ID: 918243071

View in Genome Browser
Species Human (GRCh38)
Location 1:182637054-182637076
Sequence CTTTCGGCAGATTCAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918243064_918243071 -6 Left 918243064 1:182637037-182637059 CCCACTGGTGTGTTCTCCTTTCG No data
Right 918243071 1:182637054-182637076 CTTTCGGCAGATTCAGGGGATGG No data
918243061_918243071 8 Left 918243061 1:182637023-182637045 CCTGCAGCCTGCGCCCCACTGGT No data
Right 918243071 1:182637054-182637076 CTTTCGGCAGATTCAGGGGATGG No data
918243065_918243071 -7 Left 918243065 1:182637038-182637060 CCACTGGTGTGTTCTCCTTTCGG No data
Right 918243071 1:182637054-182637076 CTTTCGGCAGATTCAGGGGATGG No data
918243063_918243071 -5 Left 918243063 1:182637036-182637058 CCCCACTGGTGTGTTCTCCTTTC No data
Right 918243071 1:182637054-182637076 CTTTCGGCAGATTCAGGGGATGG No data
918243062_918243071 1 Left 918243062 1:182637030-182637052 CCTGCGCCCCACTGGTGTGTTCT No data
Right 918243071 1:182637054-182637076 CTTTCGGCAGATTCAGGGGATGG No data
918243059_918243071 24 Left 918243059 1:182637007-182637029 CCTTGAGAAGGGCATGCCTGCAG No data
Right 918243071 1:182637054-182637076 CTTTCGGCAGATTCAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918243071 Original CRISPR CTTTCGGCAGATTCAGGGGA TGG Intergenic
No off target data available for this crispr