ID: 918264886

View in Genome Browser
Species Human (GRCh38)
Location 1:182832565-182832587
Sequence TGTCCACTCATTCAAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918264886_918264888 -1 Left 918264886 1:182832565-182832587 CCCTCAGCTTGAATGAGTGGACA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 918264888 1:182832587-182832609 ACATTTAAAGCATGTTAGAGTGG 0: 1
1: 0
2: 1
3: 29
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918264886 Original CRISPR TGTCCACTCATTCAAGCTGA GGG (reversed) Intergenic
903836043 1:26203854-26203876 GGTCCACTGATTGCAGCTGATGG + Intergenic
903836219 1:26204761-26204783 GGTCCACTGATTGTAGCTGATGG - Intergenic
905088623 1:35408006-35408028 AGTCCGCTCTATCAAGCTGAAGG + Exonic
906858410 1:49332153-49332175 TGTCTACTTATTCAGGATGAAGG + Intronic
909505874 1:76389124-76389146 TGAACACTCAATCAAGCTTAGGG - Intronic
910208957 1:84774844-84774866 TGTGCAGTCAGGCAAGCTGATGG - Intergenic
915980114 1:160415261-160415283 TGTCCACTGATTCAGCCTGTTGG + Intronic
917649058 1:177058553-177058575 TGTCCACTAATTCTTGCTCAGGG + Intronic
918264886 1:182832565-182832587 TGTCCACTCATTCAAGCTGAGGG - Intergenic
921349300 1:214219168-214219190 TGGCCCCTCATTCCATCTGAGGG - Intergenic
1063080866 10:2765962-2765984 TCTTCCCTCATTTAAGCTGAGGG + Intergenic
1065137880 10:22690628-22690650 TGTGCACTCATTGAATCTTAGGG - Intronic
1065424957 10:25591349-25591371 TTTCTACTGATTCAAGGTGACGG + Intronic
1068346938 10:55793225-55793247 TGTCCACTGATTCAATCAGCAGG + Intergenic
1072168607 10:92838416-92838438 TGTCCACTCTTTCAAAAAGAGGG - Intronic
1072415252 10:95241794-95241816 AGTCCTCTCATTCAAGCCCAGGG - Intronic
1077979162 11:7282155-7282177 AGTCCACTCATTCCAGGTTAGGG + Intronic
1078620395 11:12901993-12902015 TGTCCACTGATTCAAGCAATGGG - Exonic
1080047653 11:27826497-27826519 TGGCCCCTCATTCAAGCTCGGGG + Intergenic
1080309143 11:30869125-30869147 TTTCCACTCTTTCAGGCTGTTGG + Intronic
1081223354 11:40490329-40490351 TGTCCACTAATATAAGGTGATGG - Intronic
1084750184 11:71199452-71199474 TGACCACTCAGTCAAAATGAAGG + Intronic
1084775488 11:71372101-71372123 TTTCCTCTCTTACAAGCTGATGG - Intergenic
1086328843 11:85733038-85733060 TCTCAACTCACACAAGCTGAAGG + Intronic
1087667331 11:101065829-101065851 TTGTCTCTCATTCAAGCTGATGG + Intronic
1088896746 11:114084228-114084250 TGACCACCCATTCAAGCTAAAGG - Intronic
1091136352 11:133194145-133194167 CCTCCACTCATTGAAGCCGATGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1095121473 12:38424562-38424584 AGGCCACTGATGCAAGCTGAGGG + Intergenic
1099961834 12:89404241-89404263 TGTCCACCATTCCAAGCTGAGGG + Intergenic
1105758346 13:23490555-23490577 TGTGCTCTCATTTAAGCTCATGG - Intergenic
1106962573 13:35016570-35016592 TGTATACACATACAAGCTGAAGG - Intronic
1108463889 13:50695178-50695200 AGTCCACCCATTCAGGCTCAAGG - Intronic
1109703893 13:66063348-66063370 AGTCAACTCATAAAAGCTGAGGG + Intergenic
1112253924 13:97810483-97810505 AGTCCAGCCATTCAAGCAGAAGG - Intergenic
1113428427 13:110229183-110229205 TGTCCACTCATTTGAAGTGAAGG - Intronic
1118647792 14:67856625-67856647 TCTCCTCACATTCAAGATGAGGG - Intronic
1121045107 14:90782046-90782068 TGTCCACTCATCAAAGCTCTAGG - Intronic
1122966479 14:105130008-105130030 TGTCCACTTGTTTAAACTGATGG + Intergenic
1127431763 15:58917225-58917247 TGTCAAGTCAGTTAAGCTGATGG - Intronic
1128805731 15:70529687-70529709 TGTCCACTCACTAATGATGAAGG - Intergenic
1129549576 15:76433139-76433161 TGTCAACTCTTTCCAACTGAAGG - Intronic
1133108852 16:3533534-3533556 TATCCACTCAGTAAAGCTCAAGG - Intronic
1134049422 16:11126580-11126602 TGTCCACTCCTTCCATATGAGGG + Intronic
1134686972 16:16165812-16165834 TGTCCGCTCAAAGAAGCTGATGG + Exonic
1135525803 16:23212830-23212852 TGTCCACTCTTTAAAGCTAAGGG - Exonic
1136657221 16:31716761-31716783 TGTCCATTAATTCAAGATTATGG + Intronic
1137244338 16:46689930-46689952 TGCCATCTCATTCAAGCTCACGG - Intronic
1140088542 16:71818181-71818203 CGTCCACACATGCCAGCTGATGG + Intergenic
1140959828 16:79901079-79901101 TGTCCATTCATTCAAGGCGTTGG + Intergenic
1143194456 17:5064968-5064990 TGGCCAGTCACACAAGCTGAAGG + Intergenic
1147904422 17:43813632-43813654 TGCCCTCTCATCCAAGCAGAGGG + Intronic
1158584799 18:58722567-58722589 TTTCCCCTCATTCACTCTGATGG + Intronic
1167275322 19:48534713-48534735 TCTCCACTCATTCACACTCACGG - Intergenic
927685901 2:25170088-25170110 TGTAAACTCTTTCAAGCAGATGG + Intergenic
933453815 2:82496256-82496278 AGACCACTGATTCAAGATGATGG - Intergenic
939735921 2:145844757-145844779 TGTCCAAACATTCAAGATGTGGG + Intergenic
942288310 2:174444114-174444136 TGTCCACTAATTTAAGGAGATGG + Intronic
942424558 2:175846035-175846057 TGTCGTCTCACTCCAGCTGACGG - Intergenic
943183687 2:184576947-184576969 TGTCAATTAATTCAAGTTGATGG - Intergenic
945556865 2:211287678-211287700 TCTTCAGTCATTGAAGCTGATGG - Intergenic
945928089 2:215826666-215826688 TGTCCACTCCTTCAAACTCCAGG - Intergenic
946276008 2:218632347-218632369 AGTCAACTTATGCAAGCTGAAGG + Intronic
1173137296 20:40449948-40449970 TGTCCACTCATGCCAGCACATGG + Intergenic
1181977839 22:26743985-26744007 TGTCCACTCATTCAATTCCATGG - Intergenic
1183014565 22:34975189-34975211 TTACCATTCATTCAAGATGATGG + Intergenic
1184209176 22:43025198-43025220 CGTGCACTCATTAAGGCTGATGG + Intergenic
949574099 3:5322183-5322205 TCTCCATTCATTCAAACTGCTGG - Intergenic
954063308 3:48087506-48087528 TGTCTACCCAGCCAAGCTGACGG + Intronic
955996804 3:64687084-64687106 TGTCCACTGATTAAGGGTGAAGG - Intronic
960297665 3:115963517-115963539 TATCCCCTCATTCAAGCACATGG - Intronic
960422050 3:117458782-117458804 TGTCAACTAAATCAAGTTGATGG + Intergenic
961188079 3:124933277-124933299 TTTCAACTCATTGAACCTGAAGG + Intronic
961416115 3:126758436-126758458 TGGCCATTCTTTCAATCTGAAGG + Intronic
961559189 3:127717185-127717207 TGGCCACTCTTTCAAGCTTCAGG - Intronic
963329003 3:143893432-143893454 TGTCCACTCATCTGGGCTGAAGG - Intergenic
973976948 4:56272185-56272207 TGGTCGCTCATTCAGGCTGATGG + Intronic
974082616 4:57228351-57228373 TCTCCACTCGTCCCAGCTGATGG - Intergenic
975758315 4:77593422-77593444 TGTCCACTCATTCATCGTGATGG - Intronic
976268992 4:83211602-83211624 TGCCCACTCCTTCAAGCACAAGG - Intergenic
976538421 4:86244559-86244581 AGTTCACTTATTCATGCTGAAGG - Intronic
980031810 4:127840461-127840483 TGTCTGCTCATTAAAGCTAAAGG - Exonic
980099698 4:128529354-128529376 TGAGCTCTCATTTAAGCTGAGGG - Intergenic
981180068 4:141731112-141731134 TGTCCACCCACACAAGCTTAGGG - Intronic
984616853 4:181907795-181907817 TTTCTACTCATTCAAGCAGTTGG - Intergenic
988549966 5:32191508-32191530 TGTCCACTCATTGAATCTGGGGG - Intergenic
994382541 5:99088373-99088395 TGTGCAAACATTCAAGCTCATGG + Intergenic
997516863 5:134496108-134496130 TGTCCAGTCCTTCAAACTGATGG + Intergenic
997561994 5:134854161-134854183 TGTTCACTCATTTTAGCTAATGG + Intronic
1000172384 5:158714892-158714914 TGGCTACTCATTCCAGTTGAAGG + Intronic
1000219283 5:159196784-159196806 TTTCCACTGATTGTAGCTGAAGG + Intronic
1001117967 5:168955466-168955488 TGTTCACTCGTTCAGGCTGCAGG + Intronic
1002918785 6:1550792-1550814 TGTCCACACATTCATGGTGCTGG - Intergenic
1003728978 6:8799276-8799298 TGTCGTCTCACTCCAGCTGACGG + Intergenic
1004832553 6:19493135-19493157 TGTCCAGTCATTCCAACTGATGG + Intergenic
1007787846 6:44291652-44291674 CGTCCACTCATTCCTTCTGATGG + Intronic
1010326401 6:74568043-74568065 TTTCAACTCATTCAAGCAAAGGG - Intergenic
1012501034 6:99888425-99888447 TGTTGACACTTTCAAGCTGAAGG + Intergenic
1020718368 7:11708652-11708674 TCTCCACTCACTCTAGCTCAAGG + Intronic
1021152444 7:17167902-17167924 TGTTCATTCAGGCAAGCTGATGG - Intergenic
1023320933 7:38996867-38996889 TGTCCATTCATTAAAGGTGGGGG - Intronic
1027872098 7:83720341-83720363 TGTCCACTCACTCTGGATGAGGG + Intergenic
1030061310 7:105623472-105623494 TGTGCACTCATTCAAGGAAATGG + Intronic
1036458727 8:8932509-8932531 TCTCCACTCAATCGAGCTGGAGG - Intergenic
1037145131 8:15562633-15562655 TCTCAACTCATTCAAGTTGTAGG + Intronic
1037669089 8:20998937-20998959 TGTCAACTTAATCAAGTTGAAGG + Intergenic
1040641700 8:49342344-49342366 TGTGCACTCATAAAATCTGATGG + Intergenic
1043229593 8:77784919-77784941 TTTCAACTCCTTTAAGCTGAGGG + Intergenic
1049598591 8:143496646-143496668 TGTCCACTCATTCTAGATGTTGG - Intronic
1058628748 9:106963551-106963573 TGTCCACAAATTCAATCTAATGG + Intronic
1062365438 9:136205976-136205998 TGGCCACTCAAGCAAGCTGGGGG + Intergenic
1185738368 X:2510746-2510768 TCTCCACACATTCCAGCTGGTGG - Intergenic
1185758048 X:2667894-2667916 TGTCCTCACCTCCAAGCTGATGG + Intergenic
1186330788 X:8530949-8530971 TATCCATTTATTCAAGCTTAGGG + Exonic
1189905762 X:45757774-45757796 GCTCCACTCATTAAAACTGATGG - Intergenic
1194808689 X:98363475-98363497 AGTGAACTCATTCAGGCTGATGG - Intergenic
1196244268 X:113380977-113380999 TTTTCCCTCATTCAAGCTGTTGG + Intergenic
1199041290 X:143118190-143118212 TTTCCACTCATTCAGGATGGAGG - Intergenic
1199571476 X:149271086-149271108 TGTCAACTCAGTGAAGCTCAGGG - Intergenic
1199605597 X:149576394-149576416 GGGACACTCATTCAAGTTGACGG - Intergenic
1201432450 Y:13917849-13917871 TATCCATTTATTCAAGCTTAGGG - Intergenic
1201613160 Y:15865670-15865692 TGTCCTGGCATTCAAGTTGACGG + Intergenic
1201897704 Y:19010372-19010394 TGTCCATTCAGTCAAATTGATGG - Intergenic