ID: 918275778

View in Genome Browser
Species Human (GRCh38)
Location 1:182952902-182952924
Sequence CCTGAGCCGCGGGCAGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 270}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918275767_918275778 1 Left 918275767 1:182952878-182952900 CCGCCGCCTCTCCCGTGTCCTCG 0: 1
1: 0
2: 1
3: 16
4: 277
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275770_918275778 -5 Left 918275770 1:182952884-182952906 CCTCTCCCGTGTCCTCGGCCTGA 0: 1
1: 0
2: 1
3: 12
4: 192
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275762_918275778 16 Left 918275762 1:182952863-182952885 CCTCCGCCGCCGCCGCCGCCGCC 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275769_918275778 -2 Left 918275769 1:182952881-182952903 CCGCCTCTCCCGTGTCCTCGGCC 0: 1
1: 0
2: 1
3: 26
4: 373
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275771_918275778 -10 Left 918275771 1:182952889-182952911 CCCGTGTCCTCGGCCTGAGCCGC 0: 1
1: 0
2: 0
3: 11
4: 157
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275765_918275778 7 Left 918275765 1:182952872-182952894 CCGCCGCCGCCGCCTCTCCCGTG 0: 1
1: 2
2: 11
3: 157
4: 1201
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275764_918275778 10 Left 918275764 1:182952869-182952891 CCGCCGCCGCCGCCGCCTCTCCC 0: 2
1: 35
2: 339
3: 2305
4: 5300
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275763_918275778 13 Left 918275763 1:182952866-182952888 CCGCCGCCGCCGCCGCCGCCTCT 0: 11
1: 236
2: 1771
3: 2711
4: 5121
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275766_918275778 4 Left 918275766 1:182952875-182952897 CCGCCGCCGCCTCTCCCGTGTCC 0: 1
1: 0
2: 3
3: 44
4: 541
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918275778 Original CRISPR CCTGAGCCGCGGGCAGGCGC TGG Exonic