ID: 918276147

View in Genome Browser
Species Human (GRCh38)
Location 1:182955390-182955412
Sequence CCACTTGGGATTGCGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918276147 Original CRISPR CCACTTGGGATTGCGGCAGA AGG (reversed) Intergenic
900764509 1:4494815-4494837 CCACTTGGGACTTGGGGAGATGG + Intergenic
901023385 1:6266584-6266606 CCATTTGGGGCAGCGGCAGATGG - Intronic
908708647 1:66990610-66990632 TCACTTAGGATTGCAGCAGATGG + Intergenic
910932930 1:92460506-92460528 CTACTTGGGACTGAGGCAGGAGG - Intergenic
912745089 1:112239474-112239496 CCACTGGGGACTCCGGGAGATGG - Intergenic
912919884 1:113855738-113855760 CCTCTTGTGAATGGGGCAGATGG - Intronic
918276147 1:182955390-182955412 CCACTTGGGATTGCGGCAGAAGG - Intergenic
919268637 1:195309023-195309045 CCACATGGGATTGAGGAAGAGGG - Intergenic
922363658 1:224844627-224844649 ACACTTGGGATTGGGACTGAGGG + Intergenic
1069715731 10:70520083-70520105 GGACTTGGGATTGTGCCAGAGGG + Intronic
1069883443 10:71608555-71608577 CCCTTTGGAATTGCTGCAGAGGG + Intronic
1070415803 10:76188159-76188181 CCCCTTTGCATTGCTGCAGAGGG + Intronic
1071104674 10:82080463-82080485 CCACATGGGAAGGTGGCAGAAGG - Intronic
1073835646 10:107438014-107438036 CCCCTTGGGTTTCCAGCAGAGGG - Intergenic
1077130589 11:970423-970445 CCACGTGGGTCTGCTGCAGATGG + Intronic
1077556861 11:3230187-3230209 CCTCTTGGGGTTGGGGGAGAGGG + Intronic
1077605132 11:3604716-3604738 CTACTTGGGACTGAGGCAGGAGG + Intergenic
1081773191 11:45662253-45662275 CCCCTAGGGGTTGAGGCAGATGG - Intronic
1084355446 11:68635303-68635325 ACACTTGGGATTGGGACTGAGGG - Intergenic
1085120620 11:73965248-73965270 CCAGTTGGGAAGGCTGCAGAGGG - Intronic
1085429410 11:76434437-76434459 CTACTTGGGACTGAGGCAGGAGG - Intergenic
1089541652 11:119192986-119193008 CCACTGAGGACTGCAGCAGAGGG - Intronic
1092423893 12:8357550-8357572 CCAGTTGGGATTGCTGGAGCTGG - Intergenic
1095568162 12:43650353-43650375 TCACTTGGGTTTGAGGAAGAGGG + Intergenic
1099735415 12:86562368-86562390 CCACTTGGAATTGGGACAGGTGG + Intronic
1101102840 12:101410988-101411010 GCACTTTGGATTGAGGCGGAAGG + Intergenic
1102519731 12:113470891-113470913 CTGTTTGGGATTGCGGCCGATGG + Intronic
1109233859 13:59791925-59791947 CCACTGGGGATTGCTGTAGTTGG + Intronic
1109778639 13:67078059-67078081 CTACTTGGCATTCCTGCAGATGG + Intronic
1110920857 13:81083023-81083045 ACTCTTGGGATTGCAGCAGAAGG - Intergenic
1113434339 13:110278134-110278156 CCACTTAGAATTGTGGCAGATGG + Intronic
1118772662 14:68952557-68952579 CTACTAGGCATTGCGGCACAGGG - Intronic
1119623658 14:76152084-76152106 CGTCTTGGGGCTGCGGCAGACGG + Intronic
1124079387 15:26477090-26477112 CCATTTAGGCTTGAGGCAGAAGG + Intergenic
1129884123 15:79026759-79026781 CCACTTGGGGTTCCTTCAGAGGG + Intronic
1135275817 16:21111651-21111673 CCACTTGGAATTGAATCAGATGG + Exonic
1139492529 16:67294019-67294041 CCTCTTGGCATTTCGGCATAGGG + Exonic
1141968635 16:87464529-87464551 CCAGTTGTGGTTGTGGCAGACGG - Intronic
1144429609 17:15179196-15179218 CCTCCTGGGTTTGAGGCAGAAGG + Intergenic
1146478556 17:33183135-33183157 ACACTTAGGAGTGGGGCAGATGG - Intronic
1149431233 17:56596596-56596618 CCACTGGGGACTGAGGCGGAGGG - Intergenic
1151962003 17:77410451-77410473 CCATTTTGGAAGGCGGCAGATGG - Intronic
1155332987 18:24736902-24736924 CTACTTGTGCTTGTGGCAGATGG + Intergenic
1164561692 19:29296739-29296761 TCACTTGGGATTGAAGCTGATGG + Intergenic
1165970624 19:39625991-39626013 CAACTGGGGATGGGGGCAGATGG - Intergenic
1165975838 19:39675896-39675918 CAACTGGGGATGGGGGCAGATGG + Intergenic
1166363678 19:42268102-42268124 CCACTAGGCATTGGGGCAGGGGG - Intergenic
1167352802 19:48986162-48986184 CCGGTTGGGATTGCTGCAGTGGG - Intronic
1168214141 19:54912828-54912850 CCACTTGGGAAGGCAGGAGAAGG + Exonic
925995740 2:9291701-9291723 CCACTTGGGAATCAGGCAGAGGG - Intronic
927616746 2:24605648-24605670 CCATTTTGGTTTGTGGCAGAGGG + Intronic
935578147 2:104732154-104732176 CCACTGGGGAGTGGGGCCGAGGG - Intergenic
937717760 2:125053999-125054021 CTACTTGGAATTGAGGGAGAAGG + Intergenic
944598091 2:201280754-201280776 CCAGTTGGTATTACAGCAGAAGG + Intronic
946337527 2:219048568-219048590 CCAGTTGGGTTGGCTGCAGATGG - Intergenic
1169612086 20:7392855-7392877 GCATTTGGGATTTGGGCAGAGGG + Intergenic
1174480326 20:50826723-50826745 GCACTTTGGATTGAGGCAGGAGG + Intronic
1175818843 20:61897646-61897668 CCTCCTGGGACTGGGGCAGAGGG + Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
951978248 3:28538524-28538546 CCACTTTGCATTGCAGCTGAGGG + Intergenic
958820213 3:98964898-98964920 CCACTGGTCATTGAGGCAGATGG - Intergenic
961787429 3:129356134-129356156 CCTCTTAGGAATGCTGCAGATGG + Intergenic
966121793 3:176529708-176529730 CCACTTGGGATAGCAAGAGAGGG + Intergenic
966640057 3:182179592-182179614 CCCCTTGGGATTCCTTCAGAGGG - Intergenic
972221863 4:36965206-36965228 CTACTTGGGATTGGGGAAAAAGG - Intergenic
972728412 4:41767652-41767674 GCAGTTGGGAGTGTGGCAGATGG + Intergenic
981424367 4:144586283-144586305 CCACTGGGGATTGGGGGATAAGG - Intergenic
982254891 4:153442161-153442183 CCACTTGAGAAAGCTGCAGAAGG + Intergenic
998497237 5:142601451-142601473 CCACCTGGGGTAGAGGCAGAGGG + Intronic
1010132073 6:72505982-72506004 ACACTTGGGATCCAGGCAGATGG + Intergenic
1012476478 6:99619233-99619255 CCCGTTGGGAAGGCGGCAGATGG - Intergenic
1016535855 6:145107254-145107276 ACACTTGGGGTTGCGACTGAGGG + Intergenic
1023098581 7:36689465-36689487 CCACTTGAGGATGCAGCAGAAGG - Intronic
1027844650 7:83357134-83357156 TGATTGGGGATTGCGGCAGAGGG - Intergenic
1029864153 7:103607522-103607544 CCACTTTGGATTGAGTCTGAAGG + Intronic
1032344094 7:131104120-131104142 CCACTTGGGATTCCTGCGCATGG - Intergenic
1034817512 7:154185386-154185408 CTACTTGGGATTCAGGGAGATGG + Intronic
1035410979 7:158641468-158641490 CCAATTGGGACTGAGGCAGAAGG + Exonic
1038553116 8:28486716-28486738 CTACTTGGGGTGGGGGCAGAGGG + Intronic
1041780882 8:61577629-61577651 AAACTTGCGATTGTGGCAGAAGG + Intronic
1045384100 8:101654672-101654694 CAACTTAGGATTGAGTCAGAAGG + Intronic
1050311609 9:4358985-4359007 CCAGTTGGGATTGCTGAGGATGG - Intergenic
1053368550 9:37541589-37541611 CCAATTGGGATGGCGGCACTCGG + Exonic
1054900756 9:70367175-70367197 TCACTTTGGTTTGTGGCAGACGG + Intergenic
1059282299 9:113145416-113145438 CAATTAGGGATTGGGGCAGAGGG - Intergenic
1060221768 9:121767880-121767902 CCATTTGGGAATGAGGAAGAGGG + Intronic
1062354813 9:136156938-136156960 CCAGTGGGGACGGCGGCAGAGGG - Intergenic
1190708600 X:53049666-53049688 ACATTTGGGATTGGGGAAGATGG - Intronic
1191055232 X:56233433-56233455 CCACTTGGGGTTTCAGCAGTGGG + Intronic
1191783985 X:64897655-64897677 CCACTTGGTACTGCCCCAGAGGG + Intergenic
1192131444 X:68555329-68555351 CCACTAGGGATTGGGGCACAAGG + Intergenic
1192261350 X:69507312-69507334 TCCCTAGGGATTGGGGCAGAGGG + Intronic
1201473600 Y:14358572-14358594 ACACTTGGGATTGGGACTGAGGG + Intergenic