 16:78636537-78636559 CTGAGAATGGCGGATGGGGAGGG - Intronic
1141602783 16:85136624-85136646 CTGCGCACAGAGCACGGGGAGGG - Intergenic
1141876026 16:86825176-86825198 CTGAGAAGAGCCGAGGAGGAAGG - Intergenic
1142172129 16:88628415-88628437 CTGAGGACAGAGGACAGGGACGG - Intronic
1142381111 16:89732753-89732775 GTGAACACAGCAGAGGGCGAGGG - Intronic
1142381121 16:89732798-89732820 GTGAACACAGCAGAGGGTGAGGG - Intronic
1142381142 16:89732897-89732919 GTGAACACAGCAGAGGGCGAGGG - Intronic
1142381156 16:89732960-89732982 GCGAACACAGCAGAGGGGGAGGG - Intronic
1142381178 16:89733050-89733072 GTGAACACAGCAGAGGGCGAGGG - Intronic
1142685985 17:1577230-1577252 CTGGGCACAGCTGAGTGGGGTGG - Intronic
1143098044 17:4488970-4488992 CCCAGCACAGCGTATGGGGAGGG + Intergenic
1146055062 17:29576824-29576846 CAGGGCACAGGGGAGTGGGAAGG + Intronic
1146062329 17:29613828-29613850 CTGAGCCCAGGGGAGCGGGTTGG - Exonic
1146132582 17:30291773-30291795 CAGAGGACCGCGGCGGGGGACGG + Intronic
1148123710 17:45226259-45226281 GTGTGCACATGGGAGGGGGAGGG + Intronic
1148229014 17:45919560-45919582 CTGCGCCCAGCAGTGGGGGAAGG - Intronic
1149525003 17:57348616-57348638 CTAATCATGGCGGAGGGGGAAGG - Intronic
1150647922 17:66991449-66991471 CTGAGCAAAGCAGTGGGGCAGGG + Intronic
1151236871 17:72726997-72727019 CTGTGCACAGCAGAGGAGGCTGG - Intronic
1151966188 17:77433029-77433051 GAGAGCACAGCGGGAGGGGAGGG - Intronic
1152361719 17:79835966-79835988 CTGAGCACAGAGGTGGGGCTTGG - Intronic
1152584062 17:81181367-81181389 CTGACCACAGCGGGGCTGGACGG - Intergenic
1152643143 17:81457517-81457539 TTGACCACAGAGGAGGGTGAGGG - Exonic
1152763880 17:82124990-82125012 CTGAGCACAGAGGAGAGCCATGG + Intronic
1155506216 18:26535868-26535890 CTATGCACAGCTGAAGGGGAAGG - Intronic
1157112347 18:44833015-44833037 CTGGGGACAGTGGAGGTGGATGG + Intronic
1157979595 18:52365580-52365602 CTGAGCAAAGCTGAGAGGGGAGG + Intronic
1158674481 18:59505984-59506006 CTGACCACAGCGGAGCTGGGTGG + Intronic
1158722495 18:59938027-59938049 CTGGGCACAGCGGAGCGTCAGGG + Intergenic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1158952038 18:62503851-62503873 GTGATCATAGCGGAAGGGGAAGG + Intergenic
1159393236 18:67822485-67822507 CTGAGCACAGTGGAGGGTGCTGG - Intergenic
1160327707 18:77966358-77966380 CTGCTCACAGCAGAGGGGGTGGG + Intergenic
1160690563 19:459203-459225 CTGAACCCAGCGTAGGGGGAAGG + Intronic
1160690573 19:459232-459254 CTGAACCCAGCGTAGGGGGAAGG + Intronic
1160690592 19:459290-459312 CTGAAGCCAGCGTAGGGGGAAGG + Intronic
1160690601 19:459319-459341 CTGAACCCAGCGTAGGGGGAAGG + Intronic
1160690611 19:459348-459370 CTGAAGCCAGCGTAGGGGGAAGG + Intronic
1160690620 19:459377-459399 CTGAAGCCAGCGTAGGGGGAAGG + Intronic
1160690629 19:459406-459428 CTGAACCCAGCGTAGGGGGAAGG + Intronic
1160690639 19:459435-459457 CTGAACCCAGCGTAGGGGGAAGG + Intronic
1160690649 19:459464-459486 CTCAACTCAGCGTAGGGGGAAGG + Intronic
1160690657 19:459493-459515 CTGAACCCAGCGTAGGGGGAAGG + Intronic
1160690671 19:459551-459573 CTGAACTCAGCGTAGGGGGAAGG + Intronic
1160690679 19:459580-459602 CTGAACTCAGCGTAGGGGGAAGG + Intronic
1161110897 19:2469457-2469479 CTGAGGACAGTGGCAGGGGAGGG - Intergenic
1161315309 19:3614755-3614777 CTGGCCACAGCGGAGGGGAGGGG + Intronic
1161681957 19:5684608-5684630 CTGAGAAGGGTGGAGGGGGAGGG + Intronic
1161962993 19:7533182-7533204 CTGAGCACAGCAGTGGGAGCAGG - Intronic
1162282356 19:9709441-9709463 CTGAGCACAGCAGGATGGGAGGG - Intergenic
1162283765 19:9722006-9722028 CTGAGCACAGCAGGGCAGGAGGG - Intergenic
1162967808 19:14164265-14164287 CTGTGCACAGGGGTGGGGGTGGG + Intronic
1162980451 19:14235801-14235823 CGGAGGACAGAGGAGGGGGGAGG - Intergenic
1163228430 19:15980705-15980727 CTGAGACCAGCAGAGGGGGTGGG + Intergenic
1163444962 19:17340821-17340843 CGGGGCACAGTGCAGGGGGAAGG - Intronic
1163623520 19:18374640-18374662 CTGAGCACGGGGGTGGGGGCGGG + Intergenic
1163812020 19:19439066-19439088 ATGAGCACAGTGGAGGGAGCAGG + Intronic
1164601401 19:29566095-29566117 ATGGGCACAGTGGAGGGGGCAGG + Intergenic
1164601411 19:29566122-29566144 ATGGGCACAGGGGAGGGGGCAGG + Intergenic
1164601439 19:29566201-29566223 ATGGGCACAGGGGAGGGGGCAGG + Intergenic
1164601449 19:29566228-29566250 ATGGGCACAGGGGAGGGGGCAGG + Intergenic
1164601459 19:29566255-29566277 ATGGGCACAGGGGAGGGGGCAGG + Intergenic
1164601493 19:29566362-29566384 ATGGGCACAGGGGAGGGGGCAGG + Intergenic
1164831504 19:31325074-31325096 CGGAGCACAGCGGAGGTGGCTGG - Intronic
1165127838 19:33613254-33613276 CTGAGGACAGGGACGGGGGACGG + Intergenic
1166840033 19:45691790-45691812 TTGAGCAGAGCGGGGGGGGCAGG - Intronic
1167012221 19:46816186-46816208 CTGAGCACACAGGAGGTGGTCGG + Intergenic
1167236905 19:48320838-48320860 CTGAGGACAGCGGCCAGGGAGGG + Intronic
1167240233 19:48339084-48339106 CTGTGCCCAGAGGAGGGGCAGGG + Intronic
1168304724 19:55429307-55429329 TTGAGCAGAGGGGAGGGGGCTGG + Exonic
1168650122 19:58087238-58087260 CTGAGCACTGGTGATGGGGAGGG + Intronic
925030497 2:647166-647188 CCCAGCACATGGGAGGGGGACGG + Intergenic
926235623 2:11041239-11041261 CAGAGCAGAGCAGAGTGGGAAGG - Intergenic
926302047 2:11611648-11611670 CTGGGCATGGCAGAGGGGGAGGG - Intronic
927517723 2:23681919-23681941 CTGCGCACAGCCCAGGCGGAGGG - Intronic
929079503 2:38108203-38108225 CTAATCACAGCAGAGGAGGAGGG + Intronic
929136409 2:38627951-38627973 TTGGGAACAGTGGAGGGGGAAGG - Intergenic
929456958 2:42072950-42072972 CTGGGCTCAGGGGTGGGGGAGGG - Intergenic
930076389 2:47409066-47409088 CTGAGGGGAGGGGAGGGGGAGGG + Intronic
931586421 2:63834763-63834785 CTGAGCACAGCCAAGGAGGTAGG - Intergenic
932491569 2:72126394-72126416 CAGAGCACAGCTGAGGTGGGAGG - Intergenic
934696946 2:96406722-96406744 CTGAGGATGGCTGAGGGGGAAGG + Intergenic
934780612 2:96967507-96967529 CCGAGCACAGGTGAGGGGCAGGG - Exonic
935082146 2:99808552-99808574 ATTAGCTCAGAGGAGGGGGAGGG - Intronic
936461009 2:112713811-112713833 CTGAGGATCGCGGAGGTGGAGGG - Intergenic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
937283694 2:120736845-120736867 GAGAGCCCAGCAGAGGGGGAGGG - Intronic
937474119 2:122199452-122199474 ATGAGGACAGAGGATGGGGATGG + Intergenic
938169768 2:129064697-129064719 CTGAGCACATCAGAGCGGGTGGG + Intergenic
938387698 2:130879079-130879101 CTGAGCACAGCACAGGTGGGAGG + Intronic
938623609 2:133084046-133084068 CTGAGCACAGAAAACGGGGAAGG + Intronic
940495855 2:154427439-154427461 CTTGGCAAAGCGGAGTGGGAAGG + Intronic
940966606 2:159844924-159844946 CTGAGCACAGGGGAGAGGGAGGG - Intronic
941918664 2:170828571-170828593 GTGAGGACAGCAGAGGAGGACGG - Intronic
941918700 2:170828711-170828733 GTGAGGACAGCAGAGGGAGAAGG - Intronic
942307939 2:174627134-174627156 CAGAGCACAGTGGTGGAGGATGG - Intronic
942571869 2:177323182-177323204 GTGAGAACAGTGGAGGAGGAGGG - Intronic
942794506 2:179801489-179801511 CTTAGCACAGAGGAGGGAGTTGG - Intronic
944570677 2:201041945-201041967 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
946246041 2:218387956-218387978 GTGAGCAGAGGGGAGGGGAAAGG + Intronic
946292355 2:218754848-218754870 CTCAGGACAGCGGTGGGAGAGGG - Exonic
947872479 2:233447126-233447148 GTGGGCACCGCGGCGGGGGAGGG - Intronic
948232196 2:236356720-236356742 CAGGGGACAGCGGAGCGGGAAGG - Intronic
948232250 2:236358600-236358622 CAGGGGACAGCGGAGCGGGAAGG + Intronic
948421026 2:237859901-237859923 CAGGGCACAGGGGAGGCGGAGGG + Intronic
948853472 2:240719512-240719534 CAGAGCACAGGGGAGTGGGTGGG - Intronic
948856839 2:240734230-240734252 ATGAGCACAGGGGTTGGGGAAGG - Intronic
948954294 2:241274509-241274531 CTCAGCACTGCAGAGGGAGATGG + Intronic
1169186254 20:3619778-3619800 CTGAGCTCAGAGGTTGGGGAAGG + Intronic
1171186783 20:23128623-23128645 CTCAGCACAGAGCAGGGGTAAGG - Intergenic
1171291271 20:23984358-23984380 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1171406397 20:24914923-24914945 CTGAGGACAGGGGAGGCGCAGGG - Intergenic
1172033292 20:31996021-31996043 CTGAGCAGAGCTGAGGGGCGGGG - Intronic
1172044500 20:32070903-32070925 GGGAGGACAGAGGAGGGGGAAGG + Intronic
1172700810 20:36852544-36852566 CTGGGCACAGCAGCAGGGGAGGG + Intronic
1172975188 20:38900781-38900803 CTGAGCACAGCGCACGAGGCAGG - Intronic
1173248506 20:41352260-41352282 CTGAGCCCAGAGGATGGGGAGGG + Intronic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1174138685 20:48398090-48398112 CTGAGCACAGCCCTGGGTGATGG + Intergenic
1174832628 20:53826800-53826822 CTGAGCAAAGCAGAAGGAGATGG + Intergenic
1175802631 20:61809851-61809873 CGGAGCACAGCGGGGGGTGGGGG + Intronic
1176037789 20:63048804-63048826 ATGAGGCCAGCGGAGGGGGCGGG + Intergenic
1176207247 20:63895566-63895588 CTGAGCACCGTGGTGGGGGCTGG + Intronic
1176623672 21:9074387-9074409 CTGGGCACAGCGGGGAGGGAGGG + Intergenic
1177862699 21:26473563-26473585 CTGAGCACAGTGAAGGGGGTGGG - Intronic
1178782987 21:35623866-35623888 ATGACCACAGTGGAGGGGGAAGG - Intronic
1179305859 21:40153532-40153554 GTGATCACAGGGGTGGGGGACGG + Intronic
1179625172 21:42645195-42645217 CTGCGCAAAGGGGATGGGGAGGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180766134 22:18346736-18346758 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1180780179 22:18515642-18515664 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1180812895 22:18772963-18772985 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1181051254 22:20239256-20239278 CTGAGCTCAGCAGAGGGGCCCGG - Intergenic
1181199073 22:21207279-21207301 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1181400689 22:22648577-22648599 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1181688845 22:24547006-24547028 CTGAACAGAGAAGAGGGGGATGG + Intronic
1181702669 22:24629675-24629697 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1182261327 22:29074048-29074070 CAGAGCAGAGCGGAGGCGGGAGG + Intronic
1182656623 22:31895423-31895445 GTGAGCACTGCGATGGGGGATGG - Intronic
1183252849 22:36742699-36742721 CTGAGCACATCTAAGCGGGAGGG + Intergenic
1183745044 22:39687214-39687236 CTGAGCACTTCTGAGGGGGTGGG + Exonic
1184192618 22:42904869-42904891 CTGGGCACAGTGCAGGGGGGCGG - Intronic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184730759 22:46369805-46369827 CTGAACACAGCGGGGAGGAAGGG + Intronic
1185142530 22:49110937-49110959 CTGGGCACTGCGGAGGGGAGAGG - Intergenic
1185229761 22:49673456-49673478 CAGAGGGCAGGGGAGGGGGAAGG + Intergenic
1203227752 22_KI270731v1_random:87627-87649 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
949185855 3:1190690-1190712 CAGAGAACAGCGGTGAGGGAGGG + Intronic
950004970 3:9685737-9685759 CTGAGCACATTGGAAGAGGAAGG - Intronic
950457270 3:13100174-13100196 CTGTGCACAGCTGAGGGGTTAGG - Intergenic
952212868 3:31247119-31247141 CTGAGGGTAGCGGAGGAGGAAGG - Intergenic
952331366 3:32367156-32367178 CTGAACACAGGGGAGAGGCAGGG - Intronic
953771279 3:45780142-45780164 CTGGGCCTGGCGGAGGGGGAAGG - Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
954370332 3:50166717-50166739 CTGGGCCCAGGGGAGGGGGAGGG + Intronic
954452747 3:50580456-50580478 CTGACCAGAGGGGAGGTGGATGG + Exonic
955738667 3:62066581-62066603 TTGGACACAGTGGAGGGGGAGGG - Intronic
956916327 3:73875566-73875588 CTGAGGATTGCAGAGGGGGAGGG + Intergenic
957687735 3:83524566-83524588 AAGAGCAAAGCAGAGGGGGATGG - Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
959005912 3:101019731-101019753 CTGAACACAGGGCAAGGGGAGGG - Intergenic
959063299 3:101634778-101634800 ATGAGCAGAGCCAAGGGGGAGGG - Intergenic
961659002 3:128458479-128458501 CAGAGCTCAGCAGAGGGGCAGGG - Intergenic
961780363 3:129317131-129317153 CTGTGCACGGGAGAGGGGGAGGG - Intergenic
961820529 3:129573501-129573523 GTGAGGACAGAGGATGGGGAGGG + Intronic
962203000 3:133415561-133415583 GTGAGTAGAGCGGAGGGGGCAGG - Intronic
962203008 3:133415585-133415607 GTGAGTAGAGCGGAGGGGGCAGG - Intronic
962203159 3:133416204-133416226 GTGAGTAGAGCGGAGGGGGCAGG - Intronic
962583503 3:136819109-136819131 CGGAGTACTGCGGAGGGAGAGGG - Exonic
962873565 3:139518830-139518852 CTGAGCACAGCTGGGTGTGAGGG + Intronic
964541331 3:157783018-157783040 CTGTGCAGAGTGGAGGGGGTGGG - Intergenic
965317730 3:167211922-167211944 CTGAGCCAACCGGAGGTGGAAGG + Intergenic
967331747 3:188296918-188296940 CTGAGAACAAGGGAGTGGGAGGG + Intronic
967686767 3:192426327-192426349 CTTAGCACAGCAGAGGGCTAGGG + Intronic
968426008 4:523762-523784 CTGAGCACTTCGGAGGTAGAGGG - Exonic
969507708 4:7598469-7598491 ATGATCACAGCGGAGGGAGAAGG - Intronic
970082357 4:12301875-12301897 GTGAGCCCAGCGGAGTGAGAAGG + Intergenic
971515695 4:27483012-27483034 CTAAGAACAGCTGAGGGGGAGGG + Intergenic
971979916 4:33738380-33738402 CTGAGTAGAGGGGAGGGGAAAGG + Intergenic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
975718692 4:77229572-77229594 CTGAGCCTAGCAGAGTGGGAGGG + Intronic
981994664 4:150963174-150963196 CCGTGCAAAGGGGAGGGGGAGGG - Intronic
982097741 4:151938108-151938130 CTGAGCAGAGCAGACTGGGAGGG + Intergenic
982125898 4:152183567-152183589 CTGAGCTGAGCAGAGGGGGTGGG + Intergenic
982336875 4:154249880-154249902 CTGTGAACTGCTGAGGGGGAGGG + Intronic
982370446 4:154627431-154627453 CGGAGCCCAGGGGAGGGAGACGG - Intronic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
984953151 4:185020990-185021012 CTGGGCACCGCGGAGGGGACGGG - Intergenic
985603432 5:846628-846650 CTGAGCACGGTGGAGGCGCAAGG - Intronic
985603482 5:846901-846923 CTGAGCACGGTGGAGGCGCAAGG - Intronic
992487385 5:77210246-77210268 CTCTGGACAGCGGAGGAGGAGGG + Intergenic
995319770 5:110820532-110820554 CTGAACAAAGCGGAAGGGAAGGG - Intergenic
997428291 5:133819384-133819406 CTGAGCAGAGTGGAGGAGCAGGG - Intergenic
997523335 5:134537192-134537214 GTGGGCACAGTGGAGGGGGCTGG - Intronic
998203210 5:140141764-140141786 ATTAGCCCAGGGGAGGGGGAGGG + Intergenic
1001038648 5:168316126-168316148 CTGAGAAACGCTGAGGGGGAAGG - Intronic
1001591649 5:172869490-172869512 CTGAGCCCAGCCGAGGGGTCTGG - Intronic
1001773818 5:174314200-174314222 CTGAGCACTGAGGAGGGGAAAGG - Intergenic
1001838484 5:174852920-174852942 CAAAGGACAGTGGAGGGGGATGG + Intergenic
1002187771 5:177462522-177462544 TTGCTCACAGCGGAGGGGGGAGG - Intronic
1002194528 5:177494882-177494904 CTGGGGTCAGGGGAGGGGGAGGG + Intronic
1002344519 5:178538131-178538153 CTGAGCACAGAGGAGCTGAAGGG + Intronic
1002662353 5:180800194-180800216 CTGAGCACAGAGGGCAGGGAGGG - Intronic
1003173715 6:3739446-3739468 CTGAGGTCAGTGGAGGGGGCAGG - Intronic
1003642478 6:7887494-7887516 CTGTGCAGCGCGGAGAGGGAGGG - Intronic
1004016470 6:11736548-11736570 CTGAGCACAACGGAGGGTGAAGG - Intronic
1006069682 6:31489195-31489217 CTGAGCACCAGGGAGGGGGGTGG + Intergenic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006311931 6:33267128-33267150 CTGAGCACGGTGGGGAGGGAAGG - Intronic
1006630617 6:35427487-35427509 CTGAGTAAAGGGGAAGGGGAGGG - Exonic
1006743750 6:36326869-36326891 CAGAGCCCAGAGCAGGGGGAGGG + Intronic
1006864726 6:37200255-37200277 CTCAGCACAGCAGTGGGGGCTGG + Intergenic
1007589901 6:43014608-43014630 CTGAGCATAATGGAAGGGGAGGG + Intronic
1008595294 6:53035884-53035906 CTGAACACAGAGGGGAGGGAAGG - Intronic
1008595473 6:53037456-53037478 CTGAACACAGAGGGGAGGGAAGG - Intronic
1012399866 6:98834404-98834426 CCGAGCCCGGGGGAGGGGGAGGG + Intergenic
1012858375 6:104529171-104529193 CTGAGCAGAGAGGATGGGGCGGG - Intergenic
1012980313 6:105822755-105822777 CAGAGCCCAGGGGAGGGAGAAGG + Intergenic
1013175527 6:107673469-107673491 CTGAGTTCGGCTGAGGGGGAAGG - Intergenic
1013851643 6:114523235-114523257 CTAAGCACAGCGGATGTGGGTGG + Intergenic
1017969575 6:159299842-159299864 CTGATCATAGAGGATGGGGAAGG - Intergenic
1018887836 6:167956455-167956477 GTGAGCACAGAGGATGGAGAAGG - Intronic
1019289803 7:244943-244965 CTGAGAACAGCGTGGGAGGACGG + Intronic
1019407417 7:890960-890982 CTGCACTCAGCGGACGGGGAGGG + Exonic
1019579752 7:1755516-1755538 CTGGGCACAGCTGAAGGTGACGG - Intergenic
1020021323 7:4871241-4871263 CTTAGCACAGTGGAGGTGAAAGG - Intronic
1021836349 7:24679760-24679782 CTGAGTGTAGCGGAGTGGGAAGG - Intronic
1022725863 7:32981023-32981045 CTAAGCACAGTATAGGGGGATGG - Intronic
1022822969 7:33979458-33979480 CTAAGCACAGAGGAGGAGGGAGG - Intronic
1022855379 7:34309178-34309200 ATGTGCACTGCGGAGGGGGGCGG + Intergenic
1023092145 7:36627334-36627356 CTGAGGACAGCGTAGTGGGAAGG + Intronic
1023879363 7:44309523-44309545 CTAAGCACAGGGCATGGGGAGGG + Intronic
1024250346 7:47501491-47501513 CTGAGCAGAGCGGAGCTGGCTGG + Intronic
1024596454 7:50941535-50941557 AAGAACACAGCGCAGGGGGATGG + Intergenic
1025047735 7:55706626-55706648 CTAAGCACAGTATAGGGGGATGG + Intergenic
1026534420 7:71228333-71228355 CTGAGCTGAGTGGAGGTGGACGG - Intronic
1026819369 7:73536662-73536684 CTGAGGGCAGGGGATGGGGACGG + Exonic
1027172894 7:75885401-75885423 CTGGGAACAGGGGAGAGGGAGGG - Intronic
1028467448 7:91168916-91168938 CCCAGCACAGTGGAGGGGGAGGG - Intronic
1029174726 7:98656517-98656539 ATGAGAACAGCGGATGGGCAAGG + Intergenic
1029386250 7:100245530-100245552 CTGAGCAAGGCAGAGGGGCAGGG - Intronic
1029598659 7:101551014-101551036 CAGAGCACAGTGGGCGGGGAGGG + Intronic
1029917824 7:104230661-104230683 CTGACCAAAGAGGAGGGGGCAGG + Intergenic
1030597379 7:111556146-111556168 GTGATCCCAGGGGAGGGGGAAGG + Intronic
1031692765 7:124810877-124810899 CTGAGCAGAGCAGAAGGGGTTGG - Intergenic
1031987134 7:128170489-128170511 CTGAGCACAGAGGAAGGTCATGG - Intergenic
1032263113 7:130352185-130352207 CTGATCACAGGGCAGAGGGAGGG - Intronic
1032388039 7:131538150-131538172 CAGAGCACAGGGGAGGGGCCAGG - Intronic
1033547159 7:142412116-142412138 GTGAGCACACCTGAGGGGCAGGG + Intergenic
1034448737 7:151126360-151126382 CAGAGCAGAGCGGAGCGGGGCGG + Intronic
1034629962 7:152523140-152523162 CTGAGGACAGAGGAGGGCCACGG + Intergenic
1035131311 7:156656758-156656780 CTGAGCAAAGCGGTGGGGTCAGG - Intronic
1035266774 7:157693564-157693586 CGGAGCACAGGGGCGGGCGACGG + Intronic
1035421312 7:158731086-158731108 TAGAGAACAGCGGTGGGGGATGG - Exonic
1035426636 7:158780840-158780862 CTGAGCACAGGGAATGGTGAAGG + Intronic
1035823690 8:2621610-2621632 CCCAGCACAGCAGAGGAGGAAGG + Intergenic
1035899676 8:3445968-3445990 CTGGGCACAACAGAGGGAGAAGG + Intronic
1037764466 8:21763763-21763785 TTGAGGACAGGGTAGGGGGACGG - Intronic
1037974882 8:23201994-23202016 TTGAGCTGAGCTGAGGGGGAGGG - Intronic
1038715938 8:29991257-29991279 TTGAGCAGAGAGGAGGGTGATGG - Intergenic
1039252571 8:35682843-35682865 CTGTGCTCAGAGGATGGGGAAGG + Intronic
1039888830 8:41671015-41671037 CTGCACTCAGCGGAGGGGCATGG + Intronic
1042930943 8:74013680-74013702 CTGAGAACATCAGAGGGTGAGGG + Intronic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1047274702 8:123396680-123396702 CTGAGCTCGGCGGAAGGAGACGG + Intronic
1048294202 8:133202666-133202688 CTGGGCAGTGCGGTGGGGGAAGG + Intronic
1048586173 8:135776157-135776179 CAGAGGCCAGAGGAGGGGGAGGG + Intergenic
1048908878 8:139115266-139115288 ATGAGAACAGGGGACGGGGAAGG + Intergenic
1049092913 8:140530295-140530317 CTGAGCACAAAGGTGGGGGGGGG + Intergenic
1049418070 8:142504523-142504545 CCCAGCACAGCGGTGGGGAAGGG + Intronic
1049532321 8:143160564-143160586 CTCAGCCAAGCAGAGGGGGAAGG - Exonic
1049707434 8:144049389-144049411 CCCAGCACAGCGGAGGGGAGCGG - Intergenic
1049757711 8:144318172-144318194 ACGAGCACAGCAGAGTGGGAGGG + Intronic
1050536455 9:6634837-6634859 CTGAGATCAGAGGAGAGGGAGGG - Intronic
1052844396 9:33322334-33322356 CTGAGCTGAGGGGAGGAGGAAGG - Intronic
1052862714 9:33446871-33446893 CTGCGAACAGCGAAGTGGGAAGG - Intronic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053561314 9:39198294-39198316 CTGAGAACAGAGGAGGTTGAGGG - Intronic
1053825410 9:42018532-42018554 CTGAGAACAGAGGAGGCTGAGGG - Intronic
1054135805 9:61420653-61420675 CTGAGAACAGAGGAGGTTGAGGG + Intergenic
1054605153 9:67168825-67168847 CTGAGAACAGAGGAGGCTGAGGG + Intergenic
1056943950 9:90977909-90977931 CAGAGCACAGCAGAGCAGGAGGG + Intergenic
1057162123 9:92896197-92896219 CTGAGCAGAGCAGAGAGGGCTGG + Intergenic
1057678511 9:97154336-97154358 CTGAGCAGAGCAGAGAGGGCTGG + Intergenic
1058461643 9:105189289-105189311 ATGAGCAGATCGGTGGGGGAGGG + Intergenic
1058522742 9:105828367-105828389 TTGAGGAAAGGGGAGGGGGAAGG - Intergenic
1061141341 9:128769064-128769086 CTGACAGCAGCGGAGGGTGATGG - Intronic
1061808349 9:133148784-133148806 CTGAGGACAGGAGAGGGGCAGGG - Intronic
1062144823 9:134983185-134983207 CTGAGCACAGGGGGCGGGGGTGG + Intergenic
1062290258 9:135791143-135791165 CTGAGCACAGCGAGTGGGAATGG + Intronic
1062727037 9:138080255-138080277 CTGGGGACAGAGGAGGGTGAGGG + Intronic
1203746856 Un_GL000218v1:44815-44837 CTGGGCACAGCGGGGAGGGAGGG + Intergenic
1203563252 Un_KI270744v1:74665-74687 CTGGGCACAGTGGGGAGGGAGGG - Intergenic
1189604882 X:42666352-42666374 CTGAGCACAGCCGAGGCTGCAGG + Intergenic
1190751777 X:53368276-53368298 TTGTGCACAAGGGAGGGGGAGGG - Intergenic
1193260336 X:79399002-79399024 CAGAGCACAGAGGAGGGAAAGGG - Intergenic
1195342559 X:103919334-103919356 CGGAGCAGAGCCGAGGCGGAAGG - Intronic
1196678851 X:118450319-118450341 ATGAGGAGAGGGGAGGGGGAAGG - Intergenic
1196766593 X:119251445-119251467 CTGAGCACAGGGGAATGGGGAGG - Intergenic
1197199473 X:123735217-123735239 CTGATGACAGAGGAGTGGGAGGG - Intergenic
1199614663 X:149647359-149647381 CTGTGCCCAGGGGAGGGGGGCGG - Intergenic
1199712269 X:150477734-150477756 GTGGGCAGAGAGGAGGGGGAAGG + Intronic
1199853185 X:151739674-151739696 GTGACCACACAGGAGGGGGATGG + Exonic
1199894570 X:152117944-152117966 CTGAGATCAGCAGAGGGGAATGG - Intergenic
1200117080 X:153774116-153774138 CTGAGCACCGTGGCGGGGCAGGG - Intronic
1200164923 X:154029512-154029534 CAGAGCACAGCGGGGTGAGAGGG - Intronic
1200209868 X:154342421-154342443 CGCAGCACAGTGGAGTGGGAAGG - Intergenic
1200220984 X:154389671-154389693 CGCAGCACAGTGGAGTGGGAAGG + Intergenic
1200222390 X:154397597-154397619 TTGAGCACAGTGGAGTGGGAAGG + Intronic
1201160180 Y:11159829-11159851 CTGGGCACAGTGGGGAGGGAGGG + Intergenic
1202099808 Y:21295357-21295379 CTGAGCACAGCAGGGCAGGAGGG - Intergenic