ID: 918272776

View in Genome Browser
Species Human (GRCh38)
Location 1:182919446-182919468
Sequence GGGAGGTATTTCAAGAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918272776_918272782 12 Left 918272776 1:182919446-182919468 CCTATCCTCTTGAAATACCTCCC 0: 1
1: 0
2: 0
3: 7
4: 153
Right 918272782 1:182919481-182919503 CTCCCAACTCTGTTGTGTTGAGG 0: 1
1: 1
2: 14
3: 147
4: 600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918272776 Original CRISPR GGGAGGTATTTCAAGAGGAT AGG (reversed) Intronic
901692345 1:10981731-10981753 GGGAAGGATTTCCAGAAGATTGG - Intronic
902359811 1:15936139-15936161 GGGAGCTGTTTCAAGAGTACCGG + Exonic
902467089 1:16625119-16625141 GGGAGGTGCCTCTAGAGGATGGG - Intergenic
902525810 1:17056541-17056563 GGAATGTATTTCTAGAGAATTGG + Intergenic
903775545 1:25791107-25791129 GGAATGTATTTCTAGAGGCTGGG - Intergenic
904913103 1:33950040-33950062 GGAAGGTAATTCAAGAGACTGGG - Intronic
905611206 1:39353375-39353397 AGAAAGTATTTCAAGAGGAGTGG - Intronic
905946369 1:41904594-41904616 GGGAGGTGTTTCTAGAGTCTGGG - Intronic
912952372 1:114128707-114128729 AGGAAGTGTTTCCAGAGGATGGG - Intronic
914954892 1:152153024-152153046 GGGAGGTATTCCATGCTGATGGG + Intergenic
917696858 1:177534113-177534135 GGGAGGCATGTAAAGAGGAGTGG - Intergenic
918272776 1:182919446-182919468 GGGAGGTATTTCAAGAGGATAGG - Intronic
922601269 1:226856371-226856393 GGGATGTCTTTGAAGAGAATGGG - Intergenic
923586765 1:235279995-235280017 GCGATTTATTACAAGAGGATAGG - Intronic
1065837163 10:29669120-29669142 GGGAAGTAGATTAAGAGGATGGG + Intronic
1068410918 10:56653406-56653428 GGGAGCTTTTTGAAGAGGAGGGG + Intergenic
1069084585 10:64124140-64124162 GGGATGTATTTCAAAATAATAGG + Intergenic
1070089799 10:73273163-73273185 GGGAGTTATCGCAAGAAGATTGG + Intronic
1071580423 10:86764168-86764190 GTAATGTATTTCAAGAGTATAGG + Intronic
1071955365 10:90751635-90751657 GGGGGGTGTTTCAATAGGGTAGG + Intronic
1072447838 10:95515107-95515129 GGGAGATAATCCAAGAGAATTGG - Intronic
1072796971 10:98363661-98363683 GGGAGGGCTTACAAGAGTATCGG - Intergenic
1077898299 11:6470608-6470630 GGGATGTAATTCAAGTGGAGAGG + Intronic
1077986140 11:7353201-7353223 GAGAGGCATTGCAAGAGGAACGG + Intronic
1078399782 11:11014886-11014908 GGGAGTTATTTCAAAAACATAGG + Intergenic
1079628808 11:22649068-22649090 GGGACGTATTTCAAAATAATAGG - Intronic
1081657872 11:44869165-44869187 GGGAGGGATTTTAAGGTGATCGG + Intronic
1087419220 11:97899200-97899222 GGGAGATAATTCTACAGGATTGG - Intergenic
1088778558 11:113110848-113110870 GGGAGGTATCCCAATAGGAAAGG - Intronic
1088856808 11:113762991-113763013 GGGAGGGAACTTAAGAGGATGGG - Intronic
1090360773 11:126171262-126171284 GGGAGGTATTGAGAGAGGAAAGG - Intergenic
1096875366 12:54625946-54625968 GGTAGGGATTTCATCAGGATTGG + Intergenic
1102995303 12:117345402-117345424 TGGAGGTATTTCACCAGGAAGGG - Intronic
1109507213 13:63319509-63319531 GGGAGTTCTTTTAAGAGGAAAGG - Intergenic
1109553289 13:63935342-63935364 GGGAGGGAACTTAAGAGGATGGG - Intergenic
1114216397 14:20660643-20660665 GGGAGGAAATGCAGGAGGATAGG + Intergenic
1118451116 14:65903214-65903236 AGGAAGTGTTTCAAAAGGATAGG + Intergenic
1119975237 14:79017506-79017528 GGGAGGTTATTCAAGTGGCTTGG + Intronic
1126445011 15:48732562-48732584 GGGAGGGAACTTAAGAGGATGGG + Intronic
1126884744 15:53137597-53137619 GGGACGTATTTCAAAATAATAGG - Intergenic
1126928217 15:53615541-53615563 GGTTGGAATTCCAAGAGGATTGG - Exonic
1127378520 15:58407390-58407412 GCCAGGTGCTTCAAGAGGATGGG - Intronic
1130198287 15:81801787-81801809 GGGACGTATTTCAAAATAATAGG + Intergenic
1130218738 15:81999021-81999043 GGGACGTATTTCAAAATAATAGG + Intergenic
1130793539 15:87182635-87182657 GGGAGGTATTTAAAGAAAATGGG + Intergenic
1133831351 16:9326330-9326352 GGCAAGTATTTCAAGACCATGGG - Intergenic
1135161256 16:20098455-20098477 TCGAGGAATTTCAACAGGATTGG + Intergenic
1137335789 16:47547309-47547331 GGGAGGGATTACATGAGGTTGGG - Intronic
1138047606 16:53742156-53742178 GGGAGGAATTCCAGGAGGGTGGG + Intronic
1139145646 16:64321570-64321592 GAGAGGAAATTCAAGGGGATTGG + Intergenic
1139825271 16:69752223-69752245 AGAAGGTAAATCAAGAGGATGGG - Exonic
1140232772 16:73131607-73131629 GGGAGGGATATCCAGAGGAGAGG + Intronic
1140697953 16:77553474-77553496 GGCTGGTCTTTCAAGAGCATGGG - Intergenic
1141957574 16:87383197-87383219 GGGAGGTATTTGAGGCGGTTAGG - Intronic
1144801471 17:17931216-17931238 AGGAAGGATTTAAAGAGGATAGG - Intronic
1145956428 17:28858017-28858039 GGGAGGTACTGAAAGAGGGTGGG + Intronic
1146184099 17:30713715-30713737 AGGTGATATTTCAAGAGGGTGGG - Intergenic
1146472484 17:33135574-33135596 GAGAGGTATGACAAGAGGTTGGG + Intronic
1147229097 17:39004145-39004167 GTGAGGAATTTCTAGACGATCGG - Intergenic
1147237869 17:39071092-39071114 GGGACGTATTTCAAGTGCCTAGG - Intronic
1149481838 17:57009820-57009842 GGCAGTTGCTTCAAGAGGATGGG - Intergenic
1151465636 17:74283145-74283167 GGGAGTGACTTCATGAGGATGGG + Intronic
1151679519 17:75616126-75616148 CGGAACTATTTCCAGAGGATGGG + Intergenic
1152975442 18:212688-212710 ATGAGGTATTTCAATATGATAGG + Exonic
1153454848 18:5270024-5270046 CAGAGTAATTTCAAGAGGATTGG - Intergenic
1156966471 18:43100158-43100180 GTGAGGTTTTTCAATAGAATAGG + Intronic
1158251527 18:55493302-55493324 GGGAGGTATTTCATGAAAAAAGG + Intronic
1159229527 18:65588101-65588123 GGGATGTATGTCATTAGGATAGG - Intergenic
1160671815 19:368690-368712 GGGAGCAATTTCAAGAAGAAAGG - Intronic
1162212218 19:9101353-9101375 GGTAGATAGTTCAGGAGGATAGG - Intergenic
1162974683 19:14201966-14201988 AGGTGATATTTCAAGAGGGTGGG + Intronic
1163228148 19:15979480-15979502 GGGAGGTATTTGAGCAGGAGAGG - Intergenic
1166959418 19:46488788-46488810 GGGAGGGATTTGAACAGGAGAGG - Intronic
925663158 2:6224227-6224249 GGAAGGGATTTTAAGAAGATTGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928271610 2:29860050-29860072 GGGGAGAATTTCAAGAGGGTAGG + Intronic
935353638 2:102177889-102177911 GGGAGGTGTTTCAGCAGGAGCGG - Exonic
941028530 2:160485272-160485294 GGGAGGGGTTTCAAGAAGATGGG - Intronic
944194161 2:197035002-197035024 TGGAGGCATTTCCACAGGATTGG + Intronic
946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG + Intronic
948444033 2:238018176-238018198 GGGAGGTGGTTCCAGAGGCTTGG + Intronic
1170777226 20:19386897-19386919 TGGAGGAATTTAAGGAGGATTGG + Intronic
1173321870 20:41995099-41995121 GGGAGTAATTTCAGAAGGATTGG + Intergenic
1173750383 20:45470901-45470923 GGGAGGGACTCCAAGAGGAGAGG - Intronic
1173875598 20:46368729-46368751 AGGTGGCATTTCAATAGGATGGG - Intronic
1175467528 20:59200602-59200624 GGGAGGAATTACAAAAGGATAGG - Intronic
1178137485 21:29643651-29643673 GAGAGGAATTTCATGAGGAAGGG - Intronic
1181935529 22:26435792-26435814 GGTAGGAATTTCAAGAGTAAAGG + Intronic
949425976 3:3916411-3916433 GGGAGGAATGTCAAGCTGATTGG + Intronic
949593856 3:5523326-5523348 TGGAGGAGTTTCAAGAGGATGGG + Intergenic
953669652 3:44951888-44951910 GGGCGGGATTCCAAGAGGAGGGG - Intronic
954015705 3:47688492-47688514 GGAAATTATTTCAAGAAGATTGG + Intronic
955187866 3:56732312-56732334 AGGAGGTCTTTCACGGGGATTGG + Exonic
957847898 3:85762529-85762551 GGGAAGTGTTTCAAGAGGGGAGG - Intronic
959332538 3:105023898-105023920 GGCAGTAATTTCAAGAGGTTGGG + Intergenic
961657246 3:128450003-128450025 GGAGGGTATTTCAAGAAGAAGGG - Intergenic
964935758 3:162084432-162084454 GGGAGGGAGTACAAGAGGAAGGG + Intergenic
965430104 3:168575739-168575761 GGAAAGAATTTGAAGAGGATGGG - Intergenic
969474693 4:7415088-7415110 GGTAGGCATTTCAGGAGGCTGGG + Intronic
971004843 4:22361681-22361703 AGGAGGTAATTAAAGATGATGGG - Intronic
973301649 4:48591700-48591722 GGGAGGTAATACATGATGATAGG - Intronic
975265100 4:72354247-72354269 GGGAGGAATATCAACAGGTTGGG - Intronic
976026276 4:80691533-80691555 GGGACGTATTTCAAAATAATAGG + Intronic
977048589 4:92098104-92098126 GGAAGAAATTTCAAGAGGACTGG + Intergenic
977072822 4:92413627-92413649 GGGAAGGATTCCAAAAGGATGGG + Intronic
977356757 4:95955452-95955474 GGGAGGAAGGTCAAGAGGAGGGG - Intergenic
981771912 4:148320028-148320050 GGGACGTATTTCAAAATAATAGG - Intronic
981951314 4:150411389-150411411 GGTTGTTAATTCAAGAGGATAGG - Intronic
984106377 4:175552389-175552411 TGGAGGTATTTTAGGAGAATAGG + Intergenic
986722019 5:10566252-10566274 AGGAGGCATTGCAAGAGGAATGG - Intronic
987031433 5:13980141-13980163 GGAAGGCATTTCAAGAAGAAGGG - Intergenic
990791645 5:59487304-59487326 GGGAGGAATTTCAAGTTGATAGG + Intronic
990926725 5:61034146-61034168 GTGTTGTATTTCAAGAGGAATGG + Intronic
993657021 5:90590531-90590553 GGCAGGCATTCCAAGAGGACTGG + Intronic
995538741 5:113163593-113163615 GGCAGGGATGTCAAGAGGCTGGG + Intronic
996389384 5:122943432-122943454 GGAAAGTGTTTCAAGAGGACAGG - Intronic
998505438 5:142668455-142668477 GGGAGGGGTGTCAAGAGGATGGG - Intronic
998789428 5:145749980-145750002 GGGAGGGAACTTAAGAGGATGGG + Intronic
999480775 5:151946390-151946412 GAGAAGAATTTAAAGAGGATTGG + Intergenic
999839842 5:155413193-155413215 GGGAGGTTTTTATAGAGCATTGG - Intergenic
1003795715 6:9600719-9600741 GGAAGGCATTTCAAGAGCCTTGG - Intronic
1004235128 6:13868407-13868429 CGGAGGTGAGTCAAGAGGATGGG + Intergenic
1005505598 6:26466607-26466629 GGGAGGGATTTCAGGTGGGTGGG + Intronic
1008328474 6:50216433-50216455 GAGTGGTATTGTAAGAGGATAGG + Intergenic
1014024023 6:116623810-116623832 GGGATGTAATACAAGAGGAGAGG + Intronic
1014082185 6:117300527-117300549 GGGAGGAAGTTGAAGAGGAGAGG + Intronic
1014827083 6:126058858-126058880 CAGTGGTATTTCAAAAGGATAGG + Intergenic
1015584144 6:134758457-134758479 GGCAGGCATTTCAACAGCATGGG + Intergenic
1017044425 6:150334056-150334078 GGGAGGGATATCAAGGGTATGGG - Intergenic
1021007768 7:15421374-15421396 GGGAGCCATTTCAAGAAGCTTGG + Intronic
1022469908 7:30675703-30675725 GGGAGTTATTCCAAGAGTAAGGG - Intronic
1023502771 7:40868291-40868313 GGGAGGTAACTTAAGAGGACAGG - Intergenic
1028673244 7:93428967-93428989 GGGAGTTATTTTAAAAGGACAGG - Intronic
1029580417 7:101433471-101433493 GGGAGGTGTTTCCAGAGGGAGGG + Intronic
1031946706 7:127849600-127849622 GTGAAGTATTTCAGGATGATAGG + Intronic
1033624939 7:143100629-143100651 GGGAGCCATTTCTACAGGATTGG - Intergenic
1039712007 8:40064619-40064641 TGGAAGAATTTCAGGAGGATTGG - Intergenic
1039767283 8:40642711-40642733 GTGAGCTAAGTCAAGAGGATTGG + Intronic
1040627353 8:49164224-49164246 GGGAGGCATTACCAAAGGATAGG - Intergenic
1042452483 8:68964626-68964648 TGTAGATATTTCAAAAGGATAGG - Intergenic
1047580584 8:126210648-126210670 GGGAATTATTTCATTAGGATTGG + Intergenic
1047864956 8:129013016-129013038 GTGAGGGATCTCAACAGGATAGG + Intergenic
1048633652 8:136271805-136271827 GGGATGTAGGCCAAGAGGATGGG + Intergenic
1051701750 9:19831411-19831433 AGGAGGTATTTCATGTGGAAAGG - Intergenic
1053403093 9:37845670-37845692 GGGAGGTATCTCTAGAAGAGGGG - Intronic
1054992358 9:71343881-71343903 TGGAGGTATTTCAAAAGGAATGG + Intronic
1057173809 9:92979657-92979679 TGGAAGAATTTCAGGAGGATTGG + Intronic
1058781408 9:108339761-108339783 GGGAGTGATTTCCAGAGGGTGGG - Intergenic
1058836951 9:108865620-108865642 GGGAGGTGGTTCTGGAGGATGGG + Intergenic
1062234821 9:135502727-135502749 GGCAGGTGTTTCCAGAGCATCGG + Intronic
1185716263 X:2345109-2345131 GGGCAGTATTTCAAGAGGCAGGG - Intronic
1188963897 X:36526969-36526991 GGGAGGGATTGCAAGAGGGAGGG + Intergenic
1190081709 X:47361875-47361897 TGGAGGTATTTGAAGTGGGTGGG - Intergenic
1190527701 X:51344628-51344650 GCCAGGTACTTCAAGATGATGGG + Intergenic
1190544782 X:51514472-51514494 GGGACGTATTTCAAAACAATAGG - Intergenic
1191103970 X:56760856-56760878 GGGTGGGATTTCTTGAGGATAGG - Intergenic
1191111166 X:56803993-56804015 GGGTGGGATTTCTTGAGGATAGG - Intergenic
1194492279 X:94566916-94566938 AGGAGGTATAGCAAGAGGTTGGG - Intergenic
1196236699 X:113289800-113289822 AGGAGGAATTTCAAGTGGGTTGG - Intergenic
1197839256 X:130728056-130728078 GGGAGACATTTCAGGAGGAAGGG + Intronic
1201349338 Y:13022660-13022682 TGGAAGTATTACAAGAGAATAGG - Intergenic