ID: 918279806

View in Genome Browser
Species Human (GRCh38)
Location 1:182993365-182993387
Sequence GGCTGTCTTCTCTGTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918279806_918279813 17 Left 918279806 1:182993365-182993387 CCAGAGCCACAGAGAAGACAGCC No data
Right 918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG No data
918279806_918279811 5 Left 918279806 1:182993365-182993387 CCAGAGCCACAGAGAAGACAGCC No data
Right 918279811 1:182993393-182993415 TCTTAGTCTTTTCACCTGGATGG No data
918279806_918279810 1 Left 918279806 1:182993365-182993387 CCAGAGCCACAGAGAAGACAGCC No data
Right 918279810 1:182993389-182993411 GGACTCTTAGTCTTTTCACCTGG No data
918279806_918279812 8 Left 918279806 1:182993365-182993387 CCAGAGCCACAGAGAAGACAGCC No data
Right 918279812 1:182993396-182993418 TAGTCTTTTCACCTGGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918279806 Original CRISPR GGCTGTCTTCTCTGTGGCTC TGG (reversed) Intergenic