ID: 918242213

View in Genome Browser
Species Human (GRCh38)
Location 1:182630516-182630538
Sequence CCATGGATATGGGGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918242205_918242213 -8 Left 918242205 1:182630501-182630523 CCCAGCGTTCTGCTCCCATGGAT No data
Right 918242213 1:182630516-182630538 CCATGGATATGGGGCTCAGGAGG No data
918242203_918242213 20 Left 918242203 1:182630473-182630495 CCTGTGCGTGTGACTTGTCACAT No data
Right 918242213 1:182630516-182630538 CCATGGATATGGGGCTCAGGAGG No data
918242206_918242213 -9 Left 918242206 1:182630502-182630524 CCAGCGTTCTGCTCCCATGGATA No data
Right 918242213 1:182630516-182630538 CCATGGATATGGGGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918242213 Original CRISPR CCATGGATATGGGGCTCAGG AGG Intergenic
No off target data available for this crispr