ID: 918269127

View in Genome Browser
Species Human (GRCh38)
Location 1:182879202-182879224
Sequence CTGTGTATACACAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918269123_918269127 11 Left 918269123 1:182879168-182879190 CCTGATTACCTTGCTGCAAAAAG 0: 1
1: 0
2: 1
3: 9
4: 151
Right 918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG 0: 1
1: 0
2: 0
3: 44
4: 324
918269124_918269127 3 Left 918269124 1:182879176-182879198 CCTTGCTGCAAAAAGTTTATTAA 0: 1
1: 0
2: 1
3: 26
4: 323
Right 918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG 0: 1
1: 0
2: 0
3: 44
4: 324
918269122_918269127 12 Left 918269122 1:182879167-182879189 CCCTGATTACCTTGCTGCAAAAA 0: 1
1: 1
2: 2
3: 18
4: 242
Right 918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG 0: 1
1: 0
2: 0
3: 44
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918269127 Original CRISPR CTGTGTATACACAAGGAGGA TGG Intronic
902568186 1:17329209-17329231 CTGTGTATACAGGAGGCTGAGGG + Intronic
903684871 1:25123639-25123661 CTGCTTATCCACAGGGAGGAGGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
904873865 1:33638523-33638545 TCGTGTTTACACAAGGAGGCTGG - Intronic
904882260 1:33709870-33709892 CTGTGGATTCACGAGGAGGAGGG + Intronic
905266998 1:36761186-36761208 CTCTGTTTACACACAGAGGAGGG + Intergenic
905350178 1:37340117-37340139 CTGTGTCTTCACATGGTGGAAGG - Intergenic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
907626911 1:56039568-56039590 CTGTGTCTTCACAAGGTGAAAGG + Intergenic
907695345 1:56721073-56721095 CTGTGAATACAAAAGGAGACTGG - Intronic
908089597 1:60671819-60671841 CTGTGTCTTCACATGGTGGAAGG - Intergenic
908850527 1:68371451-68371473 CTGTCTATCGACCAGGAGGAGGG - Intergenic
909645012 1:77907228-77907250 CTGTGTTAACACAAGGATAAAGG - Intronic
910567109 1:88656644-88656666 CTGTGGACCAACAAGGAGGAAGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
913093640 1:115496633-115496655 CTGAGTTTATACAAGGAGCAAGG - Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
917274380 1:173316171-173316193 CTAAGCATACACAATGAGGAAGG - Intergenic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918313033 1:183300084-183300106 ATGTGTCCTCACAAGGAGGAAGG - Intronic
919462446 1:197894006-197894028 CTGTGTCTTCACAAGGCAGAAGG + Intergenic
919856645 1:201710872-201710894 GTGTGTATTCCCAAAGAGGAAGG - Intronic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
924047537 1:240047274-240047296 CTGTGTCTTCACATGGTGGAAGG - Intronic
1063023557 10:2155023-2155045 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1063195387 10:3736650-3736672 CTGTGTACCCGCAAGGCGGAAGG + Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063802285 10:9594057-9594079 CTGTATCTTCACAAGGGGGAAGG + Intergenic
1064548472 10:16475009-16475031 CTGTGTGTTCACATGGTGGAAGG + Intronic
1065684916 10:28274627-28274649 CTGTGTAAACACTGGGTGGATGG - Intronic
1065813096 10:29460430-29460452 TAGTGAATACACAGGGAGGATGG + Intronic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1071549150 10:86552861-86552883 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1071715571 10:88091976-88091998 CTGTGCAGACACAGGGAAGAAGG - Intergenic
1072036853 10:91570632-91570654 CTGTGTCTTCACAGGGAGAAAGG - Intergenic
1072619558 10:97070660-97070682 CTGTGTCCTCACACGGAGGAAGG - Intronic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1074230925 10:111534167-111534189 CTGTGTGAAAACAAGGAGAAAGG + Intergenic
1074611612 10:115027292-115027314 TTCTGCATACACAATGAGGATGG + Intergenic
1076167007 10:128290749-128290771 CTGTGACTAGATAAGGAGGAAGG + Intergenic
1077737861 11:4810137-4810159 CTCTGTATACAGAAGTAGGAAGG + Intronic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1078455662 11:11472781-11472803 CCTTGTATACAAAATGAGGATGG - Intronic
1079562564 11:21840786-21840808 CTGTGTCTTCACAGGGAGAAAGG - Intergenic
1080837336 11:35951679-35951701 TTGTGTATACACAAAGAGGCAGG - Intronic
1080991365 11:37539871-37539893 CTGTGTCTTCACATGGAGGGAGG - Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1081759064 11:45564440-45564462 GTGTGTATACACCAGGGGGCTGG + Intergenic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1085170143 11:74442837-74442859 CTGTGTATACACTAGTAAAAAGG + Intergenic
1086744733 11:90410842-90410864 CTGTGTTTTCACATGGTGGAAGG + Intergenic
1087087009 11:94230071-94230093 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1087213013 11:95462223-95462245 CTTGGTCTACACAAAGAGGATGG - Intergenic
1087477721 11:98657977-98657999 CTGTGTATTCACATGGTGGATGG - Intergenic
1087494933 11:98879543-98879565 CTGTGTATTCACAAGGCAAAAGG + Intergenic
1087570443 11:99920694-99920716 CTGTGTACTCACATGGTGGAAGG + Intronic
1088019139 11:105098105-105098127 CTATGTATACATATGGAAGAAGG + Intronic
1088314480 11:108493904-108493926 CTATGTAGACAAAAGGAGGTTGG + Intronic
1088823944 11:113477993-113478015 CTGTGTTCACACATGGTGGAAGG + Intergenic
1090788076 11:130068134-130068156 CTGTGTTCGCACATGGAGGAGGG + Intergenic
1091120194 11:133051038-133051060 GTATGTACACACATGGAGGAGGG - Intronic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1092250407 12:6891914-6891936 CTGTGAATACTCTGGGAGGATGG + Intronic
1093558455 12:20507888-20507910 TTGTGAATACACAGTGAGGAAGG - Intronic
1094214266 12:27923748-27923770 AAGTGTATTCACAAGGAAGATGG + Intergenic
1094590962 12:31819860-31819882 TTGTGTTTACACAAGAAAGAGGG + Intergenic
1094753435 12:33439500-33439522 ATGAGTTTCCACAAGGAGGACGG - Exonic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096775789 12:53963275-53963297 CTGGGTCTACACAAGTAGCAGGG + Intergenic
1097996082 12:65888990-65889012 CTGTGTCCACACTAGGAGGAAGG + Intronic
1099903128 12:88737103-88737125 TGGTGTCTACAAAAGGAGGAAGG - Intergenic
1100057281 12:90527243-90527265 CTTTTTATTCACAAGGAGTATGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100593684 12:96053406-96053428 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1103277746 12:119727437-119727459 CTGTGGATTCAGAAGGGGGAAGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104873672 12:132018051-132018073 CTGTGTATTGGCACGGAGGAGGG + Intronic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1106933478 13:34692535-34692557 CTGTGTCCTCACAAGGAGGCAGG + Intergenic
1106999352 13:35525834-35525856 CTGTGTCTTCACATGGTGGAAGG + Intronic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1107864007 13:44686062-44686084 CTTTGTCTACTCATGGAGGAAGG + Intergenic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1108836786 13:54560288-54560310 CTATTTATACACAAGTATGAGGG - Intergenic
1109732656 13:66436303-66436325 CTGTGTCTTCACAAGGCAGAAGG - Intronic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1112608044 13:100927336-100927358 CTGAGTATAAACAAGGAAGAGGG + Intergenic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113604398 13:111595156-111595178 CTGTGACTACACTAGGAGGGGGG - Intronic
1116528820 14:45941042-45941064 CTGTGTATTCACATGGTGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117241791 14:53841261-53841283 ATGTGCACACACAAGGAGGCAGG - Intergenic
1119476637 14:74934342-74934364 CTATATACACACAAAGAGGAAGG + Intergenic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1120498908 14:85269687-85269709 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1121853171 14:97242374-97242396 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1122594586 14:102880768-102880790 CTGTGTATCCATAAAAAGGAAGG + Intronic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1124572585 15:30878666-30878688 CTGTGTCCACACATGGTGGAAGG - Intergenic
1124857738 15:33407079-33407101 CTGTGTCTACACGTGGTGGAAGG + Intronic
1127362682 15:58258945-58258967 CTGTGTCTTCACATGGCGGAAGG + Intronic
1127597159 15:60497174-60497196 CTCTGTTTACAACAGGAGGAGGG - Intronic
1128401919 15:67292102-67292124 CTGTGTCTGCACATGGAAGAGGG - Intronic
1128541148 15:68534213-68534235 ATGTGTATGCACAAGGAGGTGGG - Intergenic
1129580471 15:76803667-76803689 CTGTGTCTTCACATGGTGGAGGG + Intronic
1131610652 15:93958000-93958022 CTGTGTTTTCACATGGTGGAAGG + Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1134083160 16:11338425-11338447 CTGTGTCTTCACAAGGTGGAAGG + Intronic
1134879094 16:17728617-17728639 CTGTGTATACACATGAAAGAGGG + Intergenic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135459494 16:22629045-22629067 CTGTGCTTACACAAAGAGGGAGG - Intergenic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138085960 16:54134166-54134188 CTGTTTAAACACAGGGAGGGAGG + Intergenic
1139837360 16:69849991-69850013 CTGGTTATAAACTAGGAGGAAGG + Intronic
1140877142 16:79163172-79163194 CTGTGTATACAAACCTAGGAGGG + Intronic
1140904899 16:79401824-79401846 ATGTGTATCCCCAAGTAGGAAGG + Intergenic
1141261245 16:82455674-82455696 TTATGTATACAGAAGCAGGAAGG - Intergenic
1143057685 17:4174560-4174582 CTGTGTACACACAAGCATGCAGG + Intronic
1144255404 17:13462654-13462676 CTGATTATAAACAAAGAGGAGGG + Intergenic
1146274179 17:31504735-31504757 TTGAGGATAAACAAGGAGGATGG - Intronic
1146785545 17:35717578-35717600 CTCTGTATACACCAGGGGGGAGG - Intronic
1147479149 17:40742434-40742456 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
1149084171 17:52694379-52694401 CTGTGTTTTCACAAGGTGGAAGG - Intergenic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1151512881 17:74572200-74572222 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1152047193 17:77944976-77944998 TTCTGTATACACAAGGGTGAAGG - Intergenic
1152233537 17:79126575-79126597 GGGTGTATAGACAGGGAGGAGGG - Intronic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1155018081 18:21865772-21865794 CTGTGTATACCTACGGATGAGGG + Exonic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156700554 18:39819584-39819606 GTGGGAATACACAAGGAGGTGGG - Intergenic
1157310884 18:46552447-46552469 TGGTGGAAACACAAGGAGGAGGG - Intronic
1158883529 18:61804323-61804345 CTGTGTGTTCACATGGCGGAAGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1165544713 19:36525350-36525372 CTGTGGATATACAAGGAAGCAGG + Exonic
1167289093 19:48614855-48614877 CTGTGTTTACACAAGGGGCCGGG - Intergenic
1167853321 19:52218228-52218250 CTGTGTATAAAAAAGAAAGAAGG - Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1168469590 19:56629548-56629570 CTGTGCCCACACATGGAGGAAGG - Intergenic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
928613731 2:33016181-33016203 CTGTGCAGAGACAAGGAGGTGGG + Intronic
929569855 2:43015608-43015630 CTGTGGAGAGACAATGAGGAAGG + Intergenic
929941207 2:46335457-46335479 CTGGGTATATACAGGAAGGAGGG - Intronic
929941796 2:46339827-46339849 CTGTGTCTCCACATGGTGGAAGG + Intronic
930155169 2:48099278-48099300 CTGTTGATACTCAAGGAGAAGGG - Intergenic
930566662 2:53029027-53029049 CTGTCTATAAACCAGGAAGACGG + Intergenic
932629972 2:73332560-73332582 CTGTGTCTACACAGGCAGGGTGG + Intergenic
933980946 2:87550286-87550308 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935635239 2:105244835-105244857 CTGGGTATAAACAGGGAGGGAGG - Intergenic
935978005 2:108598398-108598420 CTTTGTATAGGCTAGGAGGAAGG + Intronic
936135622 2:109890992-109891014 CTTTGTATAGGCTAGGAGGAAGG + Intergenic
936209075 2:110480493-110480515 CTTTGTATAGGCTAGGAGGAAGG - Intergenic
936312884 2:111400499-111400521 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
937331649 2:121034283-121034305 CTGTCTGTAAACCAGGAGGAGGG - Intergenic
937494180 2:122400505-122400527 CTGTGTCTTCACATGGCGGAAGG - Intergenic
939061372 2:137425607-137425629 TTTGGTATACACAAGGATGATGG + Intronic
940008358 2:149030397-149030419 CTGTGTCCACACATGGTGGAAGG + Intergenic
940799233 2:158115146-158115168 CTGTTTATGCACAAGGAGCTCGG + Exonic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
944132021 2:196357218-196357240 CTCTGTCTGCACAGGGAGGATGG - Intronic
945145463 2:206733470-206733492 CTGTGTCTCCACATGGTGGAAGG - Intergenic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
1169078781 20:2781143-2781165 CTGAGTACAGACAAGGAGGGTGG - Intergenic
1169402589 20:5295624-5295646 CTGTGGAGAAACAAAGAGGATGG - Intergenic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1169944645 20:10975625-10975647 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1170648306 20:18216144-18216166 CTGTCTCTTCACAAGGAGAAGGG - Intergenic
1170975679 20:21161815-21161837 CTGTGTATAAACAATTAGGTGGG - Intronic
1171953072 20:31438760-31438782 CTGTGTATCCACAATGGGCAGGG - Intergenic
1171971440 20:31567368-31567390 CTCTGAATACACAAGGCAGAGGG + Intronic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1174650420 20:52120107-52120129 CTGTGTCCACACATGGTGGAAGG - Intronic
1174945950 20:54985245-54985267 TTGTGTATACACAAATAAGAAGG - Intergenic
1177224183 21:18232453-18232475 CTGTGTCTCCACATGGTGGAAGG + Intronic
1177380192 21:20330812-20330834 CTGAGTATACCCCAGGAAGAAGG - Intergenic
1178608844 21:34062651-34062673 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1178791450 21:35704173-35704195 CTGTGTGAACACAAGAAGGAAGG - Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1183375657 22:37463441-37463463 CTGTGTCTACACAAAGCAGAAGG - Intergenic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
949313220 3:2723544-2723566 CTGTGTCTTCACACGGTGGAAGG + Intronic
949483740 3:4518160-4518182 CTGTGCACAGTCAAGGAGGAGGG - Intronic
949599458 3:5582252-5582274 CTGTGTATACCAAGGGAGAATGG - Intergenic
949764692 3:7513222-7513244 CTGTGAAAACACCAGGAGAAAGG - Intronic
949931533 3:9082388-9082410 CTGTGTCTTCACATGGTGGAAGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951156569 3:19361893-19361915 ATTTGTATACATAAGGAGAAAGG + Intronic
953767343 3:45753685-45753707 GTGAGTATACACAAAGAAGAGGG - Intergenic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
955165126 3:56503475-56503497 CTGTGTCTTCACATGGTGGAAGG + Intergenic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
958698560 3:97558005-97558027 CTTTGTAGACACAAGATGGAGGG + Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959477492 3:106828867-106828889 CTGTGTTTATACAAAGAGAAAGG - Intergenic
959568011 3:107852535-107852557 CTGTGTATGAACCAGGAAGAGGG + Intergenic
959877046 3:111395378-111395400 CTGTGTCTTCACATGGTGGAAGG - Intronic
960154668 3:114287108-114287130 CTGTGTTTTCACATGGTGGAAGG + Intronic
961175189 3:124829691-124829713 CTGTGTTTCCTCAAGGAGGGAGG - Intronic
962335078 3:134522162-134522184 CTGTTTATTGACAAGGAGAAAGG - Intronic
962977511 3:140458451-140458473 CTGTGTATAGAACAGAAGGATGG + Intronic
963390779 3:144661094-144661116 CTGTGTCTTCACATGGTGGAAGG + Intergenic
963462791 3:145638175-145638197 CTGTGTCTTCACATGGTGGAAGG - Intergenic
964166791 3:153716810-153716832 GTGTGTATGCACAAGGAGGCAGG - Intergenic
964736243 3:159921604-159921626 CTGTGTCCACACATGGTGGAGGG + Intergenic
964885140 3:161473363-161473385 CTGTGTACTCACATGGTGGAAGG + Intergenic
966702959 3:182876664-182876686 CTGTGTCCACACATGGTGGAAGG + Intronic
969128456 4:4972208-4972230 CTGTGTCCACACAGGGTGGAAGG - Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969283472 4:6187574-6187596 CTGTGTTTTCACATGGTGGAAGG - Intronic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
969975249 4:11093067-11093089 CTGTGTTTTCACACGGTGGAAGG - Intergenic
970034681 4:11719756-11719778 CTATGTATACACAAGCAGGCTGG + Intergenic
970207312 4:13667952-13667974 CTGTGTCTCCACATGGTGGAAGG + Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
973298212 4:48550775-48550797 CTCTGTTTAAAAAAGGAGGACGG + Intronic
973576400 4:52294165-52294187 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
974456101 4:62130872-62130894 CTGTGTATATACAAGCAGCTGGG + Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
976437319 4:85033082-85033104 CTGTGTTTTCACAAGGTGGAAGG + Intergenic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
978082299 4:104608334-104608356 CTGAGTATGCACAAGAAGGTGGG - Intergenic
978488081 4:109278945-109278967 CTGTGTTCACACATGGTGGAAGG + Intronic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
980535194 4:134111166-134111188 CTGTGTCTTCACAAGGCAGAAGG + Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
981890560 4:149731300-149731322 CTGTGTCTTCACATGGTGGAAGG - Intergenic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
983031802 4:162811939-162811961 CTGTGTATTCACATGGTGGAAGG + Intergenic
987436994 5:17906587-17906609 CTGTGTCTTCACATGGTGGAAGG - Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
990933872 5:61125630-61125652 CTGTGTATTGACAAGGCAGATGG + Intronic
992181931 5:74205912-74205934 CTGTGTATAAGCCAGGAAGAAGG + Intergenic
992582737 5:78198445-78198467 CTGTCCACACACCAGGAGGAGGG - Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992845108 5:80738914-80738936 GTGTGTCTTCACATGGAGGAGGG - Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
993453863 5:88105088-88105110 CTGTGTATTCACATGGTAGAAGG - Intergenic
993660149 5:90623199-90623221 CATTGTATACACAAGCAGCAAGG - Intronic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994611073 5:102040356-102040378 CTCTATACACACAAGGATGATGG + Intergenic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
996215898 5:120865124-120865146 CTGTGAATACAGAAAGAGAATGG - Intergenic
996226594 5:121006981-121007003 CTGTGTCTTCACAAGTTGGAAGG + Intergenic
997669322 5:135657492-135657514 CTCTGTATACACAAAGAGCAAGG - Intergenic
998065752 5:139156977-139156999 CTGTGTATAGAAAAGGAGCAAGG - Intronic
998171919 5:139877527-139877549 CTGTGGATAAACAAGGAGCCTGG + Intronic
999122212 5:149218279-149218301 CTGTGTCTCCACATGGTGGAAGG + Intronic
1000125994 5:158244784-158244806 CTGATTATACACAAGGATGCAGG + Intergenic
1001652472 5:173325668-173325690 CTGTGTCTACACAGGCAGGGTGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003193033 6:3890843-3890865 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1003201459 6:3965088-3965110 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1005827095 6:29639433-29639455 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1007285535 6:40744758-40744780 CTGTGTGCAGACAAGGAGGCTGG - Intergenic
1007556082 6:42767746-42767768 CTGTGTGTTATCAAGGAGGAAGG + Intronic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008148613 6:47922560-47922582 CTCTGGATCCACATGGAGGAAGG - Intronic
1009634115 6:66241864-66241886 CTTTGTATTCACAATGAGAATGG + Intergenic
1011346282 6:86372519-86372541 CTATGTCTTCACAATGAGGAAGG + Intergenic
1011555588 6:88568883-88568905 CTGTGTCCTTACAAGGAGGAAGG - Intergenic
1016234673 6:141848995-141849017 CAATGTAGAAACAAGGAGGAAGG - Intergenic
1016453647 6:144209614-144209636 ATGTGTACACACAAGGTGGTGGG + Intergenic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017157110 6:151332375-151332397 CTGAATATACCCAAGAAGGAGGG - Intronic
1017210964 6:151855645-151855667 CTGCTTATACACAAGGTGAAAGG + Intronic
1021808951 7:24384015-24384037 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1022898043 7:34772830-34772852 CTGTTTTTACACAATGAGAAAGG - Intronic
1023535413 7:41203559-41203581 CTGTGTCTACATAAGGGGCAAGG + Intergenic
1024674523 7:51626237-51626259 CTGTGAATACACCAAGAGGAAGG + Intergenic
1024945589 7:54804700-54804722 AAGTGCATACACAAGGATGACGG - Intergenic
1026603931 7:71799935-71799957 CTATGTCTACCCAAGGAGAAAGG + Intronic
1027695728 7:81407823-81407845 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1028766770 7:94568802-94568824 CTGTGTCCACACATGGTGGAAGG - Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029804423 7:102981661-102981683 CTGTGTATAAACCAGGAAGTGGG - Intronic
1030627365 7:111858834-111858856 ATGTGTCTATACATGGAGGAAGG - Intronic
1030776811 7:113543663-113543685 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1031199765 7:118666270-118666292 GTGTGTATGCACAAGGAAAAAGG + Intergenic
1031221622 7:118973806-118973828 CTGTCTATAAACCAGGAAGAGGG + Intergenic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1031727083 7:125253255-125253277 CTGTGTATAAGCCAGGAAGAGGG + Intergenic
1032357636 7:131225277-131225299 CTGTGTCTCCACATGGTGGAAGG + Intronic
1032977038 7:137237272-137237294 CTGTCTATAAACCAGGAAGAGGG + Intronic
1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG + Intergenic
1034015315 7:147577512-147577534 CTTTGTATACACAAGTAGAATGG - Intronic
1035399140 7:158553433-158553455 GTGTGTGTAGACAAGGAGGGTGG - Intronic
1035399163 7:158553577-158553599 CTGTGTGTAGACAAGGAGGGTGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038773657 8:30508154-30508176 GTATGTATATACACGGAGGAAGG + Intronic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1038907779 8:31926338-31926360 CTGCTTATTCACAAGCAGGATGG - Intronic
1039214604 8:35256078-35256100 GTGTGTATACACATAGGGGAAGG - Intronic
1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1044431231 8:92109629-92109651 CTCTGCATATAGAAGGAGGATGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045005789 8:97915527-97915549 GTGTAGGTACACAAGGAGGAAGG - Intronic
1045034285 8:98165334-98165356 CACTGTATACACCAGGTGGAGGG + Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1049632520 8:143666337-143666359 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1049632573 8:143666582-143666604 ATGTGTGTGCACACGGAGGAGGG - Intergenic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051713434 9:19956911-19956933 CTGTCTATACACCAGGAAGTAGG + Intergenic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1055824897 9:80311966-80311988 CTGTGTTTGCACATGGCGGAAGG - Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG + Intronic
1057889295 9:98856454-98856476 CTGTTCATACTCAAGGAGAAGGG + Intergenic
1058600093 9:106659884-106659906 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1059469069 9:114490307-114490329 ATGTGAATACACAAGGATAAAGG + Intronic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186211400 X:7253979-7254001 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186242354 X:7583141-7583163 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186313899 X:8348524-8348546 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186451783 X:9680061-9680083 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186798339 X:13067792-13067814 CTGTTTATTCTCAAGGATGAAGG + Intergenic
1186985564 X:15009936-15009958 CTGTGTCTTCACACGGTGGAAGG - Intergenic
1187577745 X:20576297-20576319 CTGAGCATATTCAAGGAGGAGGG + Intergenic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1189068374 X:37836360-37836382 CTGTGTCCTCACAAGGTGGAAGG - Intronic
1189219949 X:39363014-39363036 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1189522638 X:41785806-41785828 CAGCCTATACACAAGGGGGATGG - Intronic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1193322932 X:80145650-80145672 CTGTGTATATTCAAGTAAGATGG - Intergenic
1194979097 X:100422489-100422511 CTGTGTATTCACATGGTAGAAGG - Intergenic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196931674 X:120687830-120687852 CTGTGTCTTCACAAGGTGCAAGG - Intergenic
1197405760 X:126047068-126047090 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1197788425 X:130224228-130224250 CTGTGTCTTCACATGGGGGAAGG - Intronic
1198208486 X:134492763-134492785 GTGTGTGTACACCAGGAGGCAGG + Intronic
1198256490 X:134928433-134928455 CTCTGTATACAAAAGTATGATGG + Intergenic
1199531036 X:148847902-148847924 CTGTGTACACTTCAGGAGGAAGG - Intronic
1199843012 X:151669888-151669910 CTGAGTATACACCAGAAGAAAGG - Intronic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1200783488 Y:7238050-7238072 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1201642506 Y:16194584-16194606 CTGTGGGTGCACTAGGAGGATGG - Intergenic
1201660308 Y:16390736-16390758 CTGTGGGTGCACTAGGAGGATGG + Intergenic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic