ID: 918279813

View in Genome Browser
Species Human (GRCh38)
Location 1:182993405-182993427
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918279809_918279813 -4 Left 918279809 1:182993386-182993408 CCAGGACTCTTAGTCTTTTCACC No data
Right 918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG No data
918279806_918279813 17 Left 918279806 1:182993365-182993387 CCAGAGCCACAGAGAAGACAGCC No data
Right 918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG No data
918279808_918279813 11 Left 918279808 1:182993371-182993393 CCACAGAGAAGACAGCCAGGACT No data
Right 918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr