ID: 918251700

View in Genome Browser
Species Human (GRCh38)
Location 1:182708734-182708756
Sequence TGAGCTCTGATTCCCCCATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918251700_918251708 17 Left 918251700 1:182708734-182708756 CCGCATGGGGGAATCAGAGCTCA No data
Right 918251708 1:182708774-182708796 TTGGGAACTGTTGTGTCAGCAGG No data
918251700_918251702 -2 Left 918251700 1:182708734-182708756 CCGCATGGGGGAATCAGAGCTCA No data
Right 918251702 1:182708755-182708777 CAAGGCTCCTGCCCCATACTTGG No data
918251700_918251703 -1 Left 918251700 1:182708734-182708756 CCGCATGGGGGAATCAGAGCTCA No data
Right 918251703 1:182708756-182708778 AAGGCTCCTGCCCCATACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918251700 Original CRISPR TGAGCTCTGATTCCCCCATG CGG (reversed) Intergenic
No off target data available for this crispr