ID: 918279809 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:182993386-182993408 |
| Sequence | GGTGAAAAGACTAAGAGTCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918279809_918279813 | -4 | Left | 918279809 | 1:182993386-182993408 | CCAGGACTCTTAGTCTTTTCACC | No data | ||
| Right | 918279813 | 1:182993405-182993427 | CACCTGGATGGTGGTTACACAGG | No data | ||||
| 918279809_918279815 | 25 | Left | 918279809 | 1:182993386-182993408 | CCAGGACTCTTAGTCTTTTCACC | No data | ||
| Right | 918279815 | 1:182993434-182993456 | CGCTTTGTAAAAAATTAATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918279809 | Original CRISPR | GGTGAAAAGACTAAGAGTCC TGG (reversed) | Intergenic | ||