ID: 918275813

View in Genome Browser
Species Human (GRCh38)
Location 1:182953028-182953050
Sequence CGCTGTCTCCGGGGACACGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918275813_918275823 14 Left 918275813 1:182953028-182953050 CCGCCGTGTCCCCGGAGACAGCG 0: 1
1: 0
2: 0
3: 12
4: 75
Right 918275823 1:182953065-182953087 GCCTCGCCTGTCCGGGCTGATGG 0: 1
1: 0
2: 1
3: 14
4: 123
918275813_918275822 7 Left 918275813 1:182953028-182953050 CCGCCGTGTCCCCGGAGACAGCG 0: 1
1: 0
2: 0
3: 12
4: 75
Right 918275822 1:182953058-182953080 ACTTCTCGCCTCGCCTGTCCGGG 0: 1
1: 0
2: 0
3: 13
4: 77
918275813_918275821 6 Left 918275813 1:182953028-182953050 CCGCCGTGTCCCCGGAGACAGCG 0: 1
1: 0
2: 0
3: 12
4: 75
Right 918275821 1:182953057-182953079 GACTTCTCGCCTCGCCTGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
918275813_918275825 19 Left 918275813 1:182953028-182953050 CCGCCGTGTCCCCGGAGACAGCG 0: 1
1: 0
2: 0
3: 12
4: 75
Right 918275825 1:182953070-182953092 GCCTGTCCGGGCTGATGGTGCGG 0: 1
1: 0
2: 0
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918275813 Original CRISPR CGCTGTCTCCGGGGACACGG CGG (reversed) Exonic
900593801 1:3471447-3471469 CCCTGTCTCCAGGGACAAGGCGG - Intronic
901016809 1:6236465-6236487 CGCTTGATCCGGGGAGACGGAGG + Intergenic
907184874 1:52602124-52602146 CGCTGTTTCCTGGGACAAGAGGG + Intergenic
915531111 1:156502734-156502756 AGCTGTATTTGGGGACACGGTGG - Intergenic
918275813 1:182953028-182953050 CGCTGTCTCCGGGGACACGGCGG - Exonic
921019045 1:211219837-211219859 CGCTGGCTCCGGGGGCACTCTGG - Intergenic
1062814461 10:489534-489556 CGCTGTCACTAGGGAGACGGTGG + Intronic
1063980540 10:11448264-11448286 CGAAGTCTGCTGGGACACGGAGG + Intergenic
1065807647 10:29409741-29409763 CGCTGTCTCTTGGGCCGCGGTGG + Intergenic
1069531843 10:69225539-69225561 CCATGGCTCCGGGGACTCGGGGG - Intronic
1069533685 10:69237690-69237712 CCCTGTCTCCAGGGACAGAGCGG - Intronic
1072524449 10:96259172-96259194 TGCTGTCTCCAGGGACAGAGAGG - Intronic
1074875494 10:117610284-117610306 AAATGTCTCCGGGGACAGGGTGG + Intergenic
1076335616 10:129704533-129704555 CGCTGACCCCGTGGACACTGCGG - Intronic
1076721195 10:132394110-132394132 TGCTGTCTCAGGGGACATAGAGG + Intergenic
1080517184 11:33035297-33035319 TGCTGTCTCAGGGGTCACAGAGG - Intergenic
1080590660 11:33720643-33720665 CGCTGGAACCTGGGACACGGAGG + Intronic
1084390888 11:68876046-68876068 CTCAGTCTCCTGGGACACGGTGG + Intergenic
1084544478 11:69807839-69807861 CGCTGCTTCCGGTGCCACGGTGG - Intergenic
1090660692 11:128879890-128879912 AGCTGTCTCCAGGGACCCTGAGG + Intergenic
1094841654 12:34344915-34344937 CGCTGTTCCCGGGGACCCCGGGG - Intergenic
1096680552 12:53252629-53252651 AGCTGTCTCCTAGGACACTGTGG - Intronic
1104843194 12:131834369-131834391 CGCTGTCTCCAGGGCAACAGAGG - Intronic
1118276157 14:64387920-64387942 CCCAGTCTCTGGGGACGCGGTGG - Intergenic
1119468185 14:74876136-74876158 CGCTGACTCTGGGGACAGTGGGG + Intergenic
1121564028 14:94895268-94895290 GGCTGTCTCCCGGGAAACAGAGG - Intergenic
1122423128 14:101589831-101589853 GGCTGCCTCAGGGGACACAGAGG + Intergenic
1128145313 15:65329535-65329557 CTCTGGCTCCGGGGACCCTGTGG + Exonic
1128497244 15:68205584-68205606 CTCTCTCTCCTGGGACTCGGCGG + Intronic
1129704911 15:77788588-77788610 TGCTGTCTCCAGGGACACAGAGG - Intronic
1131215111 15:90529919-90529941 CGCTGGCTCCGGGGCCGCGGCGG + Intronic
1135182565 16:20288417-20288439 TGCTGTCTCTGAGGACAGGGTGG + Intergenic
1136556135 16:31009080-31009102 CGCTGTCTCTGGGGACAGACAGG - Intronic
1140224357 16:73066474-73066496 CGGTGTCTCCGGGGAGCCGGAGG - Intergenic
1142110153 16:88326996-88327018 AGCTGTCTCCTGGGTCAGGGCGG + Intergenic
1142597300 17:1035815-1035837 GGCTGTCCCCGGGGAGACGTGGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1151255292 17:72871931-72871953 TGCTGTCTCCAGGTACACAGTGG + Intronic
1152521407 17:80858794-80858816 GGCTGTGTGCGGGGACACGCAGG + Intronic
1152564492 17:81094085-81094107 CCCTGGCCCCGGGGACACTGAGG - Intronic
1152601392 17:81264012-81264034 CGCAGTCCCCGAGGACAGGGTGG + Intronic
1154032862 18:10768285-10768307 CGCTGTGTTCAGGGACACGGAGG + Intronic
1154134751 18:11766477-11766499 GGCTGTCTCTGGGGACTCTGGGG - Intronic
1161216229 19:3096172-3096194 CTCTGTAACCCGGGACACGGAGG - Intronic
1162144443 19:8605253-8605275 CGCTGCCTCCGGGGAGGAGGTGG + Exonic
1163444679 19:17339449-17339471 CCCTGGCTCCGGGGACACGATGG - Exonic
925385039 2:3456137-3456159 CGATGACTCAGGGGACAAGGTGG - Intronic
926785094 2:16510623-16510645 CGCTGTCTCCTGGGCCACCAAGG + Intergenic
927685528 2:25168245-25168267 CGCTGTCTCCAGGGAGCCGGCGG - Intronic
934517022 2:94994637-94994659 CCCTCTCCCCGGGAACACGGAGG + Intergenic
936671576 2:114662626-114662648 TGCTCTCTCCGTGGACGCGGTGG - Intronic
941937879 2:171000640-171000662 TGCTGTCTCAGGGGTGACGGGGG + Intronic
942942342 2:181632981-181633003 CTCTTTCTCAGGGGACACAGAGG + Intronic
945245334 2:207711998-207712020 GGCGGTGTCCGGGGACGCGGTGG + Exonic
1172887425 20:38240664-38240686 GGCTTTCTCCGGGGTCACAGAGG + Exonic
1174362985 20:50040137-50040159 CTCAGCCTCCGGGGACAGGGAGG - Intergenic
1176668282 21:9707718-9707740 CAGTGTCTCCGTGGGCACGGTGG - Intergenic
1183614961 22:38938443-38938465 CGATGTCTCCTGGGAGAAGGTGG + Intergenic
1184949747 22:47832878-47832900 GGCTCTCTCTGGGGTCACGGTGG + Intergenic
952380452 3:32800486-32800508 AGCTGTCTGTGGGGAGACGGAGG + Intergenic
954408681 3:50359528-50359550 CGCTGCCGCCGGGGACGCGCAGG - Exonic
954699089 3:52442299-52442321 CTCTGTCTGCGGGGAGAAGGAGG + Exonic
955800138 3:62678033-62678055 AGCTGTCTCCTGGAACAAGGAGG - Intronic
964590604 3:158359579-158359601 AGCTGGCACCGGGAACACGGTGG + Intronic
969226017 4:5798805-5798827 CTCTGTCCCTGGGGACACCGAGG + Intronic
970346608 4:15158938-15158960 GGCTGTTGCGGGGGACACGGTGG - Intergenic
970860745 4:20700270-20700292 CGCTGTCTCTGGCGACAAAGGGG - Intronic
982278351 4:153659397-153659419 CGCTGGCTCCGTGGACAAGGTGG + Intergenic
985406499 4:189643773-189643795 CAGTGTCTCCGTGGGCACGGTGG + Intergenic
986196360 5:5539838-5539860 GACTGCCTCCGGGGACAAGGAGG + Intergenic
991622961 5:68565478-68565500 TGCTGTTTGCGGGGACATGGTGG + Intergenic
991964708 5:72079511-72079533 TGCAGTCCCCGGGGACACGGGGG + Intergenic
996117470 5:119634165-119634187 GGCTGTCTCCTGGGAGACAGAGG + Exonic
1000239300 5:159394558-159394580 CGCTGTCTGTGGGGAAACAGAGG + Intergenic
1003318282 6:5030800-5030822 CGCTGTCTCCAGGGACATCTAGG - Intergenic
1006558269 6:34887870-34887892 CGCTGTGCCCGGGGACCCGGGGG - Exonic
1013507432 6:110814736-110814758 CGCCGTCTCCGAGCACTCGGAGG + Intronic
1032464226 7:132133854-132133876 GGCTGTCTTTGGGGACACTGAGG - Intronic
1033244817 7:139708662-139708684 CTCTGTCTCTGGGGACACTGGGG + Intronic
1034389235 7:150770842-150770864 CGCTTTATCCCGGGAGACGGAGG + Intergenic
1035362721 7:158324207-158324229 CGGTGTCACCGGGGAGAGGGTGG - Intronic
1057792052 9:98130906-98130928 CGCTGTCTCAGGGGTCCAGGAGG + Intronic
1061802729 9:133121080-133121102 CGCTGTTTCCGGGCTCCCGGCGG - Exonic
1186728701 X:12384590-12384612 CGCTGTATCCCTGGACAAGGAGG + Intronic
1187320590 X:18234270-18234292 CGCTAACTCCGGGGACAAGCTGG + Intergenic
1189332558 X:40152667-40152689 CGCTGGCTCCGGGGCCCGGGTGG - Intronic
1192091692 X:68165411-68165433 TGCTGTCTCAGGGAACAGGGAGG + Intronic
1197882170 X:131178246-131178268 AGCTGTCTCTGGGGACTAGGTGG + Intergenic