ID: 918279814

View in Genome Browser
Species Human (GRCh38)
Location 1:182993407-182993429
Sequence CTCCTGTGTAACCACCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918279814_918279815 4 Left 918279814 1:182993407-182993429 CCTGGATGGTGGTTACACAGGAG No data
Right 918279815 1:182993434-182993456 CGCTTTGTAAAAAATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918279814 Original CRISPR CTCCTGTGTAACCACCATCC AGG (reversed) Intergenic
No off target data available for this crispr