ID: 918262699

View in Genome Browser
Species Human (GRCh38)
Location 1:182810089-182810111
Sequence CCCTGGAGGACTCTGTGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918262691_918262699 10 Left 918262691 1:182810056-182810078 CCTGTTTTACCTAAGACATAGCT 0: 1
1: 0
2: 0
3: 4
4: 146
Right 918262699 1:182810089-182810111 CCCTGGAGGACTCTGTGATTGGG 0: 1
1: 0
2: 2
3: 16
4: 195
918262692_918262699 1 Left 918262692 1:182810065-182810087 CCTAAGACATAGCTAGCCAAGAA 0: 1
1: 0
2: 0
3: 7
4: 129
Right 918262699 1:182810089-182810111 CCCTGGAGGACTCTGTGATTGGG 0: 1
1: 0
2: 2
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918262699 Original CRISPR CCCTGGAGGACTCTGTGATT GGG Intronic
901617982 1:10556890-10556912 ACCTGGAAGAATCTGTGACTTGG + Intronic
902308715 1:15563978-15564000 CCCTGGAAGACCCTTGGATTGGG + Exonic
902663946 1:17924460-17924482 CCCTCCAGGAGTCTGTGAGTGGG + Intergenic
902755506 1:18546816-18546838 CCCTGAAGGACACTGTGTGTGGG - Intergenic
903332229 1:22602000-22602022 CCCTGTTGGACTCTGTGACGTGG - Exonic
905197040 1:36287858-36287880 CCCTGGGGGACACGGTGAGTTGG + Intronic
905385003 1:37596400-37596422 CCCTACAGGATTCTGTGATCTGG + Intergenic
906108544 1:43308672-43308694 CCCTCGAGGACTCTGTACCTAGG + Intronic
906114244 1:43345535-43345557 GCCTACAGGACTCTGTGATTTGG - Intronic
906124009 1:43415392-43415414 CCCTGAAAGAATCTGTGTTTTGG - Intronic
906143086 1:43545220-43545242 CCCAGCAGGACTCTGGGATGGGG + Intronic
906714006 1:47953537-47953559 CCCCGGAGGCCTCTGTAAGTAGG - Intronic
910896132 1:92071311-92071333 CTCTGGAGAACTCTGTGGGTGGG - Intergenic
913071005 1:115298536-115298558 CCCAGGAGAGCTCTGTGAGTAGG - Intronic
913071054 1:115298827-115298849 CCCAGGAGAGCTCTGTGAGTAGG + Intronic
915552156 1:156641601-156641623 CCCTGGAGGCAGCTATGATTGGG - Intronic
915730470 1:158050259-158050281 CCCTGCAGAACTCTGGGATGGGG - Intronic
916896526 1:169169156-169169178 CCTTGGATGACTCTGTTACTTGG - Intronic
917798810 1:178552128-178552150 CCCCTGAGGACTCTGTGTGTTGG - Intergenic
918243612 1:182640855-182640877 CCTTGGAGGACTCTGTGGAGGGG - Intergenic
918262699 1:182810089-182810111 CCCTGGAGGACTCTGTGATTGGG + Intronic
918386872 1:184017572-184017594 CCCTGGACGTATCTGTGATCTGG - Intronic
919787569 1:201269581-201269603 CCCTGAATTTCTCTGTGATTAGG + Intergenic
920016246 1:202911958-202911980 CCCTGGAGCACTTGGTGTTTGGG - Intronic
920779197 1:208971391-208971413 CCCACGGAGACTCTGTGATTTGG - Intergenic
921955263 1:220976579-220976601 CTCTGGATGAGTCAGTGATTAGG + Intergenic
922194806 1:223350784-223350806 CCCTGGAGGAATCTGTAATGTGG + Intronic
922803298 1:228373683-228373705 CCAGGGAGGACTATGTGGTTGGG - Intronic
1064774419 10:18760031-18760053 CAGGGAAGGACTCTGTGATTAGG - Intergenic
1065079069 10:22110226-22110248 CACTGGAGGACTATGGGATGTGG - Intergenic
1069904652 10:71725197-71725219 AGCTGGAGGACTCTGTGAGGTGG - Intronic
1070619911 10:78001378-78001400 TCCTGGAGGACATTATGATTTGG + Intronic
1072825604 10:98603272-98603294 TCCCGGAGGACTCAGTCATTGGG + Intronic
1073791195 10:106942142-106942164 CCCCGGGGAACTCTGTGAATGGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077412314 11:2409395-2409417 CCCTCCCCGACTCTGTGATTTGG + Intronic
1077804047 11:5572024-5572046 CCCTGGAGCACTTGGTGTTTGGG + Intronic
1078421186 11:11214355-11214377 CCCTGGAGAGCTCTGGGCTTTGG + Intergenic
1079020160 11:16903707-16903729 GCCTGGAGGACTCTGTAATTTGG - Intronic
1079116782 11:17645298-17645320 CCCTTGAGGACTCTGTGCTAGGG - Intronic
1081919670 11:46761827-46761849 CCCTTGAGGTGTCTCTGATTAGG - Intronic
1082780715 11:57285494-57285516 CTCTTGAGGACTGTGTGCTTGGG + Intergenic
1084672437 11:70615251-70615273 TCCTGGTGGACTCTGTGATGAGG + Intronic
1085161794 11:74354585-74354607 CCCTGGAGCACTTGGTGTTTGGG - Intronic
1090180400 11:124693436-124693458 AGCTGCAGAACTCTGTGATTAGG + Intronic
1091689296 12:2584727-2584749 CCTAGGAGGACTCTGGGTTTGGG + Intronic
1094383079 12:29864811-29864833 GCCTGGAGGACACTGGGTTTTGG + Intergenic
1095890989 12:47235122-47235144 TCCTGGGGGACTCTGTGCATAGG + Exonic
1098935138 12:76470217-76470239 TGCTGGCGGACTCTGTGGTTAGG + Intronic
1101033806 12:100685452-100685474 CCAGTGAGGACTCTGTGTTTGGG + Intergenic
1102236659 12:111298207-111298229 CCCCGGAGAACACTGTGATCAGG + Intronic
1102559035 12:113749041-113749063 CCCTGGAGGGACCTGAGATTTGG + Intergenic
1103679419 12:122681476-122681498 CTCTGGGGGCCTCTTTGATTAGG - Intergenic
1105305350 13:19164901-19164923 CCCTGGAGGAAGCTGTGAAACGG + Intergenic
1105700802 13:22934826-22934848 CCCGGAAGGCCTCCGTGATTTGG - Intergenic
1106554581 13:30798636-30798658 CCCTGGAGGCCTGAGTAATTTGG + Intergenic
1109109076 13:58292936-58292958 CCCAGTAGGACTCTGTGTGTGGG - Intergenic
1110298432 13:73897460-73897482 CCCTGGAGGAATACCTGATTCGG - Intronic
1110574601 13:77041109-77041131 CCCTGGAGGAGTGTGACATTGGG + Intergenic
1112364314 13:98743555-98743577 CCCTGGAGCACTCTGTGGTCTGG - Intronic
1115955447 14:38773915-38773937 TCTTGGAGGAGTCTGTGAATTGG - Intergenic
1118696649 14:68392725-68392747 CCGAGGAGGACACTGAGATTCGG + Intronic
1119547741 14:75485012-75485034 CCCTGGAGGACTGTGCTTTTGGG - Intergenic
1123005939 14:105323865-105323887 CCCTGGAGGCCTTGGGGATTCGG + Intronic
1124657109 15:31517614-31517636 CCCTGGAGAACTCAGTGTGTGGG - Intronic
1127256647 15:57298942-57298964 CCCAGAAGGACTCTGTGGCTTGG - Intronic
1127425500 15:58851836-58851858 CCCGGAAGGAATCAGTGATTTGG + Exonic
1128760376 15:70212676-70212698 CCCTGGAGGACTCTGGAGGTGGG - Intergenic
1130078172 15:80708103-80708125 CCACAGAGGACTCTGTGACTTGG - Intronic
1131019942 15:89088975-89088997 CCCGAGAGGCCTCTGTGTTTCGG + Intronic
1132570230 16:641196-641218 TGCTGGAGGTCTCTGTGCTTGGG - Intronic
1132975578 16:2709679-2709701 CCCTGGGGGACACCGTGAATGGG - Intergenic
1133805240 16:9121707-9121729 CCCTGGAGAACTCTGGAATGTGG + Intergenic
1136511536 16:30740674-30740696 CCTTGAAGGACTCTGAGTTTCGG - Exonic
1137977783 16:53045735-53045757 CCTTGTAGGACTGTGTGATTGGG - Intergenic
1139469192 16:67169371-67169393 CCTGGGAGGACGCCGTGATTGGG + Intronic
1141804116 16:86331339-86331361 CCATGGAGGACCCTTTGATGAGG + Intergenic
1142803427 17:2359207-2359229 CCCGAGAGGACTTTGTGAATGGG - Intronic
1143686002 17:8516256-8516278 CCCTGGAGGACATTGGGATAAGG - Intronic
1146122690 17:30209293-30209315 CCCTGCAGGTCTCTGTAGTTGGG - Intronic
1146462527 17:33057565-33057587 CCTTGGAAGACTCTGGGGTTTGG - Intronic
1147329290 17:39687473-39687495 CCCTGAAAGACTCTTTGATTAGG - Intronic
1151075414 17:71266635-71266657 ATCTTCAGGACTCTGTGATTTGG - Intergenic
1151768607 17:76145265-76145287 GCCTGGAGGACTCTGAGACGAGG - Exonic
1152121763 17:78423275-78423297 ACCTGTAGGACTCTGTGGCTGGG - Intronic
1152158055 17:78647872-78647894 CCCTGGTGGACTCTCGCATTTGG - Intergenic
1152885496 17:82846760-82846782 CCCTGCAGGCCCCTGTGTTTTGG + Intronic
1153072746 18:1124613-1124635 CCCTGCAGGACTTTGAGATTTGG + Intergenic
1155064810 18:22259015-22259037 TCATGGTGGACTCTGTGCTTTGG + Intergenic
1157137190 18:45067760-45067782 CCCTGTTGGACTCAGTCATTTGG + Exonic
1160088371 18:75801468-75801490 CCCTGGAGGGCCATGTGATGAGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160754750 19:751448-751470 CCTTGGAGGGCTCTGGGATTTGG - Intronic
1160791028 19:923853-923875 CCCAGGAGGAAGCTGTGATCCGG - Intergenic
1161907289 19:7166284-7166306 CCCTGGGTGGTTCTGTGATTTGG + Exonic
1164743405 19:30593758-30593780 CCTTGGAGGTCTCTGTCAGTTGG - Intronic
1164781589 19:30897353-30897375 CCCTGGGGCACTCTGGGGTTGGG + Intergenic
1165255212 19:34573535-34573557 CCCTGGAGCACCGTGGGATTGGG + Intergenic
1165258576 19:34594832-34594854 CCCTGGAGCTCCCTGGGATTGGG + Exonic
1165267122 19:34669562-34669584 CCCTGGAGCACCGTGGGATTGGG - Intronic
1165685953 19:37820037-37820059 CAGTGGAGACCTCTGTGATTTGG + Intergenic
1165772578 19:38387752-38387774 GGCTGGAGGACTCGGTGAGTGGG - Exonic
1166581061 19:43900208-43900230 GCTTGTAGGACACTGTGATTAGG - Intronic
1167715297 19:51139016-51139038 CCCAGGAGACCTGTGTGATTTGG + Intergenic
1168129603 19:54309934-54309956 ACCTGGAGGCCTCTGTGCTCAGG - Intronic
1168169794 19:54577650-54577672 ACCTGGAGGCCTCTGTGCTCAGG + Intronic
925794925 2:7531026-7531048 CCCAGGGGGACTCTGTGTTTTGG + Intergenic
926191917 2:10734702-10734724 CCCTGGGGGACTCTGTGCCCTGG + Intronic
926427922 2:12756501-12756523 CACTGTAGGACTCAGTGATATGG - Intergenic
927507436 2:23623544-23623566 CCATGGGGGACTCTGTGTTCTGG + Intronic
927673570 2:25089008-25089030 TCCTGGAGGCCTCTGTGCTGGGG + Intronic
928923717 2:36554299-36554321 CCCCAGAGGACTCTGTTCTTTGG + Intronic
929194513 2:39171574-39171596 CCCTGGTGGCCTATGTGCTTGGG - Intergenic
930641204 2:53856256-53856278 CCTTGCAGGACTTTGGGATTTGG - Intronic
932778565 2:74544887-74544909 CCCTGGGAGATTCTGTGATGGGG - Intronic
932848921 2:75164744-75164766 TCCTGGAAGGCTCTGTCATTTGG + Intronic
936502207 2:113075076-113075098 CCCTGGAGGCCTCTGGGGCTTGG - Intronic
937758436 2:125569723-125569745 CAATGGAGAACTCTGTCATTTGG + Intergenic
940089254 2:149897553-149897575 ACCAGGAGCCCTCTGTGATTAGG + Intergenic
941397655 2:164993082-164993104 GCCTGGAGGGCTTTGTGATGTGG + Intergenic
943313249 2:186353603-186353625 CCCAGTAGGACTCTGTGTGTGGG - Intergenic
945062993 2:205924836-205924858 CCCGGGAGGACTCTGTGGAATGG + Intergenic
947819661 2:233061048-233061070 CCCTGGAGGAAGCTGTTGTTTGG + Intronic
948584773 2:239012471-239012493 CCCTGGAGGAAGCTGTGCTTGGG - Intergenic
1169252761 20:4072909-4072931 CCCTGGAGGAATCTGTGTGGCGG + Intronic
1170026373 20:11892423-11892445 CCCTGGAGGACTCGTTGCTATGG - Intronic
1171426334 20:25050969-25050991 ACCTGGGGGACACTGTGTTTGGG - Intronic
1172097955 20:32469812-32469834 CCCTGGAGGAGTCTGGGGTTTGG - Intronic
1172991269 20:39038728-39038750 TCCTGGAGGACTTTGTGCATGGG + Exonic
1173337304 20:42123183-42123205 CCCTGGAGGAAGCTGTGATTTGG + Intronic
1173877034 20:46379624-46379646 CCCAGAAGGAGTGTGTGATTAGG - Intronic
1174302350 20:49591883-49591905 GCCTGGATGACTCTGTGGTCAGG + Intergenic
1175812839 20:61868142-61868164 CGCTGGAGGACTCTGGGGTCTGG + Intronic
1178383082 21:32127944-32127966 TGCTTGAGGACTGTGTGATTTGG - Intergenic
1179110879 21:38444066-38444088 CCCTCTAGGACACTGTGACTTGG + Intronic
1179607991 21:42530691-42530713 CCCTGGAGGACAGTGGGGTTAGG - Intronic
1180622633 22:17171967-17171989 CCCTGGAGGCCGGTGTGCTTTGG + Intergenic
1181014524 22:20061565-20061587 CCCTGGAGGAAGCTGTGCTTTGG + Exonic
1181890285 22:26056754-26056776 CCAGGGAAGAATCTGTGATTTGG + Intergenic
1182262216 22:29081993-29082015 CCCTCCAGGACTCTATTATTGGG + Intronic
1182948165 22:34344591-34344613 CCCATGAGGATTCTGTGATAAGG - Intergenic
1185023553 22:48394851-48394873 CCCTGCGGAACTCTGGGATTAGG - Intergenic
1185091980 22:48780767-48780789 CCCTGCAGGACTCTGGGCCTGGG - Intronic
1185277289 22:49955276-49955298 CCTTGGAGGACTCAGGGAGTTGG - Intergenic
949125040 3:437026-437048 ACCAGCAGGAATCTGTGATTTGG - Intergenic
949323880 3:2842318-2842340 CCCTGGAAGATTTTGTGTTTGGG - Intronic
951709197 3:25572392-25572414 CTTATGAGGACTCTGTGATTTGG + Intronic
953697186 3:45169354-45169376 CCCTGTTGGACTCTGTGCTTTGG - Intergenic
954865267 3:53723602-53723624 CCCTGGGGATCTCTGTGTTTCGG + Exonic
954876353 3:53805508-53805530 CCCTGCTGCACTCTGTGATGGGG + Intronic
955457159 3:59135901-59135923 GCCTGGAGGCCTTTGTCATTAGG - Intergenic
956749894 3:72337050-72337072 CCCAGGAGGACACTGTGCTCGGG + Intergenic
957305779 3:78456892-78456914 CCCTGGCCAACTCTCTGATTCGG - Intergenic
959798995 3:110467453-110467475 CCCTGGAAGACTCGGTCTTTTGG - Intergenic
961008294 3:123419621-123419643 CCAGGGAGGACCCTGTGCTTGGG + Intronic
964561985 3:158007255-158007277 CCCCGTGGGACTCAGTGATTTGG - Intergenic
968263420 3:197343407-197343429 CCTTCAAGGACTCTATGATTTGG - Intergenic
969137019 4:5037607-5037629 GCCTGGAGGACTCTGAGAAAGGG + Intergenic
970142721 4:12999768-12999790 CCCTGGAGAGCTCAGTGATGTGG - Intergenic
971401037 4:26275493-26275515 CCCAGGGGGACTATGTGACTCGG + Intronic
972339152 4:38136030-38136052 TCCTGGAGTGCTCTGTGACTTGG - Intronic
975302515 4:72807391-72807413 CCCTGGAGCACTTGGTGTTTTGG - Intergenic
977386816 4:96350730-96350752 GCCTGCAGAACTCTGTAATTTGG + Intergenic
979947408 4:126850508-126850530 TCCTGAAGGATTCTGTGGTTAGG - Intergenic
980419430 4:132541369-132541391 CTCTGGAGGACTCAGGGCTTGGG - Intergenic
982072631 4:151708817-151708839 CCCTGGAGGCCCCTCAGATTAGG + Intronic
985721593 5:1492405-1492427 ACCTGGAGCACCCTCTGATTCGG - Intronic
991130423 5:63116480-63116502 ACATGGAGGACTTTGTGAGTGGG + Intergenic
994386375 5:99137658-99137680 CCCTGCAGGACTCAATTATTAGG - Intergenic
994900192 5:105761064-105761086 CCCTGGAGGACGCAGGGAGTGGG - Intergenic
996314358 5:122144899-122144921 CTCTTGGGTACTCTGTGATTTGG + Intronic
998696920 5:144651510-144651532 TCCTGGAGGACTCTGTCTCTGGG - Intergenic
999525827 5:152404793-152404815 CCCTGGAGGTCTATGAGATGTGG - Exonic
1000652107 5:163830552-163830574 CCCTGAAGGACTCAGAGACTGGG + Intergenic
1002719831 5:181251686-181251708 CACTTGAGGACTCTCTGGTTTGG + Intergenic
1003950411 6:11110789-11110811 CTCTGGAGGACTTGGTGTTTGGG + Intronic
1004695504 6:18029230-18029252 CCATGGAGGTCTGTGTGCTTGGG + Intergenic
1017011659 6:150067814-150067836 CCCTGTTGGATTCTGTGGTTGGG - Intronic
1017232998 6:152092682-152092704 CCCTGCAAGGCGCTGTGATTAGG + Intronic
1017254375 6:152316432-152316454 CCATGCAGGGCTGTGTGATTTGG - Intronic
1024883018 7:54111119-54111141 TCCAGGAGGGCTCTGTGAGTGGG + Intergenic
1025709085 7:63891093-63891115 CCATGAAGGACTGTGTGAATGGG + Intergenic
1029401124 7:100347206-100347228 CCCTCCAGGACCCTGTGTTTTGG + Intronic
1032192346 7:129772200-129772222 CCCTGGAGGGCTGTATGAGTGGG - Intergenic
1034062663 7:148107347-148107369 CCCTGTGTGTCTCTGTGATTCGG - Intronic
1038077837 8:24097592-24097614 CCCTGTAGTGCTCTATGATTTGG + Intergenic
1038335461 8:26642000-26642022 CCCTTGAGGGCCCTGTGTTTGGG + Intronic
1039428683 8:37507821-37507843 CCCTAGAGCAGTCTCTGATTAGG - Intergenic
1039790126 8:40868967-40868989 CCCTGCAGGACTGTGAGATCAGG - Intronic
1040325874 8:46341255-46341277 CCCTGGGGGATTCTGGGATAAGG - Intergenic
1041205644 8:55495544-55495566 CCCTGGAAGCCACTGTGATGGGG - Intronic
1041813266 8:61936734-61936756 ACCTGGAGGAAACTGGGATTTGG + Intergenic
1042186324 8:66139702-66139724 CCCTGCAGGACTTTATGATGAGG + Intronic
1046015755 8:108603349-108603371 CCCTGGAGGAGTCAGTGATAAGG - Intergenic
1047192503 8:122690884-122690906 CCCTGGAGGCCTTTGTGACCAGG - Intergenic
1047393675 8:124474871-124474893 CCCAGGAGGTCTCTGGGTTTCGG - Exonic
1049097105 8:140555280-140555302 CCCTGGAGGGCTCAGTGTTCAGG + Intronic
1049841761 8:144777701-144777723 CTCTGGAGGGCACTGAGATTGGG + Intronic
1056831064 9:89917991-89918013 CCATGGAGGACACTGTGGTGTGG - Intergenic
1059453477 9:114385554-114385576 ACCCAGAGGGCTCTGTGATTGGG - Intronic
1059767800 9:117400412-117400434 CCCTAGAGGCTTCTGTGGTTTGG + Intronic
1062284841 9:135768319-135768341 CCGTGGGGGACACTGTGATGTGG + Intronic
1185871625 X:3669540-3669562 TCATGGAGGACTCTGTGGTGGGG - Intronic
1189079498 X:37955706-37955728 CCCTAAAGGACTCTGTGAATTGG + Intronic
1190981119 X:55457279-55457301 CCCTGGAGGAATCTGTGTACAGG - Intergenic
1190987578 X:55515901-55515923 CCCTGGAGGAATCTGTGTACAGG + Intergenic
1194618820 X:96141987-96142009 CACTGCAGGAAGCTGTGATTAGG + Intergenic
1197724549 X:129767909-129767931 AACTGGAGGAATCTGAGATTGGG + Intronic
1198532148 X:137557942-137557964 CCATGGAGGAATGTGTGATGAGG + Intergenic