ID: 918265806

View in Genome Browser
Species Human (GRCh38)
Location 1:182840197-182840219
Sequence GGGGAGAAACGAATGGATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918265798_918265806 8 Left 918265798 1:182840166-182840188 CCGGGTGTGCAGTAGTGGTGGCA 0: 1
1: 0
2: 1
3: 14
4: 120
Right 918265806 1:182840197-182840219 GGGGAGAAACGAATGGATAGGGG 0: 1
1: 0
2: 1
3: 19
4: 253
918265797_918265806 9 Left 918265797 1:182840165-182840187 CCCGGGTGTGCAGTAGTGGTGGC No data
Right 918265806 1:182840197-182840219 GGGGAGAAACGAATGGATAGGGG 0: 1
1: 0
2: 1
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918265806 Original CRISPR GGGGAGAAACGAATGGATAG GGG Intronic
902844433 1:19098699-19098721 TGGGAGAAAAGAAAGGAGAGAGG + Intronic
903666590 1:25011797-25011819 GGGGAGAAGGGAATGGGTGGAGG - Intergenic
904840790 1:33370643-33370665 GGGGAGAAAGAAATGGATGAGGG - Intronic
906335354 1:44925501-44925523 GGGGAGAAAAAAATGGGGAGGGG + Intronic
907114426 1:51956535-51956557 GAGGAGAAAAGAATGGAGAGGGG - Intronic
908042324 1:60127893-60127915 GGGGAAACTAGAATGGATAGTGG + Intergenic
908361119 1:63368970-63368992 GGGGAGGAAAGAAGGGATGGTGG - Intronic
909345558 1:74581904-74581926 GAGGAGAAAGGAAAGGAAAGTGG + Intronic
910010654 1:82457686-82457708 AGTGAGAAAGCAATGGATAGGGG - Intergenic
915195562 1:154186607-154186629 AGGGAGAAACAAAGGGAAAGAGG - Intronic
915668638 1:157467869-157467891 GGAAAGAAAGGGATGGATAGTGG - Intergenic
916540265 1:165746814-165746836 GGAGAGAAAGGAAGGGATGGAGG + Intronic
916884022 1:169049457-169049479 GGGGAGAAACAAATGTCAAGTGG + Intergenic
917036703 1:170755578-170755600 GGGAAGAATTGAATTGATAGGGG + Intergenic
918102456 1:181388083-181388105 GGGGAGAAACAAATGTCTATCGG - Intergenic
918265806 1:182840197-182840219 GGGGAGAAACGAATGGATAGGGG + Intronic
919094221 1:193010406-193010428 GGGGAGGAAGGAATGGAGGGAGG + Intergenic
920500513 1:206482266-206482288 GGGGAGGAAAGAAGGCATAGAGG + Intronic
922243905 1:223776520-223776542 GGGGACAAGGGAATGGACAGTGG + Intergenic
1063112313 10:3047767-3047789 AGAGAGAAAGGGATGGATAGAGG - Intergenic
1063661515 10:8037547-8037569 AGGGAGAAAGGAAAGGAAAGAGG - Intergenic
1064057033 10:12106456-12106478 GGGGACAAATGAATGAAAAGGGG + Intronic
1067129125 10:43545696-43545718 GGGTAGACACTAATGGAAAGAGG + Intergenic
1070499300 10:77055463-77055485 AGGGAGGAAGGAATGGATGGAGG - Intronic
1071155463 10:82683336-82683358 GGGGAGAGAGGAAGAGATAGAGG - Intronic
1071248696 10:83792505-83792527 GGGGAGAAAGGCATGAAGAGAGG - Intergenic
1073102431 10:101013554-101013576 GTGGAAAAACGAGTAGATAGTGG + Intronic
1074318244 10:112378131-112378153 AGAGAGAAATGAATGGAGAGAGG + Intronic
1077065949 11:640985-641007 GGGAAGAAACAAATGGGGAGAGG + Intergenic
1077311988 11:1892939-1892961 GGGGATGGATGAATGGATAGAGG + Intergenic
1077312067 11:1893301-1893323 GGGGATGGATGAATGGATAGAGG + Intergenic
1078039890 11:7850440-7850462 GGAGAAAAAGGAATGGAAAGAGG + Intergenic
1078899385 11:15627484-15627506 GGGGAGAAGTGAATGGATCCTGG - Intergenic
1082924502 11:58531093-58531115 GGGGAGAAACCAATGCAAAAAGG + Intronic
1087031257 11:93706897-93706919 GGTGAGAAATAAATGGAAAGTGG + Exonic
1088152043 11:106757453-106757475 GGGGAGAAACCAATGAAAAAAGG - Intronic
1089139521 11:116274728-116274750 AGGGAGAAAGGAAGGGAGAGAGG + Intergenic
1089980220 11:122766054-122766076 GGGAAGAAGCGAAAGGAGAGGGG + Intronic
1092782847 12:12003329-12003351 GGAGAGAAAAGGATGGATTGAGG - Intergenic
1093149765 12:15606908-15606930 GAGGAGAAAAGAAGGGATTGGGG + Intergenic
1093169657 12:15845544-15845566 GAGAAGAAAAGATTGGATAGTGG - Intronic
1094101626 12:26770668-26770690 AGGAAGAAAAGAATGGATATGGG - Intronic
1097801247 12:63916853-63916875 AAGGAGAAATAAATGGATAGAGG - Intronic
1099740080 12:86623841-86623863 GGGGAGAAATGGATGGAGATGGG - Intronic
1102417398 12:112775983-112776005 AGGGAGAAATGAAAGGAAAGAGG + Intronic
1102662190 12:114538912-114538934 GAGGAGAAAGGAACGGAGAGTGG - Intergenic
1102665538 12:114569382-114569404 GAGGAGAAAGGAATGGAGAGTGG + Intergenic
1103141937 12:118556338-118556360 GGGGAGAAAAGACTGCATGGAGG + Intergenic
1104113287 12:125724569-125724591 GGTGAGAAAGGCATGGATAATGG - Intergenic
1106212451 13:27662698-27662720 TGGGGGAAACGAATGCAAAGAGG + Intronic
1107579221 13:41764327-41764349 AGGGAGAAACGAAGGGAGGGAGG - Intronic
1107703805 13:43078200-43078222 GGGGAGGAACTAATGAAGAGGGG - Intronic
1108023168 13:46150245-46150267 GAGCAGAAAGGAATGGAAAGCGG - Intronic
1113281184 13:108789591-108789613 TGGGAGAAAGCAATGGGTAGAGG + Intronic
1113663090 13:112120275-112120297 GGGGAGGAACGAAGGGAGCGGGG + Intergenic
1115078527 14:29421323-29421345 GGGGAGAAAGGAAAGGAAGGAGG + Intergenic
1116664408 14:47756804-47756826 AGGGAGTAACGAATGGCAAGGGG - Intergenic
1116953673 14:50901060-50901082 GGGGAGAAATGAATGGGTTTAGG + Intronic
1117471294 14:56048341-56048363 GGGGAGAAATGAAAGTATACTGG + Intergenic
1117908536 14:60614465-60614487 TGGGAGAAAAAAATGGAAAGGGG + Intergenic
1117967575 14:61221496-61221518 GGAGAGAAAAGAATGGGGAGGGG - Intronic
1118312771 14:64705414-64705436 GGGGAGAATGGAATGGTTGGAGG + Intronic
1119188045 14:72658598-72658620 GAGGAAAAAGAAATGGATAGGGG + Intronic
1119420725 14:74506327-74506349 GAGGAGGAACCAATGGACAGAGG + Intronic
1119532673 14:75373978-75374000 AGGGAGAAACTTATTGATAGAGG - Intergenic
1119578656 14:75753954-75753976 GGAGAGAAAAGAAAGGATAAGGG - Intronic
1120920390 14:89749733-89749755 GGGCAGGAACAAATGGGTAGTGG + Intergenic
1121803297 14:96793509-96793531 TGGGAGAAAGGAAAGGAGAGAGG - Intergenic
1124017543 15:25890193-25890215 GGAGAGAGAGGGATGGATAGGGG - Intergenic
1124588298 15:31031277-31031299 GGGAAGAAAGGAAGGGAAAGAGG - Intronic
1125965678 15:43873944-43873966 GGGGACAAAAGTATTGATAGTGG + Exonic
1126167593 15:45666899-45666921 TGGGAGAAAGGAAAGGAGAGGGG - Intronic
1126167613 15:45666957-45666979 GGGGAGAAAGGAGAGGAGAGGGG - Intronic
1126838874 15:52696248-52696270 TGGGAGAGAGGAATGGCTAGAGG - Intronic
1127169607 15:56286964-56286986 GGGGAGAAACTCAGGGATAGGGG + Intronic
1128036042 15:64527657-64527679 CTGGAGAAAGGAATGGAGAGAGG - Intronic
1130026121 15:80271882-80271904 GTGAAGAAAGGAATGGAGAGGGG - Intergenic
1130127343 15:81105097-81105119 GGGGAGAAAGGAAGGGAGGGAGG - Intronic
1130634933 15:85609251-85609273 GGGGAGAAGAGAATGGGGAGAGG - Intronic
1131925902 15:97383457-97383479 AGGGAGAAAGGAATGGAGGGAGG + Intergenic
1133711717 16:8408100-8408122 AGGGAGAAAGGAAAGGATGGAGG - Intergenic
1136486917 16:30579190-30579212 ATGGATAAATGAATGGATAGAGG + Intronic
1137483033 16:48868253-48868275 GGGGAGAAACGAAGAGAATGTGG - Intergenic
1140098612 16:71895710-71895732 GAGGAGAAAGGGAAGGATAGTGG + Intronic
1140678930 16:77364671-77364693 GGGTAGAAATAAATGGATAATGG + Intronic
1141859857 16:86709108-86709130 GAGGTGAGAAGAATGGATAGAGG - Intergenic
1143008985 17:3855207-3855229 GGGGAGAGATGAATGGGTAAAGG + Intergenic
1143452540 17:7044082-7044104 GGCGAGAAATGAATGCAGAGGGG + Intergenic
1144120414 17:12147292-12147314 GGTGAGGAATGAATGGAGAGTGG - Intergenic
1145271503 17:21407253-21407275 GTAGAGAAATGAATGGATAGAGG - Intronic
1145271546 17:21407456-21407478 GTGAAGAAGTGAATGGATAGAGG - Intronic
1145309717 17:21694701-21694723 GTAAAGAAATGAATGGATAGAGG - Intronic
1145309760 17:21694904-21694926 GTGAAGAAGTGAATGGATAGAGG - Intronic
1146788112 17:35735429-35735451 GTGGGGAAACGGATGGGTAGGGG + Intronic
1147144538 17:38477535-38477557 GGGGAGACAGGAATGGTGAGAGG - Intronic
1147842824 17:43384397-43384419 GGGGAGAGAAGAATGGCAAGTGG - Intergenic
1148380604 17:47194048-47194070 GGGGCCACAAGAATGGATAGGGG - Intergenic
1150998097 17:70342045-70342067 GAGGAGACAGGACTGGATAGAGG - Intergenic
1151871663 17:76840925-76840947 GGGGAGAAACAGAGGGAGAGAGG - Intergenic
1155130978 18:22933902-22933924 GGGGAGAAATGGATGGAGAAGGG + Exonic
1155830127 18:30505592-30505614 AGGGAGGAACTAATGGAAAGAGG + Intergenic
1156356100 18:36341582-36341604 GGGGAGAAAAAAATGGAGATGGG + Intronic
1156709213 18:39922092-39922114 GTGGAGAAAGGACTTGATAGAGG + Intergenic
1159734138 18:72073549-72073571 GGGGAGAAAATAATGGCTTGAGG - Intergenic
1159950578 18:74479765-74479787 GGGAAGAAAAGAATGCTTAGCGG - Intergenic
1160827043 19:1085424-1085446 GGGGAGAAACGGAAGGAGAGAGG - Intronic
1163353807 19:16796603-16796625 AGGGAGAAAGGAAGGGATAGCGG - Intronic
1163502733 19:17686388-17686410 GGGGAGAAGAGAGAGGATAGAGG + Intronic
1164806079 19:31118140-31118162 TGGAAGAAACGAAAGGAGAGAGG + Intergenic
1165028354 19:32978529-32978551 GGGGAGAAACAATTTGAAAGAGG + Intergenic
1165100538 19:33436116-33436138 GGGGAGAAAAGAAGGGAGAAGGG + Intronic
1166215399 19:41331302-41331324 GGGGAGAGACGAAGTGAGAGAGG - Intronic
1166311666 19:41966681-41966703 GGGGCGGGAGGAATGGATAGAGG + Exonic
1167045274 19:47045786-47045808 GGGGAGACAGAAATGGACAGAGG - Intergenic
1168544379 19:57238628-57238650 ATGGAGAAAGGAATGGAAAGAGG - Intergenic
924967745 2:93330-93352 GGGGAGAAACCAGTGGAAAAAGG + Intergenic
929937550 2:46304845-46304867 AGGAAGGAAAGAATGGATAGGGG + Intronic
930412705 2:51047070-51047092 GGGGAGAAGAGAATGGGGAGAGG - Intergenic
933624207 2:84580230-84580252 GGGGAGAAAAAAGTGGATATGGG + Intronic
936434038 2:112487841-112487863 GGAGAGAGACAAATGGATAAAGG - Intronic
937318354 2:120946324-120946346 GGGGAGAAGGCAATGCATAGGGG + Intronic
937915267 2:127095784-127095806 AGAGAGAAACAAATGGAAAGCGG + Intronic
938201053 2:129373390-129373412 GGGGGAAGACGAATGGATGGAGG - Intergenic
938270798 2:129969155-129969177 GGTGGAAAAAGAATGGATAGTGG - Intergenic
938621175 2:133055070-133055092 GGGGAGAAAGGAGTGAGTAGTGG + Intronic
938851276 2:135263097-135263119 TGGGAGAGAAGAATGGATATGGG - Intronic
938939110 2:136153664-136153686 GTGGAGAATGGATTGGATAGAGG - Intergenic
939846375 2:147251358-147251380 AGGGAGAAGCAAATGGGTAGAGG + Intergenic
941778101 2:169414563-169414585 GGGAAGAGAGGATTGGATAGAGG - Intergenic
942266436 2:174231152-174231174 GGGGAAGAAGGAATGGAGAGTGG - Intronic
944824004 2:203462242-203462264 GGAGAAAAATGAATGTATAGTGG + Intronic
945711002 2:213294090-213294112 GGGGAGTTACCAATGAATAGAGG - Intronic
946154957 2:217801266-217801288 GGCGAGAAAACAATGGAGAGGGG - Exonic
946347497 2:219122906-219122928 GGGGAGTAAAGAGTGGATAGCGG + Intronic
946795467 2:223346590-223346612 ATGGAGAAACGAATGCAAAGAGG + Intergenic
946973703 2:225123511-225123533 AGGGAGGAAGGAAAGGATAGAGG - Intergenic
947683553 2:232059627-232059649 GAGGAGGAAGGAAGGGATAGGGG - Intronic
948093044 2:235311736-235311758 GGGGAGAAATGAACTGATAAGGG + Intergenic
1172208833 20:33183394-33183416 GGGGAGAGAAGAATGCACAGTGG - Intergenic
1177316938 21:19474410-19474432 GGGGAAAAAAGAATGGAGAGGGG - Intergenic
1177808227 21:25896877-25896899 GGGGAGAAATGAATGGGTAAAGG + Intronic
1178086645 21:29119045-29119067 GGGGAGAAGCCAATAGATAATGG - Intronic
1179076656 21:38128547-38128569 GGAGAGAGAGGAAAGGATAGAGG - Intronic
1179963293 21:44784196-44784218 GGGGAGAAAGGAAGAGAGAGAGG + Intronic
1182917939 22:34052518-34052540 TGGGAGAAATGAATGGGTATGGG + Intergenic
1183708761 22:39490440-39490462 GAGGAGAAGAGAATGGATATGGG + Exonic
1184278091 22:43421719-43421741 AGGGAGAAACGGATGGATGGAGG - Intronic
949531307 3:4958264-4958286 GGGAAGAAAAAAATGGCTAGGGG + Intergenic
949887544 3:8708615-8708637 GGGGAGAAAGGAGAGGGTAGAGG - Intronic
950580400 3:13858307-13858329 AGGGAGAAACCAAGGGAGAGGGG - Intronic
951540486 3:23777449-23777471 GGGGAGAGAGGAAAGGAAAGTGG - Intergenic
952418654 3:33112037-33112059 AGGGAGGAATGAATGGGTAGAGG - Intergenic
952531935 3:34271771-34271793 GGGAAGAAGAGAGTGGATAGTGG - Intergenic
955747080 3:62150569-62150591 GGGAAGGAAGGAGTGGATAGTGG - Intronic
956190393 3:66602267-66602289 AGGAAGAAAGGAATGGATCGAGG - Intergenic
956493786 3:69802573-69802595 GGTGAAAAATGAATGGATGGCGG - Intronic
957671646 3:83312530-83312552 AAGAAGAAACGAATGGATACCGG + Intergenic
960763194 3:121096458-121096480 GGGGAGAAACCAGTGCAAAGTGG - Intronic
961218577 3:125181883-125181905 GGAGAGTAAAGAATGAATAGAGG + Intronic
962028667 3:131575337-131575359 GGGGAGCAATGGATGGATATTGG - Intronic
962512460 3:136115286-136115308 GGGGAGAAACTAGTGCAAAGAGG + Intronic
963284230 3:143417507-143417529 GGGGAGAAAGGGATGGATGGAGG + Intronic
963577787 3:147083821-147083843 CTGAAGAAAAGAATGGATAGTGG - Intergenic
964234557 3:154509991-154510013 AGGGAAAAAGGAAAGGATAGAGG - Intergenic
965400455 3:168206802-168206824 GATGAGAAACGAATGCATTGAGG - Intergenic
965604236 3:170483559-170483581 GGGAAGAACAGCATGGATAGAGG + Intronic
966768270 3:183481511-183481533 CGGGAGAAATGTATGGGTAGGGG - Intergenic
966944332 3:184767287-184767309 GGGGAAGAAAGAATGGAGAGAGG + Intergenic
967199820 3:187063137-187063159 AGGGAGAAACCAGTTGATAGAGG + Intronic
968865693 4:3209802-3209824 GGGAAGAAAAAAATGGATAAGGG - Intronic
968947823 4:3674901-3674923 AGGGAGAAAGGAAGGGACAGAGG - Intergenic
969268506 4:6081979-6082001 GGTGAGAATTGAATGCATAGTGG + Intronic
970099180 4:12501640-12501662 GAGGAGAAATGAATGGGAAGAGG - Intergenic
970949705 4:21740377-21740399 GGGAAGAAAGGAATGAAAAGAGG - Intronic
972369720 4:38411212-38411234 GAGGAGAAAGCAATGAATAGTGG - Intergenic
977248892 4:94666289-94666311 GGGGATAAAAGAATGGCAAGGGG + Exonic
978108004 4:104928117-104928139 GGAGAGAAAGGAAAGGAAAGAGG + Intergenic
979931192 4:126632962-126632984 AGGGAGAAAAGAAGGGAGAGGGG + Intergenic
981649433 4:147039201-147039223 TGGGAGAAACAGTTGGATAGGGG - Intergenic
983047840 4:163007946-163007968 GGGGAGAAGTGAGTGGATACTGG + Intergenic
983518369 4:168679856-168679878 GGGAAGACAAGAATGGATTGTGG + Intronic
983543422 4:168936321-168936343 GGGGAGAAACCAATGCAAAAGGG + Intronic
983609127 4:169623648-169623670 GGGGAAAAAGGAAAGGAGAGAGG - Intronic
985770051 5:1803988-1804010 GGGGAGAAACCGATGGATGTGGG + Intronic
986120574 5:4832081-4832103 AGGGAGAAAGGAAGGGAGAGAGG + Intergenic
986173813 5:5334803-5334825 GGGGTGAGAAGAATGGATAAGGG - Intergenic
986296608 5:6444628-6444650 GGGAAGAAAGGAAGGGAGAGAGG - Intergenic
986376939 5:7141912-7141934 GGGTAGAAAAAAATGTATAGAGG + Intergenic
987037424 5:14032290-14032312 GGGGAGAATCAAGTGGAAAGTGG - Intergenic
988882252 5:35516471-35516493 GGTGAGAAACGAAATGAAAGAGG + Intergenic
990224168 5:53630983-53631005 GGGGAGAAACCAGTGCATAAAGG - Intronic
992709897 5:79441470-79441492 GGGGAGAAAGAAAGGGATAGAGG + Intronic
996583530 5:125058529-125058551 GGGAAGAAAGGACTGGAAAGGGG + Intergenic
998386204 5:141758453-141758475 GAAGAGAAACGGATGGGTAGAGG + Intergenic
1000926228 5:167197955-167197977 GGGGAGAAAAGAAAGGAGAAAGG + Intergenic
1001151392 5:169231355-169231377 GGGGAGTTGCGAATGGAGAGGGG - Intronic
1001919388 5:175588557-175588579 GGGGAGAAAGGAAGGGAGGGAGG + Intergenic
1006667727 6:35708636-35708658 GGGAAGAGAAGAATGGATACTGG - Intronic
1007367112 6:41402685-41402707 GTGGAGAAATGACTGGATAGAGG - Intergenic
1008349285 6:50470949-50470971 GAGGAGAAAAGATTGGAAAGGGG + Intergenic
1010746948 6:79574295-79574317 GGGGAGAAACTAATGGAATGAGG + Intergenic
1011709994 6:90043462-90043484 GGGAAGAAAGGAAAGGAAAGGGG - Intronic
1012002197 6:93666869-93666891 GGGGAATACTGAATGGATAGTGG + Intergenic
1012823198 6:104115138-104115160 GGGCAGAAAGCAAGGGATAGAGG + Intergenic
1013195166 6:107838323-107838345 GGGGAGAAAGGGAGGGTTAGTGG - Intergenic
1014382424 6:120758964-120758986 GGGAAGAGAGGAATGGATGGAGG + Intergenic
1014433843 6:121399940-121399962 GGGGAGAAAAGAATGGAAACCGG - Intergenic
1014878757 6:126695151-126695173 CGGGAGAAAGGAAAGGATGGAGG - Intergenic
1016317762 6:142808721-142808743 GGGGAGGGATGAATGGATGGGGG + Intronic
1017505439 6:155064867-155064889 GGGGAGAAAGGAAGGGAAAAGGG - Intronic
1018866007 6:167747667-167747689 AGGGAGAAAGGAAGGGAGAGAGG + Intergenic
1018932617 6:168251472-168251494 GAGGAGAAGAGAATGGAAAGGGG - Intergenic
1019158265 6:170052917-170052939 AGGGAGAAAGGGAGGGATAGAGG - Intergenic
1020821937 7:12981106-12981128 GGGGAGAAGGGAAAGGATATTGG - Intergenic
1022312970 7:29214603-29214625 GGCCAGAAACTAATTGATAGGGG + Intronic
1024487456 7:49934304-49934326 GGGGAGAAGTGAATTGATATTGG + Intronic
1025307729 7:57879241-57879263 GGGGAGAAAGGAAGGGAGGGAGG - Intergenic
1025771181 7:64509036-64509058 GGGAAGAAACAAATGGAGAGGGG - Intergenic
1026734283 7:72939595-72939617 AGGGACTAACGATTGGATAGAGG + Intronic
1026784616 7:73294501-73294523 GGGGGCTAACGATTGGATAGAGG + Intergenic
1026955005 7:74371564-74371586 GGGGAGACAGGAAGGGAGAGAGG + Intronic
1027109454 7:75425427-75425449 GGGGGCTAACGATTGGATAGAGG - Intronic
1027431559 7:78119154-78119176 GGGGAGGGAGGAATGAATAGTGG + Intronic
1028163504 7:87511894-87511916 GGGGAGAAAGGAAAGGTAAGGGG + Intronic
1029097759 7:98102620-98102642 GGGGAGAGAAGAATGGAAATAGG + Intergenic
1030898318 7:115089247-115089269 GGGGAGAAACGAGTGGAGAGGGG - Intergenic
1031964534 7:128018178-128018200 GAGGAGAAACAAATTGATATAGG + Intronic
1032262317 7:130347389-130347411 GGGGAGAAAGGAATAGACACAGG - Intronic
1032591783 7:133198787-133198809 GAGGAGGAACGAAAGGATTGTGG - Intergenic
1035058663 7:156053112-156053134 GGGTAGACACTCATGGATAGGGG + Intergenic
1035058681 7:156053191-156053213 GGGTAGACACTCATGGATAGGGG + Intergenic
1035543984 8:465024-465046 GGGGAGAAAAGAATAGAATGAGG - Intronic
1035985703 8:4429622-4429644 AGAGAGAAACGAATGCACAGAGG + Intronic
1037045704 8:14300349-14300371 GGGGAGAAAGGAAGGAAGAGAGG + Intronic
1037383039 8:18308702-18308724 GGGGAGAAGGGAATGGGGAGTGG + Intergenic
1037668113 8:20989433-20989455 GGGGAGGTAGGAATGGTTAGTGG - Intergenic
1038961762 8:32527907-32527929 GGGGAGAAGCGGTTGGATAATGG - Intronic
1039918289 8:41875597-41875619 GAGGAGAAACGAATGGCCATGGG - Intronic
1041263971 8:56046071-56046093 GGAGAAAAACGAAGGGATTGCGG - Intergenic
1041475350 8:58259288-58259310 GGGGAGAAATGCAAGAATAGTGG + Intergenic
1045901444 8:107285958-107285980 AGGTAGAAAGGAAAGGATAGAGG + Intronic
1046392169 8:113588825-113588847 GGGGAGAAAGGAGAGGATAAGGG + Intergenic
1046512961 8:115222010-115222032 GTGGAGAAACCAGTGGAAAGGGG - Intergenic
1047473717 8:125204782-125204804 GGGCAGAAAGTAATGGAGAGGGG - Intronic
1048348986 8:133600485-133600507 GGGAAGGAAAGAAGGGATAGAGG + Intergenic
1050290264 9:4147088-4147110 GGGAAGAAATGAATGGCCAGAGG - Intronic
1050308935 9:4333368-4333390 GGGAAGAAAGGAAGGGAGAGAGG + Intronic
1056308166 9:85311983-85312005 TGGGAGAAACAAATGGATGGTGG - Intergenic
1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG + Intergenic
1058298279 9:103336750-103336772 GGGGAAAAACGAAAGGAGGGAGG - Intergenic
1058345014 9:103950842-103950864 GGGAAGAAAGGAAGGGATGGAGG + Intergenic
1058640575 9:107079730-107079752 GGGGAGAGAGGAAGGGAGAGAGG + Intergenic
1058997845 9:110317346-110317368 GGGGAGAAGTGAAGGGATATAGG - Intronic
1059104275 9:111498293-111498315 GGGGAGAGAAGAATGGAAACAGG - Intergenic
1060023739 9:120153764-120153786 GGGGAGAAAGGGAGGCATAGAGG - Intergenic
1060032334 9:120225827-120225849 GGGGTGAGATGAATGGGTAGAGG - Intergenic
1061133940 9:128722890-128722912 AGGGAGGAAGGAATGGACAGGGG + Intronic
1061852628 9:133424837-133424859 GGGGACAAGAGAATGGAGAGAGG - Intronic
1062185752 9:135217626-135217648 GGGGAGGAAAGAAGGGAGAGAGG - Intergenic
1062628069 9:137451967-137451989 GGGGGGAAACGAAGGGGAAGAGG - Intronic
1185861682 X:3585206-3585228 AGGGAGAAACCAAGAGATAGTGG - Intergenic
1185918134 X:4058887-4058909 AGGGAGGAACAAAGGGATAGAGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1187357475 X:18590538-18590560 TGGGCGAAATGAATGGACAGAGG + Intronic
1188073601 X:25748317-25748339 CTGGAGAAAGGACTGGATAGAGG - Intergenic
1189053144 X:37667873-37667895 GGGGAGAGAAGAAGGGAGAGAGG + Intronic
1189245919 X:39563451-39563473 GAGGAGAAAGGAATGGATAAGGG + Intergenic
1193654296 X:84180821-84180843 GGGGAGATAGCAATGTATAGAGG + Intronic
1195037884 X:100986710-100986732 GGCGAGAAAAGAAGGGAAAGAGG - Intronic
1199649463 X:149938831-149938853 TGGGAGAAACCAATGGGGAGGGG + Intergenic
1199749175 X:150798310-150798332 GGGGAGAAAGGAAAGGAAAAGGG + Intronic
1201540068 Y:15096500-15096522 GGAGAGAAACAAAGGGAGAGAGG - Intergenic
1201550137 Y:15210522-15210544 GGGGAGAGAGGAAGGGAGAGAGG + Intergenic
1201979239 Y:19890065-19890087 GGGGAGAAACCAGTGCAAAGAGG - Intergenic