ID: 918256848

View in Genome Browser
Species Human (GRCh38)
Location 1:182756414-182756436
Sequence TGGAGCAAAAGCAGAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918256844_918256848 -9 Left 918256844 1:182756400-182756422 CCCATCTCGGCCCATGGAGCAAA No data
Right 918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG No data
918256838_918256848 26 Left 918256838 1:182756365-182756387 CCAGGATGGTCTCGATCTCCTGA 0: 52576
1: 63017
2: 95022
3: 179642
4: 170031
Right 918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG No data
918256845_918256848 -10 Left 918256845 1:182756401-182756423 CCATCTCGGCCCATGGAGCAAAA No data
Right 918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG No data
918256843_918256848 -6 Left 918256843 1:182756397-182756419 CCACCCATCTCGGCCCATGGAGC No data
Right 918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG No data
918256839_918256848 8 Left 918256839 1:182756383-182756405 CCTGACCTCGTGATCCACCCATC 0: 344
1: 7532
2: 29464
3: 59742
4: 56613
Right 918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG No data
918256841_918256848 3 Left 918256841 1:182756388-182756410 CCTCGTGATCCACCCATCTCGGC 0: 180
1: 4224
2: 21031
3: 51870
4: 60609
Right 918256848 1:182756414-182756436 TGGAGCAAAAGCAGAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918256848 Original CRISPR TGGAGCAAAAGCAGAACTGC TGG Intergenic
No off target data available for this crispr