ID: 918275778

View in Genome Browser
Species Human (GRCh38)
Location 1:182952902-182952924
Sequence CCTGAGCCGCGGGCAGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 270}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918275766_918275778 4 Left 918275766 1:182952875-182952897 CCGCCGCCGCCTCTCCCGTGTCC 0: 1
1: 0
2: 3
3: 44
4: 541
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275763_918275778 13 Left 918275763 1:182952866-182952888 CCGCCGCCGCCGCCGCCGCCTCT 0: 11
1: 236
2: 1771
3: 2711
4: 5121
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275765_918275778 7 Left 918275765 1:182952872-182952894 CCGCCGCCGCCGCCTCTCCCGTG 0: 1
1: 2
2: 11
3: 157
4: 1201
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275769_918275778 -2 Left 918275769 1:182952881-182952903 CCGCCTCTCCCGTGTCCTCGGCC 0: 1
1: 0
2: 1
3: 26
4: 373
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275770_918275778 -5 Left 918275770 1:182952884-182952906 CCTCTCCCGTGTCCTCGGCCTGA 0: 1
1: 0
2: 1
3: 12
4: 192
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275762_918275778 16 Left 918275762 1:182952863-182952885 CCTCCGCCGCCGCCGCCGCCGCC 0: 1025
1: 1397
2: 2293
3: 4170
4: 7329
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275767_918275778 1 Left 918275767 1:182952878-182952900 CCGCCGCCTCTCCCGTGTCCTCG 0: 1
1: 0
2: 1
3: 16
4: 277
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275764_918275778 10 Left 918275764 1:182952869-182952891 CCGCCGCCGCCGCCGCCTCTCCC 0: 2
1: 35
2: 339
3: 2305
4: 5300
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270
918275771_918275778 -10 Left 918275771 1:182952889-182952911 CCCGTGTCCTCGGCCTGAGCCGC 0: 1
1: 0
2: 0
3: 11
4: 157
Right 918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG 0: 1
1: 0
2: 5
3: 29
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918275778 Original CRISPR CCTGAGCCGCGGGCAGGCGC TGG Exonic
900096626 1:942537-942559 CCTGGGCCGGGGGCAGACGCGGG - Exonic
900295631 1:1947752-1947774 GCTGAGCCCGGGGCAGGCTCTGG - Intronic
900382291 1:2391100-2391122 CTTGGGGCGAGGGCAGGCGCAGG - Intronic
900933303 1:5750299-5750321 ACTGAGCAGCGGTCAGCCGCAGG - Intergenic
901629402 1:10640925-10640947 CCTGTGCCTCTGGCAGGAGCTGG - Intronic
901739213 1:11331157-11331179 CCCGAGCCGCTGGCAGGCACTGG + Intergenic
902892138 1:19452171-19452193 GCTGAGTCGGGGGCAGGAGCAGG - Intronic
903950662 1:26994236-26994258 CCTGAGCGGCGGCGTGGCGCAGG + Exonic
904756683 1:32771943-32771965 CCTGAGGAGGGGGCAGGCACTGG - Exonic
906522292 1:46474747-46474769 CCGGAGCCGCAGAGAGGCGCAGG + Intergenic
906640752 1:47439144-47439166 CCCGAGCCTGAGGCAGGCGCAGG - Exonic
912964540 1:114226415-114226437 CCTGAGTTGCAGGCAGGCCCTGG + Intergenic
913323294 1:117605819-117605841 CCTCAGCGGCGGGAAGGGGCGGG - Intergenic
914694824 1:150067624-150067646 CCTGGGCCGCTGCCACGCGCGGG - Exonic
916305178 1:163322119-163322141 CCCAAGGCGCGGGCAGGTGCCGG + Exonic
918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG + Exonic
918355149 1:183700909-183700931 CCTGAGCCCCTGACAGGCCCCGG + Intronic
919981032 1:202643164-202643186 CCTGAGGCGTGGGCGGACGCGGG - Intronic
922526658 1:226309297-226309319 CCTCCTCCCCGGGCAGGCGCGGG - Exonic
1062774682 10:135446-135468 CCTGAGCCGGCGACGGGCGCGGG - Intronic
1062927269 10:1326789-1326811 GCTGGGCCGTGGGGAGGCGCTGG - Intronic
1062927276 10:1326807-1326829 GCTGGGCCGTGGGGAGGCGCTGG - Intronic
1062927283 10:1326825-1326847 GCTGGGCCGTGGGGAGGCGCTGG - Intronic
1062927296 10:1326861-1326883 GCTGTGCCGTGGGGAGGCGCTGG - Intronic
1062927319 10:1326933-1326955 GCTGTGCCGTGGGGAGGCGCTGG - Intronic
1062927331 10:1326969-1326991 GCTGGGCCGTGGGGAGGCGCTGG - Intronic
1062927344 10:1327005-1327027 GCTGTGCCGTGGGGAGGCGCTGG - Intronic
1062927401 10:1327290-1327312 GCTGTGCCGTGGGGAGGCGCTGG - Intronic
1062927415 10:1327362-1327384 GCTGTGCCGTGGGGAGGCGCTGG - Intronic
1062927436 10:1327434-1327456 GCTGGGCCGTGGGGAGGCGCTGG - Intronic
1062927473 10:1327614-1327636 GCTGTGCCGTGGGGAGGCGCTGG - Intronic
1062968215 10:1626437-1626459 CCTGAGGCGTGGGCAGACGTGGG - Intronic
1063009067 10:2004532-2004554 CCTCAGCCGAGGGGAGGCGAAGG + Intergenic
1064462965 10:15552688-15552710 CCTCACCCCCGGGCAGGCCCCGG + Intronic
1065501920 10:26391704-26391726 CCTGCCCCGCTGGAAGGCGCGGG - Intergenic
1066220553 10:33334236-33334258 CCTGAGCCCCGGTCCGGGGCGGG + Intronic
1067572781 10:47384170-47384192 ACAGAGCCGCGAGCGGGCGCGGG - Intronic
1067686123 10:48466783-48466805 CCTGAGGCGAGGGAAGGCCCAGG + Intronic
1067777507 10:49174245-49174267 CCTGAGGCAGGGGCAGGGGCAGG - Intronic
1069818334 10:71212602-71212624 CCGGAGCCGCACGCAGCCGCGGG + Exonic
1071572959 10:86708114-86708136 GCTCAGCCGTGGGCAGGCCCAGG - Intronic
1071598215 10:86943070-86943092 CCGGAGCCAAGTGCAGGCGCTGG - Exonic
1071858329 10:89647793-89647815 CCTGAGCCGCATGCAGGCTGTGG - Intergenic
1073025200 10:100482576-100482598 CCTAAGGCGCGGGCGGGCCCTGG + Exonic
1073110993 10:101062937-101062959 CCTGAGCCGCGGAGAGGTGCCGG + Exonic
1073288103 10:102400389-102400411 CTGGCGCTGCGGGCAGGCGCTGG + Exonic
1075501731 10:122980716-122980738 CCTGGGCCGCGGGGCGGGGCGGG + Intronic
1076137511 10:128055254-128055276 CCTGAGCAGCGAGCAGACGCAGG + Intronic
1076219133 10:128719070-128719092 CCTGAGCCGTGGCCAGGGGCAGG - Intergenic
1076279341 10:129232529-129232551 CCTGCACCCCGGGCAGGGGCAGG - Intergenic
1077081450 11:726242-726264 CCTGGGCCGGGGGCGGGGGCAGG + Intronic
1077888408 11:6402546-6402568 CCTGAGCCGGGGGTAGGGGGTGG - Intronic
1078345140 11:10541185-10541207 CCTGAGTCGCGGCCACCCGCAGG - Exonic
1079413695 11:20213045-20213067 CGTGAGCTGCGTGCAGGGGCGGG + Intergenic
1082025078 11:47565691-47565713 CCTGTTCCGCGGGAAGGTGCCGG + Exonic
1083686641 11:64380488-64380510 GGGGAGCCGCGGGCAGGCACGGG + Intergenic
1083732604 11:64660906-64660928 CCTGAGCCTCAGCCAGGCCCCGG + Exonic
1083764448 11:64835346-64835368 GCTGAGCCGGGAGCAGGAGCGGG - Exonic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1084119870 11:67062730-67062752 CCTGAGTCACGGGCAGGTGTGGG + Intronic
1084129178 11:67119742-67119764 CCCGAGCCCCGGGCCGGCCCCGG - Exonic
1084378736 11:68797002-68797024 CCAGAGCCGCGGGGAAGGGCAGG + Intronic
1084758378 11:71252733-71252755 CCGCAGCCGCGGGCGGGAGCGGG - Intergenic
1085312080 11:75522758-75522780 CCTCAGCTGGGGGCAGGCTCAGG - Intronic
1086064893 11:82733775-82733797 TCTGGGCGGCGGGCAGGAGCTGG - Exonic
1094844360 12:34354946-34354968 CCTGGGCCCCGCGCATGCGCAGG + Intergenic
1097182416 12:57178968-57178990 CATGAGGTGGGGGCAGGCGCAGG - Exonic
1097938475 12:65278828-65278850 CCAGAGCCGCGGCCAGGCAGAGG - Exonic
1099600726 12:84733784-84733806 CCCGACCCGCTGGCAGGCTCTGG + Intergenic
1101089475 12:101270383-101270405 CCTGAGCCGCGGACCGGTACCGG + Intergenic
1101325161 12:103709329-103709351 CAGGAGCAGTGGGCAGGCGCCGG + Intronic
1103415911 12:120741424-120741446 CCTGAGCCCAGGGCAGGGACAGG - Intergenic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1103723306 12:122986037-122986059 CTGGAGCCGGGGGCAGCCGCGGG - Exonic
1104042244 12:125138211-125138233 CCGCAGATGCGGGCAGGCGCCGG - Intronic
1104506448 12:129336797-129336819 CCTGGGCCGAGGGCAGCAGCAGG + Intronic
1105596816 13:21846846-21846868 CCAGAGCAGCAGGCAGGCACTGG - Intergenic
1108363825 13:49691310-49691332 CCTGGGCCGCGGGCAGGGGGCGG - Exonic
1108509041 13:51138100-51138122 CATGAGCTGAGGGCAGGCCCTGG + Intergenic
1110630196 13:77698198-77698220 CCTGGGGCTCGGGCTGGCGCTGG + Intronic
1112330154 13:98471132-98471154 CCTGAGCCGTAGGCAGGAGCAGG + Intronic
1112593760 13:100788879-100788901 CCTTAGCCACCGGCAGGAGCAGG - Intergenic
1113470515 13:110541671-110541693 GCTGAGCCCCAGGCAGGCGAAGG - Intronic
1113874303 13:113584912-113584934 CGGGAGCCGCGGGCGGGAGCCGG + Intronic
1114187372 14:20413213-20413235 CCGGAGCCGCCGGGAGGAGCAGG + Intronic
1115119882 14:29927202-29927224 CCTGCGCCGCGGGGAGGCGCCGG + Intronic
1115511881 14:34145949-34145971 CCTGAGCCCCCGACAGGCCCTGG - Intronic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1121050373 14:90816090-90816112 CCCGAGGCGCGGCCGGGCGCGGG - Intronic
1121776189 14:96592689-96592711 ACTGAGCCGAGGGCCGGCGCGGG - Intergenic
1121776202 14:96592735-96592757 CCTGGGGCGCGCGCATGCGCAGG - Intergenic
1123004373 14:105314435-105314457 CGGGAGCCGCGGGCAAGGGCCGG - Exonic
1124129390 15:26971210-26971232 CTGGAGCCGCGAGCGGGCGCGGG - Intergenic
1124496730 15:30191906-30191928 CCTGAGGCGCGGGCGGACGCGGG - Intergenic
1124746846 15:32346741-32346763 CCTGAGGCGCGGGCGGACGCGGG + Intergenic
1126167081 15:45662798-45662820 GCTGAGCCCAGGGCAGGGGCAGG + Intronic
1129265678 15:74392003-74392025 CCAGAGCCGAGGGCAGAGGCTGG - Intergenic
1129410548 15:75348204-75348226 CCTGACCCGGGGGCGGCCGCGGG + Intronic
1129471644 15:75758783-75758805 CCTGAGACGGGGGCAGGAGTGGG + Intergenic
1129595249 15:76958842-76958864 GCTGAGTGGCGGGCAGGCGAGGG - Intergenic
1129654015 15:77510767-77510789 CCTGAGCCAGGGGCTGGCCCAGG + Intergenic
1130086155 15:80779689-80779711 CCTGTGCCGGGTGGAGGCGCGGG - Intronic
1130685395 15:86032638-86032660 CCTGAGCTGGGGGCTGGGGCAGG - Intergenic
1130960090 15:88653393-88653415 CCTGAGGCTCGGGGAGGGGCTGG + Intronic
1132566413 16:625562-625584 CCTGGGCCCCGGGTAGGCTCTGG + Intronic
1132661047 16:1061655-1061677 CCTGAGCCCCGGGGAGGAGCTGG + Intergenic
1132743902 16:1428856-1428878 CCTGAACCCCAGGCAGCCGCAGG + Intergenic
1133129952 16:3670875-3670897 CCTGTGCCGCGGGCAGGAGCAGG - Intronic
1135016079 16:18926122-18926144 CCTCAGCCCCGGGCCGGAGCGGG - Exonic
1135437263 16:22437298-22437320 CCTCAGCCCCGGGCCGGAGCGGG + Intergenic
1136333169 16:29595047-29595069 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1136447863 16:30335113-30335135 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1137676472 16:50305985-50306007 CCTGGGCGGGGGGCAGGGGCGGG + Intronic
1139364721 16:66426628-66426650 GCTGGGCCGCTGGCAGGGGCAGG - Intergenic
1139390628 16:66604839-66604861 CGGGAGCCGCCGGCAGGCTCGGG - Exonic
1139715097 16:68806779-68806801 CCTGCGCCAAGGGCAGGCTCTGG - Intronic
1140156018 16:72427439-72427461 GCTGAGCCAGGGGCAGGCGCTGG + Intergenic
1141203098 16:81912612-81912634 CCTGAGCCGCGGAGAGGCAGAGG + Exonic
1141624533 16:85254310-85254332 CCTGGGCTGAGGGCAGGGGCAGG - Intergenic
1142136860 16:88455543-88455565 CCAGGGCAGCGGGCAGGCACAGG - Intronic
1142395671 16:89829810-89829832 CCTGAGGCGCAGGCTTGCGCTGG + Intronic
1143112185 17:4558947-4558969 GCAGAGCCGCGGGCAGCCCCAGG + Exonic
1143634464 17:8156436-8156458 CCCGTGCCGCGTGCAGCCGCCGG + Intronic
1144674979 17:17156203-17156225 CCTGAGCTGTGTGCAGGCACAGG - Intronic
1144764452 17:17725041-17725063 CCTGGGCCTCGGGCAGGGGGAGG + Intronic
1146100059 17:29972572-29972594 CCTGAGCCGGGCGCAAGAGCAGG - Intronic
1146171657 17:30639135-30639157 CCTGAGCCCCGGGGAGGCTGAGG - Intergenic
1146439041 17:32877279-32877301 CCTGGGCGGCGCGCACGCGCGGG + Intergenic
1148741374 17:49894964-49894986 CCTGAGCTGCTGGCACGAGCTGG + Intergenic
1149622959 17:58059985-58060007 CCTGTGCTGCGGGCAGGCTATGG + Intergenic
1150336119 17:64331985-64332007 CCTGGACCTCGGGCAGGCTCAGG + Intronic
1151332662 17:73420075-73420097 GCTGAGCCCCAGGCAGGAGCAGG + Intronic
1151715208 17:75827679-75827701 TCTGAGAGGCGGGCAGGGGCAGG + Exonic
1151779448 17:76234020-76234042 CCTCAGCCTCTGGCAGCCGCAGG + Intronic
1151791352 17:76307767-76307789 CCTTGGGCGCGGGCAGGTGCGGG + Intergenic
1152654824 17:81514645-81514667 CCTGAGCCGCGGGGAGGGGCGGG + Intronic
1153382637 18:4455489-4455511 CCCAGGCCGCGGGGAGGCGCCGG + Intergenic
1156088782 18:33440686-33440708 CCGGAGGGGTGGGCAGGCGCGGG - Exonic
1156487853 18:37477934-37477956 CCTGAGCAGAGGGCAGGGGTGGG + Intronic
1157856620 18:51110448-51110470 CCCCAGCCCGGGGCAGGCGCTGG - Intergenic
1160192020 18:76722503-76722525 CCTGAGCCTGGGGCAGGACCAGG + Intergenic
1160613844 18:80109358-80109380 GCGGAGGCGCGGGCGGGCGCAGG + Exonic
1160691054 19:460846-460868 CCTGGGCCGCGGCCCGGCGGCGG - Exonic
1160830413 19:1102095-1102117 CCTGAGTCGGGGGCAGTGGCGGG + Intergenic
1160836771 19:1128287-1128309 CCTGTGCCGGAGGCAGGGGCGGG + Intronic
1160932876 19:1578820-1578842 GCTGAGCCCCGGGGAGGCTCAGG - Intronic
1161050926 19:2163850-2163872 GCTGGGCGGCGGGCACGCGCCGG + Intronic
1161484956 19:4530443-4530465 CCTGAGCCGATGACAGGCGGGGG - Intronic
1161960930 19:7522760-7522782 CCTGAGCCGCGCGGACCCGCCGG - Exonic
1162413095 19:10517994-10518016 CCTGAGCCGGGGGCGGGAGCGGG - Intergenic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1163361072 19:16846780-16846802 CCTGAGCCCCGGCCATGGGCAGG - Intronic
1164520272 19:28973577-28973599 CCAGAGCCAGGGGCAGGAGCTGG - Intergenic
1165046409 19:33108328-33108350 CCTGAAAGGCGGGCAGGGGCGGG - Intronic
1165157364 19:33796562-33796584 GCTGGGCCGCGGCGAGGCGCTGG + Intronic
1165922464 19:39307615-39307637 TGTGAGCGGCGGGCGGGCGCCGG - Exonic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1167681926 19:50928814-50928836 CCTGAGCTGGGGGCTGGAGCAGG + Intergenic
924987733 2:287613-287635 CCTGGGCCGCGCGGAGGCGGCGG - Exonic
925998549 2:9311743-9311765 CCTGAGTGGCGGGCAGGCTCTGG - Intronic
927513269 2:23657843-23657865 CCTGAGGCTCTGGCAGGAGCAGG + Intronic
928399976 2:30970820-30970842 CCTGAGCTGTGAGCAGGGGCAGG - Intronic
929044516 2:37776825-37776847 GCTGAGCAGCTGGCAGGGGCAGG + Intergenic
930177409 2:48314856-48314878 GCTGCGCCGCGGGCTGGGGCGGG - Intronic
932416310 2:71575603-71575625 CCTGAGCACTGGGCAGGGGCTGG + Intronic
932477158 2:72013488-72013510 CCTCAGCCTAGGGCAGGGGCGGG - Intergenic
932567930 2:72921054-72921076 CCTGAGCCCCTGGCCGGCGGCGG + Intronic
932613166 2:73214477-73214499 CCCGGGCCGCGAGCAGGGGCAGG - Intronic
934563524 2:95325292-95325314 CCTGAGCAGCGGGGAGGCTGTGG + Intronic
935127220 2:100235265-100235287 CCTGAGCAGCGGGGAGGCTGTGG - Intergenic
935219772 2:101002401-101002423 CCGGAGCCCCGGGCTGGCTCGGG - Intronic
935332678 2:101988636-101988658 CCTGAGCCACCGGCAGGCAGAGG + Intergenic
935556053 2:104510614-104510636 CCTGACCCCCGGGCAGGCCCCGG - Intergenic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
936161251 2:110085797-110085819 CCTGAGGGGTGGGCAGGAGCTGG - Intronic
936183412 2:110285557-110285579 CCTGAGGGGTGGGCAGGAGCTGG + Intergenic
941935010 2:170975276-170975298 CCTGAGACCCGGGCAGGTGTGGG + Intergenic
944389856 2:199206770-199206792 CCTGAGCAGGCGGCAGGTGCTGG - Intergenic
946235582 2:218322961-218322983 CCTGAGCCCTGGGAAGGGGCAGG - Intronic
946354675 2:219177245-219177267 CCCGACCCGCGGGCAGGAACCGG + Intronic
947745224 2:232503726-232503748 CCTGAGCAGCGGGAACGCTCTGG - Intergenic
1168769822 20:408063-408085 GCAGAGCCGCGGGAAGGAGCTGG - Exonic
1171400710 20:24871682-24871704 CCTGTGCCTGGGGCAGGAGCAGG - Intergenic
1172033013 20:31994982-31995004 CCCGAGCCGCCCACAGGCGCAGG - Intronic
1172118228 20:32583955-32583977 CCGGAGCCGCAGCCTGGCGCAGG - Intronic
1172125657 20:32623799-32623821 CCCGAGCAGCGGGCAGGCTAGGG + Intergenic
1172389613 20:34558335-34558357 CCTAAGCCCCGTGAAGGCGCCGG + Intronic
1172603750 20:36200912-36200934 CCTGAGCCTGGAGCAGCCGCAGG + Intronic
1172618777 20:36306619-36306641 CCTGAACCGGGGGACGGCGCTGG + Intronic
1174058399 20:47815369-47815391 CCTGAGTCCAGGGCAGGTGCTGG - Intergenic
1174210637 20:48875391-48875413 GCTGAGCAGCTGGCAGACGCTGG + Intergenic
1174407200 20:50310172-50310194 CCTGAGCAAAGGGCAGGGGCGGG - Intergenic
1174576670 20:51542319-51542341 CCTGAGCCCCTGGCGGGCTCAGG + Intronic
1174747750 20:53080762-53080784 CCTGGGCCGCGGGCCGGTACAGG - Intronic
1175367655 20:58466998-58467020 CCAGAGCCCTGGGCAGGCCCAGG + Intronic
1175517247 20:59577461-59577483 CCGGGGCCGCGGGGAGGCGCCGG - Intergenic
1175877799 20:62238654-62238676 CCTGGGCCGCGGGCTGGGGCTGG + Intronic
1175918320 20:62437988-62438010 GCTGAGCCCCGGGCAGTCGGTGG - Intergenic
1175961292 20:62637871-62637893 CCAGACCCGCGGGGAGGCTCAGG + Intergenic
1178367529 21:31999682-31999704 CAGGAGCCGGGGGCAGGCCCAGG + Exonic
1178914653 21:36699609-36699631 AGTGGGCCGCGGGCAGGTGCGGG - Exonic
1179522529 21:41954180-41954202 CGCGGCCCGCGGGCAGGCGCCGG - Intergenic
1179675113 21:42975321-42975343 CCTCAGCCGGGCGCCGGCGCGGG + Intronic
1179799332 21:43803586-43803608 CCCGAGGCGCGGGCAGAGGCTGG + Exonic
1179997383 21:44980279-44980301 CCTCAGCCCCGGGCAGGCCCAGG + Intergenic
1180065477 21:45410110-45410132 CCTCCGGCGCGGGCAGGCCCCGG + Intronic
1180087841 21:45516023-45516045 CCTGGGCCGGGGGCTGCCGCGGG + Exonic
1180091155 21:45534405-45534427 CCTGTGCCCCGGCCAGGGGCTGG - Intronic
1180649991 22:17369611-17369633 CAGGAGCCGAGGGCGGGCGCCGG - Exonic
1180879857 22:19196021-19196043 GCTGAGCTGCGGGCAGGGTCAGG - Intronic
1183411760 22:37659073-37659095 CCGGAGGCCCGGGCAGGCGCTGG - Exonic
1184782402 22:46655851-46655873 CCTGAGCCCTGGGGAGGCACCGG + Intronic
1185226492 22:49656613-49656635 CCTGATCACCGGGCAAGCGCGGG - Exonic
1185314706 22:50174069-50174091 CCTCAGCCGAGGCCAGGCCCTGG - Intronic
950030045 3:9846322-9846344 CCTGAGCTGCCGGCAGCCTCTGG + Intronic
950433866 3:12967327-12967349 GCTGAGCGGTGGGCTGGCGCAGG - Intronic
952644520 3:35639445-35639467 CCGGAGCTGCGGGGAGGAGCCGG + Intronic
954628913 3:52037777-52037799 CCTGAGCCTGGGGCAGAGGCTGG + Intergenic
955403926 3:58613491-58613513 CCAGAGCAGCAGGCAGGGGCTGG - Intronic
960097060 3:113699021-113699043 CCAGAGCTGCGGGGAGGCCCCGG + Intergenic
960896749 3:122514380-122514402 CCTGCGCCGCGGCCGGGCGGCGG - Intronic
963852347 3:150221411-150221433 CCAGTGCCGCGGGGAGCCGCCGG - Intergenic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
967840234 3:193999141-193999163 CCTTTGCTGCGGGCAGGCTCCGG + Intergenic
968512872 4:1003136-1003158 CCTCAGCCGCGCGCATGCGCCGG - Exonic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968591910 4:1463767-1463789 CCTGTGCTGTGGGCAGGCCCTGG + Intergenic
968640411 4:1711930-1711952 GCAGAGCCGACGGCAGGCGCTGG - Exonic
968724820 4:2241905-2241927 CCTGATCCCCGGGCAGCTGCTGG + Intronic
968755188 4:2412046-2412068 CCTGGGGCGCAGGCAGGGGCAGG + Intronic
971119164 4:23684914-23684936 CCTGTGCTGCGGGCAGCCACTGG + Intergenic
974075384 4:57164106-57164128 CATGAGCGGCTGGCAGGCGCGGG - Intergenic
977809815 4:101346467-101346489 GCTGAGCCGCGGGGAGGTGGCGG - Intronic
981615588 4:146640163-146640185 CCTGAGTCCCGGGCTGGCCCTGG + Exonic
984638601 4:182140867-182140889 CTTGACCCGCGGGGAGGCGGTGG + Intergenic
984758400 4:183343971-183343993 CCCCAGCCTCGGGCAGGGGCTGG + Intergenic
984771924 4:183444207-183444229 CTTGAGCCGCCCGCAGCCGCGGG - Intergenic
985896392 5:2751919-2751941 CGCGAGCCGCGGGCTGGGGCCGG - Intergenic
987785607 5:22494396-22494418 CCTGAGCTGCGGGCAGGCTCCGG + Intronic
989097053 5:37791462-37791484 CCTGAGAAGCTGGCAGGCTCTGG - Intergenic
989178879 5:38556715-38556737 CCGGGGCCGGGGGCAGGGGCGGG - Intronic
992910736 5:81393954-81393976 CCGGGGCTGCGGGGAGGCGCGGG - Intronic
994171349 5:96662445-96662467 CCGGGGCCGCGGGGAGGCGGCGG - Exonic
995650240 5:114361637-114361659 CCTTGGCCGGGGGCAGGCTCAGG - Intronic
998134672 5:139668416-139668438 CCTGGGACCCGGGCGGGCGCCGG - Intronic
998231381 5:140363478-140363500 CCTCAGCCGAGGTCAGGCGCGGG - Exonic
998251870 5:140558738-140558760 CTTGAGCCGCAGGCGGGCACGGG + Exonic
999287396 5:150402349-150402371 CCTGAGCAGGGGGCAGGGGAGGG - Intronic
1000302943 5:159972288-159972310 GCTCAGGCGCGGGCAGGCTCAGG - Exonic
1002067437 5:176658985-176659007 CCTGGGCCCCTGACAGGCGCTGG + Exonic
1002302734 5:178266725-178266747 CCTGAGCTGTGAGCAGGAGCAGG - Intronic
1003874242 6:10422495-10422517 CCTGAGCTGCGGTGAGGGGCGGG + Intergenic
1004650276 6:17600962-17600984 CCTGACCCGCGGACAGCTGCCGG + Exonic
1005881100 6:30061602-30061624 CCTGAGCCCCGGGCAGAGGCAGG - Exonic
1006137110 6:31901925-31901947 CCTGGGCAGCGCGCAGGCGCGGG + Exonic
1006230760 6:32584456-32584478 CCTGAGCGGGGTGCGGGCGCTGG + Intronic
1006912243 6:37570981-37571003 CCTGAGCCGGCGGGAGGCTCTGG + Intergenic
1007701920 6:43770787-43770809 GGCGAGCCGCGGGCAGGGGCCGG + Exonic
1007760092 6:44128232-44128254 CCAGAGCCGGGGGCAGCGGCCGG - Intronic
1011194348 6:84766472-84766494 GCTTAGCCGAAGGCAGGCGCCGG + Intergenic
1013330311 6:109094572-109094594 CCTCAGCAGCCGGCCGGCGCCGG + Exonic
1019342942 7:517081-517103 CCCGGCCCGAGGGCAGGCGCGGG + Intronic
1019352484 7:561505-561527 CCTGAGCTGCGTGCAGGCTCCGG + Intronic
1019525430 7:1478471-1478493 CCAGGGCCTCGGCCAGGCGCAGG + Exonic
1019554099 7:1620011-1620033 CCTGAGGCCCGGGCGGGGGCGGG - Intergenic
1019637297 7:2082787-2082809 GCTGGGCCGAGTGCAGGCGCCGG - Intronic
1027050741 7:75019785-75019807 CCTGAGATGCAGGCAGGGGCCGG + Intronic
1027059359 7:75073453-75073475 CCTGCGGCGCGGTCGGGCGCCGG + Exonic
1029055123 7:97733111-97733133 CCTGGGTCGCGGGCAGCAGCGGG + Intronic
1029539045 7:101172402-101172424 CCTTGGCCGCCAGCAGGCGCAGG + Exonic
1032125229 7:129188727-129188749 GCTGGGCCGCGGGCTGGCGCGGG + Intergenic
1032169400 7:129572008-129572030 CCAGAGCCTCGGGCAGTGGCTGG - Intergenic
1032525482 7:132576306-132576328 CGTGTGCCGCGGGCTGGCTCCGG + Intronic
1034383602 7:150720198-150720220 CCTGCACCACGGGCAGCCGCAGG + Exonic
1034917588 7:155053695-155053717 CCTGAGCCCCGGGGAGGCCGAGG - Intergenic
1040340030 8:46435806-46435828 CCGGAGCCGCAGGGAGGCGTGGG - Intergenic
1042190060 8:66177381-66177403 CCTGAGCCGCGGGCCGGTCCCGG - Exonic
1048310855 8:133321534-133321556 CCTGAGCTGGGGGCAGGGTCTGG + Intergenic
1049356340 8:142190589-142190611 CCTGAGCTGCGGCCAGTCGCCGG + Intergenic
1049649981 8:143761304-143761326 CCGGAGCAGCAGGCAGGGGCCGG - Intergenic
1053893988 9:42725399-42725421 CCAGAGGCCCGGGAAGGCGCCGG - Intergenic
1056379146 9:86041563-86041585 CCTAAGGTGAGGGCAGGCGCCGG - Intronic
1056382591 9:86068525-86068547 CCTGAGACCTGGGCAGGGGCAGG - Intronic
1057048246 9:91902429-91902451 CCTGAGGCGTGGGAAGGCCCTGG - Intronic
1057361134 9:94374703-94374725 CCTGACCCGCAGGCCGCCGCGGG + Exonic
1057662227 9:97013461-97013483 CCTGACCCGCAGGCCGCCGCGGG - Exonic
1058696657 9:107564654-107564676 CCTCAGCCTCAGGCAGGCCCAGG - Intergenic
1061208714 9:129178560-129178582 CCTAAGGCGAGGGCAGCCGCGGG - Intergenic
1061212693 9:129202984-129203006 CCTGTCCCCCGGGCAGCCGCTGG + Intergenic
1061759942 9:132843623-132843645 GCTGAACCGCAGGCAGGCCCAGG + Intronic
1061808425 9:133149044-133149066 CCTGCGCCGCGCGCGGGCCCAGG - Intronic
1061959068 9:133978912-133978934 CCTGAGCCTGGGGCTGGCCCCGG + Intronic
1061961767 9:133992347-133992369 CCTGAGCCCCGCGCGCGCGCGGG - Intronic
1062309635 9:135928978-135929000 CCTGGGCTGTGGGCAGGCTCTGG - Intergenic
1062467318 9:136687023-136687045 CCTGGGCCGGCGGCAGGCACAGG - Intronic
1062478961 9:136742743-136742765 CCTGAGCCGGGCGCCGGCTCTGG - Intronic
1062520091 9:136954142-136954164 CCTGGGCTGCAGGCAGGAGCTGG + Exonic
1062658961 9:137618577-137618599 CCTGGGCCGCGGCCTGGCGCGGG - Exonic
1185457665 X:318881-318903 CCTGTGCCGGGGAGAGGCGCTGG - Intergenic
1185642812 X:1597869-1597891 CCAGAGCCCCGGGGAGGGGCAGG + Intronic
1185702702 X:2243139-2243161 CCTCAGCCGCCAGCAGCCGCTGG + Exonic
1186022257 X:5269282-5269304 CCTGGGCCGAGGGCAGGTACTGG - Intergenic
1197707107 X:129641917-129641939 CCTGAGCCGGGGACAGACCCAGG + Intergenic
1197772494 X:130098107-130098129 CCTGAGCCATGGGCAGGCAGGGG + Intronic
1198215587 X:134551143-134551165 CCAGAACCGCGTGCGGGCGCTGG + Intergenic