ID: 918279809

View in Genome Browser
Species Human (GRCh38)
Location 1:182993386-182993408
Sequence GGTGAAAAGACTAAGAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918279809_918279813 -4 Left 918279809 1:182993386-182993408 CCAGGACTCTTAGTCTTTTCACC No data
Right 918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG No data
918279809_918279815 25 Left 918279809 1:182993386-182993408 CCAGGACTCTTAGTCTTTTCACC No data
Right 918279815 1:182993434-182993456 CGCTTTGTAAAAAATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918279809 Original CRISPR GGTGAAAAGACTAAGAGTCC TGG (reversed) Intergenic