ID: 918285587

View in Genome Browser
Species Human (GRCh38)
Location 1:183051550-183051572
Sequence CAAGCTACTCCAAAGCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 9, 3: 74, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918285587_918285590 20 Left 918285587 1:183051550-183051572 CCACTGAGCTTTGGAGTAGCTTG 0: 1
1: 0
2: 9
3: 74
4: 381
Right 918285590 1:183051593-183051615 GGAACACTTACTGAGTCTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 116
918285587_918285589 19 Left 918285587 1:183051550-183051572 CCACTGAGCTTTGGAGTAGCTTG 0: 1
1: 0
2: 9
3: 74
4: 381
Right 918285589 1:183051592-183051614 TGGAACACTTACTGAGTCTCTGG 0: 1
1: 0
2: 0
3: 18
4: 267
918285587_918285588 -1 Left 918285587 1:183051550-183051572 CCACTGAGCTTTGGAGTAGCTTG 0: 1
1: 0
2: 9
3: 74
4: 381
Right 918285588 1:183051572-183051594 GTTGTGCAGCAGTAGATAACTGG 0: 1
1: 5
2: 18
3: 76
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918285587 Original CRISPR CAAGCTACTCCAAAGCTCAG TGG (reversed) Intronic
902099958 1:13979179-13979201 CAAGAAACTACAAACCTCAGGGG + Intergenic
903759372 1:25687157-25687179 CAAGCTACTCGGAAGCCAAGTGG + Intronic
904206663 1:28859882-28859904 TAACATTCTCCAAAGCTCAGGGG + Intronic
904661254 1:32086956-32086978 CCAGCTACTCGAGAGGTCAGAGG + Intronic
904807576 1:33142608-33142630 CAAGCTTCTCCCAGGGTCAGAGG - Intergenic
904903170 1:33873805-33873827 CATATTACTCCAAAGCTTAGTGG - Intronic
904944724 1:34190845-34190867 CAAACCACCCCAAAGCTTAGTGG + Intronic
904978614 1:34477832-34477854 CTGGCTACTAAAAAGCTCAGAGG + Intergenic
905064871 1:35171986-35172008 CTAGCTACTCCCAAACTCTGGGG + Intergenic
905251547 1:36652063-36652085 CAAACCACTCCAAAACTCAGTGG - Intergenic
905355767 1:37383204-37383226 CAAGCCATTCCAAAACACAGTGG + Intergenic
906220777 1:44077416-44077438 CAAATTACTCCAAAACTCGGTGG + Intergenic
906330664 1:44881445-44881467 CAAGCTTACCCAGAGCTCAGTGG + Intronic
906387017 1:45378683-45378705 CAAGCTACCCCAAAACTTAGTGG - Intronic
907036210 1:51218647-51218669 CAAACTACCCCAAAGCTTAGTGG + Intergenic
907251750 1:53144083-53144105 CAAGCTACTGCAAAGAGCAGGGG - Intergenic
908376506 1:63547584-63547606 AAAACTACCCCAAAACTCAGTGG + Intronic
910112654 1:83699249-83699271 CAAACCACCCCAAAACTCAGTGG - Intergenic
911158719 1:94661230-94661252 CACCCTACTCCAAATCCCAGTGG - Intergenic
911401440 1:97379732-97379754 CATGCAACTCAAAAGTTCAGAGG + Intronic
912513475 1:110203732-110203754 CAAGTTACTCCAAGTCTGAGCGG + Intergenic
913711929 1:121493519-121493541 TAAGCTACCCCAAAGCTTAGTGG + Intergenic
914493769 1:148173566-148173588 CAAATTACTCCAAAACTTAGTGG - Intergenic
914856573 1:151356160-151356182 CAAACTACCCCAAAACTTAGTGG - Intergenic
915854492 1:159367248-159367270 GAAGGTTCTCCAAAGCACAGCGG + Intergenic
916240360 1:162633140-162633162 CTAGCCACCCCAAATCTCAGGGG - Intronic
917487174 1:175465896-175465918 CAAGCTACTCCACACCACTGTGG - Intronic
917595126 1:176521563-176521585 CAAGCTACCTCAAAACTGAGTGG - Intronic
918092283 1:181307996-181308018 CAAACCACCCCAAAACTCAGAGG + Intergenic
918285587 1:183051550-183051572 CAAGCTACTCCAAAGCTCAGTGG - Intronic
918865785 1:189897611-189897633 CAAACTACCCTAAAACTCAGTGG - Intergenic
920025544 1:202991821-202991843 CAAACAACCCCAAATCTCAGTGG - Intergenic
920287675 1:204892323-204892345 CAAGCCACCCCAAAACTTAGTGG + Intronic
922596443 1:226817205-226817227 CAAACTACCCCAAAACTCAGTGG + Intergenic
923733057 1:236572157-236572179 CACGCTACTGAAAAGTTCAGAGG + Intronic
924071897 1:240289050-240289072 CAAGTTACACCAAAGCTTAGGGG - Intronic
924821164 1:247491919-247491941 ACAGCTACTCCCAAGATCAGGGG + Intergenic
1063006155 10:1972513-1972535 CAAGCCACTCCAAAACCCAGTGG + Intergenic
1063313352 10:4977868-4977890 CAAGCTACAGCAAAGCCCATTGG + Exonic
1063557348 10:7093481-7093503 CAAGCAGCCACAAAGCTCAGAGG - Intergenic
1063856809 10:10264350-10264372 CAAACTACACCAGACCTCAGTGG - Intergenic
1064636420 10:17372733-17372755 CAAATTACTCCAAAACTTAGTGG + Intronic
1065019060 10:21487689-21487711 CAAGCCACTCCAAAGCTTAGTGG + Intergenic
1065271100 10:24034752-24034774 CAAGCCTCTGCAAAGGTCAGTGG - Intronic
1065661739 10:28010730-28010752 CAAACTGCCCCAAAACTCAGTGG + Intergenic
1067551507 10:47239675-47239697 CATTCTACTCCAAAACTTAGTGG - Intergenic
1067655963 10:48191453-48191475 CAAACGACCCCAAAGCACAGTGG - Intronic
1067881901 10:50052987-50053009 CAAGCAACTCCAAAGCCTAGTGG - Intergenic
1068753662 10:60625324-60625346 CAAACTATCCCAAAGCACAGTGG - Intronic
1069614112 10:69795647-69795669 CAAACTGCTCCAAAACTTAGTGG - Intergenic
1070176581 10:73975652-73975674 CAAACCACTCCAAAATTCAGTGG - Intergenic
1070339348 10:75482410-75482432 CAAGCTACACCAAAATTCAGTGG - Intronic
1070558773 10:77550231-77550253 CAGCCTACTCCCAAGCCCAGTGG + Intronic
1071371391 10:84955185-84955207 CAAGCCACTCCAAAACTCAGTGG + Intergenic
1071714254 10:88079344-88079366 CAAACCAGTCCAAATCTCAGTGG + Intergenic
1071731112 10:88249425-88249447 CAAATTACCCCAAAACTCAGTGG + Intergenic
1072701276 10:97643099-97643121 CCAGCTACTCGGAAGCTGAGTGG - Intronic
1072855718 10:98943957-98943979 CAGACTACTCCAAAACTGAGTGG - Intronic
1073120878 10:101122045-101122067 AAACCTACTCCAGAGCTGAGTGG + Intronic
1075027258 10:118994488-118994510 CAAGCTACTCAGTACCTCAGAGG - Intergenic
1075518408 10:123128317-123128339 CAAATTACTCCAAAACTTAGTGG + Intergenic
1075594510 10:123718651-123718673 CAAGCTACCCCAAAACTCAGTGG + Intronic
1077596134 11:3533274-3533296 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1078787271 11:14507100-14507122 TAAGCTACCCCAAAACTTAGGGG - Intronic
1078841758 11:15083065-15083087 CAAACTACCCCAAAGCTTAGTGG - Intergenic
1079611707 11:22440569-22440591 ACAGCTAATACAAAGCTCAGAGG + Intergenic
1079673026 11:23190865-23190887 ACAGGAACTCCAAAGCTCAGTGG + Intergenic
1081594043 11:44446947-44446969 CAAGCGGCACCACAGCTCAGCGG - Intergenic
1081649962 11:44817302-44817324 CAAAAGATTCCAAAGCTCAGTGG + Intronic
1081770058 11:45644673-45644695 CAAGTCACTCCAAAACTTAGTGG + Intergenic
1081929540 11:46859201-46859223 CAAGCAACTGCGAAGCTCACGGG - Exonic
1084252041 11:67907262-67907284 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1084820805 11:71688765-71688787 TAAGTCACTCCAAATCTCAGTGG + Intergenic
1085351652 11:75801686-75801708 CAAACTACTTCAGAGCTCAGTGG + Intergenic
1085381340 11:76121924-76121946 CAAGCTGCTCAAAAGCCTAGTGG - Intronic
1085806819 11:79643927-79643949 CAATCAACTCCACAGTTCAGAGG - Intergenic
1086018176 11:82192680-82192702 CAAACTACAGCAAAACTCAGAGG + Intergenic
1086065451 11:82738893-82738915 CAAATTACTCCAAAACTTAGTGG + Intergenic
1086163337 11:83747962-83747984 CAATCTTCTCCACAGCACAGTGG - Intronic
1088048172 11:105478895-105478917 CAAGCTAGTCAAATGGTCAGGGG + Intergenic
1088358867 11:108970530-108970552 CAAACTATGCCAAAGCTTAGTGG - Intergenic
1089082545 11:115788916-115788938 CAAAGTACTCCAAAACTTAGTGG - Intergenic
1089402866 11:118174634-118174656 AAAGCTTCTGCAAAGCTGAGTGG - Intronic
1089617534 11:119703377-119703399 CAGGCATCTCCAGAGCTCAGAGG + Intronic
1090174962 11:124640507-124640529 CAAGCTACCCCAAAACTTAGGGG - Intronic
1090452935 11:126822575-126822597 CAAACTACCCCAAAACTTAGTGG + Intronic
1090489073 11:127141968-127141990 CCAGCAACTCCAAAGCCTAGAGG - Intergenic
1091646484 12:2275823-2275845 CAAGCTTCACCAAAGAACAGAGG - Intronic
1091941132 12:4483387-4483409 CAAACCACTCCAAAACTTAGTGG - Intergenic
1092269539 12:7012319-7012341 CATGCTCCTCCCAATCTCAGCGG + Intronic
1092422307 12:8342054-8342076 CATGTCACTCCAAATCTCAGTGG - Intergenic
1092558947 12:9589125-9589147 CAAATTACTCCAAAGTTTAGTGG - Intergenic
1095807299 12:46333724-46333746 CAAAACACTCCAAATCTCAGTGG - Intergenic
1097959513 12:65518815-65518837 CAAACTACTCCAAAACTTAGTGG - Intergenic
1098233849 12:68399309-68399331 CAAATTACTCCAAAACTTAGTGG - Intergenic
1100350096 12:93773192-93773214 CAAAGAACTCCAAATCTCAGTGG + Intronic
1100691205 12:97040202-97040224 CAAACTACTCCAAAACTTAGTGG + Intergenic
1100755431 12:97746128-97746150 CAAATTACTCCAAAACTTAGTGG - Intergenic
1101329524 12:103746184-103746206 CAGGCTTCTCCCTAGCTCAGTGG + Intronic
1101693885 12:107106528-107106550 CAAGCTACTCCAAAATTGCGTGG - Intergenic
1102657896 12:114498505-114498527 AAAATTACTCCAAAGCTCAGTGG - Intergenic
1102780591 12:115561308-115561330 CAAGCTACTACTATGCACAGAGG + Intergenic
1103912739 12:124361259-124361281 CAGGCTGCTCCAAAGGTCTGAGG - Intronic
1104894339 12:132154411-132154433 CACGCTCCTCCACAGCACAGGGG - Intergenic
1106118199 13:26835522-26835544 CAAGCAACCCCAAAACTCAGAGG + Intergenic
1106186949 13:27418019-27418041 CAAGTTACTCTAAAACGCAGTGG + Intergenic
1106294799 13:28402208-28402230 AATGCTACTCCACAGATCAGTGG - Intronic
1107391164 13:39965708-39965730 AAAATTACTCCAAAACTCAGTGG - Intergenic
1110753538 13:79144794-79144816 CAAACCACTCCAAAACTTAGTGG + Intergenic
1111971712 13:94923738-94923760 CAAACGACTCCAAAACTTAGTGG - Intergenic
1112243951 13:97711190-97711212 CAAGCCACTCAAAATCTCAGTGG - Intergenic
1112450381 13:99502091-99502113 CATCCAACTCCAAAGCTCTGAGG - Intronic
1112784926 13:102941039-102941061 CAAACTACTCCAAAACTCTGTGG - Intergenic
1115123282 14:29962621-29962643 CAAGCTACTCCAAGACTTGGTGG - Intronic
1115146166 14:30228645-30228667 CAAACTACCCCAAAACTCAGTGG + Intergenic
1117648249 14:57875396-57875418 CAAACAACTCCAAACCTTAGTGG + Intronic
1118477569 14:66132665-66132687 CAAATCACTCCAAAGCTTAGTGG + Intergenic
1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG + Intronic
1120909947 14:89657193-89657215 CAAACTATGCCAAAACTCAGTGG - Intergenic
1121509056 14:94498868-94498890 CTAGCTGCCCCAAAGCTTAGGGG - Intronic
1121660214 14:95629490-95629512 CAAATTACTCCAAACCTTAGCGG - Intergenic
1121859861 14:97307445-97307467 CAAGCCACCCCATAACTCAGTGG + Intergenic
1122669640 14:103360519-103360541 CAAACTACCACAAAGCACAGTGG + Intergenic
1124903430 15:33845852-33845874 CAAACCACTCTAAAACTCAGTGG + Intronic
1126317869 15:47390061-47390083 CAAACTACCCCAAAACTCAGTGG + Intronic
1126389405 15:48130308-48130330 CAATCTATTCTAAAGTTCAGAGG + Intronic
1126741529 15:51781414-51781436 CAAATTACTCCAAAACTTAGAGG + Intronic
1126974114 15:54155107-54155129 CAAACCACTCCAAAACTCAGTGG + Intronic
1127909110 15:63401350-63401372 CAAACCACCCCAAAGCTTAGTGG - Intergenic
1128129502 15:65216387-65216409 CAAACCACTCCAAAGCTCTGTGG - Intergenic
1128664197 15:69526392-69526414 CAAACGACCCCAAAACTCAGTGG - Intergenic
1128750104 15:70142712-70142734 CAAGCTCCTCCAAATCGCGGGGG + Intergenic
1129496010 15:75981440-75981462 CATACTACCCCAAAACTCAGTGG - Intronic
1130401335 15:83557484-83557506 CAAACCACTCCAAAATTCAGTGG + Intronic
1130603145 15:85291715-85291737 CAAACTACCCCAAAACTCAGTGG + Intergenic
1131459034 15:92605576-92605598 CTATCTATTCCAAGGCTCAGAGG + Intergenic
1132416271 15:101621213-101621235 CAAATTACCTCAAAGCTCAGTGG - Intergenic
1133146624 16:3791823-3791845 CAAGGTACAGCCAAGCTCAGAGG - Intronic
1133375974 16:5287528-5287550 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1133428867 16:5718409-5718431 CAAACCACACCAAAACTCAGTGG - Intergenic
1133890172 16:9871600-9871622 CCAGCCACTTCATAGCTCAGAGG - Intronic
1134335334 16:13294199-13294221 TAATCTACCCCAAAACTCAGTGG + Intergenic
1134791060 16:16989722-16989744 CAAGCTACATAAAATCTCAGTGG + Intergenic
1135066399 16:19313910-19313932 CAAGCCACCCCAAAACTCAGTGG + Intronic
1135356979 16:21777060-21777082 CAAATTATTCCAAAACTCAGTGG - Intergenic
1135455482 16:22593174-22593196 CAAATTATTCCAAAACTCAGTGG - Intergenic
1135781223 16:25302871-25302893 CAAACTACCCCAAAACTGAGTGG + Intergenic
1135802682 16:25512799-25512821 CACGCTCCTCCAAATCTTAGAGG + Intergenic
1137382267 16:48010472-48010494 ACAGCAACTCCAAATCTCAGTGG + Intergenic
1137909001 16:52356594-52356616 CAAACTGCTCCAAAACTTAGTGG - Intergenic
1138489243 16:57366582-57366604 CAAACACCTCCAAATCTCAGTGG + Intergenic
1139140099 16:64251731-64251753 CAAGCCACTCCACAACTTAGTGG + Intergenic
1139368821 16:66452100-66452122 GAAACTACTCCAAAGCTCCATGG + Intronic
1140294082 16:73690933-73690955 CAAACTACTCCAAACCATAGAGG - Intergenic
1140912226 16:79464695-79464717 CAAGCTACACCATGGGTCAGAGG + Intergenic
1141385242 16:83616506-83616528 CGAGCCACTCCATAGCACAGTGG + Intronic
1142230701 16:88899008-88899030 CAAGCTCCTCTAAAGCTGGGAGG - Intronic
1143707751 17:8711183-8711205 CAATCTACCCCAAAACTGAGTGG - Intergenic
1143967764 17:10769073-10769095 CAAACTATGCCAAAACTCAGTGG - Intergenic
1144580921 17:16458913-16458935 CAAACTACCCCAAAACTTAGTGG - Intronic
1144834077 17:18147899-18147921 CAGGCTACTCCAGAGCTCCAAGG - Intronic
1144941962 17:18948192-18948214 CAACCTCACCCAAAGCTCAGTGG + Intergenic
1144966640 17:19080630-19080652 CAAACCACCCCAAAACTCAGTGG - Intergenic
1144981278 17:19171427-19171449 CAAACCACCCCAAAACTCAGTGG + Intergenic
1144986946 17:19206812-19206834 CAAACCACCCCAAAACTCAGTGG - Intergenic
1145066344 17:19763878-19763900 CAAGCCACTCCAAAACTTAATGG - Intergenic
1145967240 17:28928322-28928344 CAAACTACGCCAAAACTCATTGG - Intronic
1148494273 17:48043294-48043316 CAAGCTATACCAAGGCCCAGAGG - Intergenic
1149578683 17:57732099-57732121 CAAGCTACTTCAAAACTTAATGG + Intergenic
1152201719 17:78951139-78951161 CAAGTTACCCCAAAACTTAGAGG - Intergenic
1152203950 17:78963681-78963703 CAAACTGCTCCAAAACTCGGTGG - Intergenic
1152650871 17:81492042-81492064 CAAATTACTCCAAAACACAGGGG - Intergenic
1153871048 18:9320386-9320408 CAAATTACCCCAAAACTCAGTGG - Intergenic
1153883888 18:9446060-9446082 CAACCTACCCCAAAACACAGTGG - Intergenic
1154343618 18:13524583-13524605 CAAACCACTTCCAAGCTCAGTGG + Intronic
1155726243 18:29087839-29087861 CAAGCCACCCCAAAGCTTAATGG + Intergenic
1156444250 18:37223135-37223157 CAAGCTGCTGCAAAGCTGATGGG + Exonic
1156516045 18:37681516-37681538 CAAACCACACCAAAGCTCAATGG + Intergenic
1157101114 18:44730848-44730870 CAAACTACCCCAAAACTCAGTGG + Intronic
1157643272 18:49239846-49239868 CAAACTACCCCAAAACTTAGTGG - Intronic
1158288598 18:55913313-55913335 CAAAACACTCCAAAACTCAGTGG - Intergenic
1158408887 18:57186888-57186910 CTAGCTACAGCAAAGCTCAATGG - Intergenic
1159081913 18:63744427-63744449 CAAACTACCCCAAACCTTAGTGG + Intergenic
1159482839 18:69012801-69012823 CAAACAACTCCAAATCTCAGTGG - Intronic
1159558302 18:69967776-69967798 CAAACTACCCCAAAGTTTAGTGG + Intergenic
1159955037 18:74513098-74513120 CAAGCTGCTCCTGAGCTGAGGGG - Intronic
1162415304 19:10532659-10532681 CAAACCAGCCCAAAGCTCAGTGG - Intergenic
1164969326 19:32517637-32517659 CAAAGTACTCCAAAACTTAGTGG + Intergenic
1165406926 19:35636736-35636758 CAAGGGACACCAAGGCTCAGAGG + Intronic
1166020052 19:40018942-40018964 CAAACTACTCCAAAACTTAGTGG - Intergenic
1166903049 19:46081126-46081148 CAGGCCACACCAAAGGTCAGGGG + Intergenic
925411947 2:3644866-3644888 CAAATTACCCCAAAACTCAGTGG + Intergenic
926169646 2:10544452-10544474 CCAACTACCTCAAAGCTCAGAGG - Intergenic
927140359 2:20126048-20126070 CAAACCACTCCAAAGCTCAGTGG - Intergenic
927264985 2:21136305-21136327 CTAAATACCCCAAAGCTCAGAGG - Intronic
927370830 2:22353494-22353516 TAAGCTATCCTAAAGCTCAGTGG - Intergenic
927378811 2:22453265-22453287 CAAACAACTCCCAATCTCAGTGG + Intergenic
929264985 2:39908664-39908686 CAAGTTACCCCAAATCTTAGTGG + Intergenic
929802448 2:45115931-45115953 CAAATGACTCCAAAACTCAGTGG + Intergenic
930621155 2:53644835-53644857 AAAGCTCCTCCAAAGCAGAGAGG + Intronic
930747263 2:54897600-54897622 CCAGCCACCCCATAGCTCAGGGG - Intronic
931309307 2:61063811-61063833 CCAGCTACTCCAAGGCTGATGGG - Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932708686 2:74046877-74046899 CAGGCCACTCCTCAGCTCAGAGG + Exonic
932909642 2:75792196-75792218 CAAACCACTCCAAAACTTAGTGG + Intergenic
936339761 2:111620797-111620819 CAAAACACTCCAAAGATCAGTGG + Intergenic
937071103 2:119063983-119064005 CAAACAACTCCAAAAGTCAGTGG - Intergenic
937269881 2:120642711-120642733 CAAACCACTCTAAAACTCAGTGG + Intergenic
937348076 2:121140007-121140029 CAAACCACTTCAAAACTCAGTGG - Intergenic
937527277 2:122786905-122786927 CAAACCACTCCAAAACTCAGTGG - Intergenic
940104363 2:150081669-150081691 CAAACCAATCCAAAACTCAGTGG + Intergenic
940659098 2:156524295-156524317 GAAGCAACACCTAAGCTCAGTGG + Intronic
941219373 2:162756671-162756693 CAAGCTAGTCTAAAGCTCCTGGG + Intronic
941505981 2:166346072-166346094 CAGGTTACTCAAAAGCCCAGAGG - Intronic
942212070 2:173681265-173681287 CAAGCCCCTCCAAAACTTAGTGG + Intergenic
944487021 2:200217700-200217722 CAAGCCACCCCAAAGCTTAGTGG + Intergenic
944727871 2:202489891-202489913 CAAGCCACCCCTAAGCTCAGTGG + Intronic
945666141 2:212745420-212745442 CAACCTACACAAAAGCTTAGAGG + Intergenic
945789044 2:214280653-214280675 CAAGCTTCCTCACAGCTCAGGGG - Intronic
945794805 2:214348845-214348867 CAAACTGCTCCAAAACTTAGAGG - Intronic
946012578 2:216578114-216578136 CAAGCCACTGCAAAACTTAGTGG + Intronic
946303331 2:218839428-218839450 CAAGCTACCCAGAAGCTCTGTGG - Intergenic
946573871 2:221053191-221053213 TGAACTACTCCAAAGCTTAGGGG + Intergenic
946853566 2:223930995-223931017 CAAACTACCTCAAAACTCAGTGG - Intronic
947333595 2:229056317-229056339 CAAGTCACCCCAAAACTCAGTGG - Intronic
947576979 2:231283398-231283420 CAATTTACCCCAAAGCTTAGTGG + Intronic
948547396 2:238742624-238742646 TAAGCCACCCCAAAACTCAGTGG + Intergenic
948678703 2:239615599-239615621 CAAACCACTCCAAAACTTAGTGG - Intergenic
1168797647 20:622212-622234 CAAACTACCCCAAAACTCCGTGG - Intergenic
1168986521 20:2053715-2053737 CAAGCCATTCCAAAGCTCAGTGG + Intergenic
1169248160 20:4040360-4040382 CAAACAACCCCTAAGCTCAGTGG + Intergenic
1169296274 20:4402722-4402744 CATCCTGCTCCAAAGCTCAATGG - Intergenic
1169669064 20:8075099-8075121 CAAACTACGTCAAATCTCAGTGG + Intergenic
1169841258 20:9940448-9940470 CAAAATACCCCAAAGCTTAGTGG + Intergenic
1169854120 20:10084850-10084872 CAAACCACCCCAAATCTCAGTGG - Intergenic
1169869436 20:10235617-10235639 CAAACCACCCCAAAACTCAGTGG + Intronic
1169875931 20:10297098-10297120 CAAACAACTCCAAAACTGAGTGG + Intronic
1170119671 20:12898311-12898333 CAAGCCACCCCAAAACTCTGTGG + Intergenic
1170257774 20:14364243-14364265 CAAGTTACTGCAAAGCTTATAGG + Intronic
1170534385 20:17325590-17325612 CAAGTGTCTCCAAAGCTCAGAGG + Intronic
1170579438 20:17686801-17686823 CAAACCACTCCCAAACTCAGTGG + Intergenic
1170712547 20:18805474-18805496 CAAACCACTTAAAAGCTCAGAGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171345900 20:24466127-24466149 CAAACTACTCTGAAACTCAGTGG - Intergenic
1172959785 20:38790482-38790504 CCAACTACTCCAAAACTTAGAGG - Intergenic
1173505460 20:43583645-43583667 CAAGCAACTCCAAAGCTAGGTGG + Intronic
1174124327 20:48291635-48291657 CAATCGTCTCCAAATCTCAGTGG - Intergenic
1175092458 20:56515788-56515810 CAAGTTAATTCAAAGCCCAGTGG + Intronic
1175459254 20:59138820-59138842 CAAGCCACTCCAAGTCCCAGTGG - Intergenic
1176418507 21:6495083-6495105 ATAGCTACTCAACAGCTCAGAGG + Intergenic
1176667592 21:9701748-9701770 CAAGCAACCCAAAATCTCAGTGG - Intergenic
1178082787 21:29082279-29082301 CAAACCACTCCAAATCTCAGTGG + Intronic
1179342716 21:40527676-40527698 CAAACTACTTCAAAACTTAGTGG - Intronic
1179694000 21:43103405-43103427 ATAGCTACTCAACAGCTCAGAGG + Intronic
1180014303 21:45072771-45072793 CAGGCCACCCCAAACCTCAGAGG - Intergenic
1181007697 22:20021751-20021773 CAGGCTGCTACAAAGCCCAGCGG - Intronic
1182007755 22:26975361-26975383 CCATCTCCTCCAAAGCTCTGAGG - Intergenic
1182016755 22:27046786-27046808 CAAACAACCCCAAAGTTCAGTGG + Intergenic
1182479036 22:30594718-30594740 CCAGCTACTCAGAAGCTGAGTGG + Intronic
1183029292 22:35091260-35091282 CAAACTACCCCAAAACTTAGTGG + Intergenic
1183101537 22:35587164-35587186 CAAGGTACTCCAAAACGTAGTGG - Intergenic
1183496797 22:38150534-38150556 CAAACTACTCCAGAACACAGTGG - Intronic
1183935422 22:41259162-41259184 CCCTCTCCTCCAAAGCTCAGGGG - Intronic
1184725969 22:46346645-46346667 CAAGCTACTCTGGAGCACAGAGG - Intronic
949280451 3:2340832-2340854 CAAACCACCCCAAAACTCAGTGG + Intronic
949308956 3:2674121-2674143 CAAACTACTCCAAAACTGAGCGG - Intronic
950103275 3:10371490-10371512 CAAACTACTCCAAAACTTAGTGG - Intronic
950872440 3:16241507-16241529 CAAACTACCCCAAAACTTAGTGG + Intergenic
950932682 3:16806269-16806291 GAAGCCACTCCAAAACTTAGTGG - Intronic
951136859 3:19113999-19114021 CAAACCACTCCAAAGATGAGTGG + Intergenic
951707830 3:25561402-25561424 CAAACTACCCCCAAGCTCAGTGG + Intronic
951796274 3:26542183-26542205 CAAACCAATCCAAAGCTAAGGGG - Intergenic
955509918 3:59669340-59669362 CAAACTGCCCCAAAACTCAGTGG + Intergenic
955974610 3:64468060-64468082 CATGCTACTGGAAAGCCCAGGGG - Intergenic
956764372 3:72472103-72472125 CAAATTACTCCAAAACTTAGTGG + Intergenic
956860385 3:73317524-73317546 CAAGCAACCCCAAATCTCAATGG - Intergenic
956927903 3:74009254-74009276 CAAACCACTCCAAAACTCAGTGG + Intergenic
957066103 3:75523654-75523676 CATGTCACTCCAAATCTCAGTGG - Intergenic
957217852 3:77344972-77344994 CAAATTACCCCAAAGCTTAGAGG + Intronic
958635184 3:96734915-96734937 CTAGCTATTCAAAAACTCAGAGG - Intergenic
960124119 3:113979294-113979316 CTACCCACTCCAAAACTCAGGGG - Intronic
960347897 3:116557224-116557246 AAAGCTACTTCAAGCCTCAGAGG - Intronic
960670431 3:120150534-120150556 CAAGCCACCCCAAAGCTGAATGG + Intergenic
961287046 3:125814403-125814425 CAAGTCACTCCAAATCTCAGTGG + Intergenic
961374351 3:126453069-126453091 AATGCTGCTCCAAAGCTCTGTGG - Intronic
961421403 3:126807793-126807815 CAAATTACTCCAAAACTTAGTGG + Intronic
961866530 3:129957363-129957385 CAAGCCACCCCAAAACCCAGTGG + Intergenic
962737563 3:138339303-138339325 GAAACTACTCCAGTGCTCAGTGG + Intergenic
962904670 3:139790837-139790859 CAGATTACTCCAAAACTCAGTGG + Intergenic
962904901 3:139792796-139792818 CAAACCACCCCTAAGCTCAGTGG + Intergenic
962912517 3:139866380-139866402 CAAGTTACACCAAAAGTCAGTGG + Intergenic
964534411 3:157703724-157703746 CAAATTACTCCAAAACTAAGTGG - Intergenic
964810508 3:160658719-160658741 CAAACTATTCCATAGCACAGAGG + Intergenic
965050804 3:163645252-163645274 CAAGTGACTCCAAAGGTCACTGG - Intergenic
965075685 3:163972339-163972361 CAAATTACTCCAAAACTTAGTGG - Intergenic
965618885 3:170622635-170622657 CAAACAACCCCAAATCTCAGTGG - Intronic
965846666 3:172970054-172970076 CAAACCACTCTAAAACTCAGCGG - Intronic
967699958 3:192580435-192580457 CAAGCTGCTCCACAGTTCAGCGG - Intronic
968621447 4:1605114-1605136 CCAACCACTCCAAAGCTGAGCGG + Intergenic
969010705 4:4059737-4059759 CAAGTCACTCCAAATCTCAGTGG - Intergenic
969743352 4:9050156-9050178 CAAGTCACTACAAATCTCAGTGG + Intergenic
969802745 4:9582255-9582277 CAAGTCACTCCAAATCTCAGTGG + Intergenic
970004914 4:11401000-11401022 CAAACCACTCCAAAACTCAGGGG - Intronic
970017227 4:11525692-11525714 TAATGTACTACAAAGCTCAGGGG - Intergenic
970378945 4:15486199-15486221 CAAACTATTCCAAAAATCAGAGG - Intronic
970650502 4:18172139-18172161 CAAGCTACTCCAAAATGTAGTGG - Intergenic
971355724 4:25893733-25893755 CAAACTGCTCCAAAATTCAGTGG - Intronic
971797994 4:31253680-31253702 CAAACTACCCCAAAATTCAGTGG + Intergenic
971925244 4:33001387-33001409 CAAGTTACTCCAAAACTTGGTGG + Intergenic
972116324 4:35638868-35638890 CAAGCCACTCCAAAACTCAGTGG - Intergenic
972246833 4:37253762-37253784 CAATCTACTTCAAAACTTAGTGG - Intronic
973673559 4:53241235-53241257 CCAGCCACTGCAAAGCCCAGAGG + Intronic
976202938 4:82597758-82597780 CAAACTACTCCAAAACTTAATGG - Intergenic
976492313 4:85685784-85685806 CAAACTATCCCAAAACTCAGCGG + Intronic
976773961 4:88686430-88686452 CAAGCTACACCAGAGTTAAGAGG + Intronic
977268542 4:94885220-94885242 TAAGCTACCCTAAAACTCAGTGG - Intronic
977514141 4:97998654-97998676 CAAACCACTCCAAAACTCATAGG - Intronic
977725843 4:100296138-100296160 CAAGCTACTTCAAAACTTAGTGG + Intergenic
978079817 4:104578545-104578567 CAAACTGCTCCAAAACTGAGTGG + Intergenic
979324531 4:119363296-119363318 CAAAGTATGCCAAAGCTCAGTGG + Intergenic
979721097 4:123901395-123901417 CAAGCTACACCAAAATACAGTGG - Intergenic
981849781 4:149216685-149216707 CAAACTACTCCAAAACTTAATGG - Intergenic
982376094 4:154692530-154692552 CAAAATTCTCCACAGCTCAGTGG + Intronic
982421322 4:155201560-155201582 CAAACTACCCCAAAACTCAGTGG - Intergenic
983185750 4:164698721-164698743 CAAACAACCCCAAATCTCAGTGG + Intergenic
983242370 4:165247998-165248020 CAAAGTATGCCAAAGCTCAGTGG + Intronic
984786827 4:183574821-183574843 CAAACTACTCCGAAACTTAGTGG - Intergenic
985407213 4:189649857-189649879 CAAGCAACCCAAAATCTCAGTGG + Intergenic
985773364 5:1826723-1826745 CAAGCCACTCCCCAGGTCAGCGG - Intergenic
986212100 5:5683587-5683609 TAAGCTACTCCAAAACATAGTGG - Intergenic
986823779 5:11498141-11498163 CAAACCACCCCAAAACTCAGGGG - Intronic
988718824 5:33855438-33855460 AAAGCTATTCCAAAGCTCCATGG + Intronic
990283732 5:54278793-54278815 CTGTCTACTCCAAACCTCAGTGG + Intronic
990430495 5:55730236-55730258 CAAACTACTCCAAAACTTGGTGG - Intronic
990439410 5:55829768-55829790 TAAGTTACCCCAAAGCTAAGTGG + Intergenic
991040731 5:62172857-62172879 CAAACTACTCCAAAACTCAGTGG + Intergenic
991445258 5:66692842-66692864 CAACCTACTTCAAAGCACACTGG - Intronic
991631937 5:68665227-68665249 AAAGCTATTCCCAAGCTGAGAGG + Intergenic
991772618 5:70053804-70053826 CAACCTCCTCCCAAGCTCAAGGG + Intronic
991851911 5:70929228-70929250 CAACCTCCTCCCAAGCTCAAGGG + Intronic
992324858 5:75650755-75650777 CAATCCAACCCAAAGCTCAGTGG + Intronic
992532013 5:77661042-77661064 CAAACTAGTCCAAAACTCAGAGG + Intergenic
993085684 5:83360849-83360871 CTAACTATCCCAAAGCTCAGTGG - Intergenic
993131887 5:83908616-83908638 CAAGTTACCCTAAAGCTTAGTGG - Intergenic
993536438 5:89092397-89092419 CAAACCACCCCAAAGCACAGGGG + Intergenic
995252364 5:110007966-110007988 CTGTCTACTCCAAAACTCAGTGG - Intergenic
995452415 5:112316695-112316717 CAAGTAACTTCAAAACTCAGTGG + Intronic
996453630 5:123655840-123655862 CATGCAAGTCCAAAGCCCAGTGG + Intergenic
996507685 5:124286667-124286689 CCACCTATTCCAGAGCTCAGAGG - Intergenic
998994754 5:147859038-147859060 CAAAATACTCCAAAATTCAGTGG - Intergenic
999611981 5:153379617-153379639 CATGTTATTCCAAAACTCAGTGG - Intergenic
999924077 5:156356143-156356165 CAAACTACCCCAAAACTTAGTGG + Intronic
1000890929 5:166801140-166801162 CAAACCACTCCAAAACTCAGTGG + Intergenic
1001689434 5:173621910-173621932 AAAACAACTCCAAATCTCAGTGG - Intergenic
1003566878 6:7229740-7229762 GAAGCTCCTCAAAGGCTCAGTGG + Exonic
1004143211 6:13040534-13040556 CAAGCCACACCAGATCTCAGTGG - Intronic
1004483660 6:16045232-16045254 CCAACTACCCCAAAACTCAGTGG + Intergenic
1005811251 6:29518100-29518122 CCAGCTGCTCCACAACTCAGAGG - Intergenic
1007024649 6:38558147-38558169 CTAGCTACTCCAGAGGTTAGAGG + Intronic
1007114397 6:39333313-39333335 CAAACCACTCTAAACCTCAGTGG + Exonic
1007811784 6:44491424-44491446 CAAACTACCCCAAAACTTAGTGG - Intergenic
1008756915 6:54807325-54807347 CAAACCACCCCAAAACTCAGTGG + Intergenic
1010300921 6:74257993-74258015 CAAATTATTTCAAAGCTCAGTGG - Intergenic
1011442827 6:87405608-87405630 TAAGCCACTCAAAAACTCAGCGG + Intergenic
1012732841 6:102903657-102903679 CAAACTACCCCAAATCTTAGTGG - Intergenic
1013135357 6:107277026-107277048 CAAACTACTCCAAACCTTGGTGG - Intronic
1013594912 6:111651751-111651773 CAAACCACTCCAAAACTTAGTGG - Intergenic
1014102950 6:117531851-117531873 CAAGCCACTCCAAAACTTAGTGG + Intronic
1014562589 6:122909002-122909024 TAAACTACCCCAAAACTCAGTGG - Intergenic
1015286770 6:131494474-131494496 AAAACTACTCCAAAACTTAGTGG + Intergenic
1015344531 6:132140108-132140130 CAAACCACCCCAAAGCACAGGGG - Intergenic
1017274421 6:152549381-152549403 CAAACTACTCCAAAACTCTGTGG - Intronic
1018642778 6:165919824-165919846 AAAGCAAATACAAAGCTCAGTGG + Intronic
1018753690 6:166830009-166830031 CCAGCTACTCCAGAGGTCAAGGG + Intronic
1018772582 6:166984936-166984958 CAAATTACTCCAAAACTTAGTGG + Intergenic
1019812110 7:3172450-3172472 CAAACGACCCCAAAACTCAGTGG + Intronic
1020705481 7:11538580-11538602 GAACCTACTCCAAAGATCTGTGG - Intronic
1021399430 7:20192674-20192696 CAAACTACTCCAAAACTTAGTGG - Intronic
1021645751 7:22787948-22787970 CAAATTACCCCAAAACTCAGTGG + Intergenic
1021761803 7:23909649-23909671 CACTCTACTCAAAAGCCCAGGGG + Intergenic
1021845749 7:24761059-24761081 CAAACTACCCCAAAACTTAGTGG + Intergenic
1022020460 7:26395585-26395607 CAAACTATCCCAAAGCTTAGTGG - Intergenic
1022553135 7:31261418-31261440 CCAACCACTCCAAAACTCAGGGG + Intergenic
1023477595 7:40597823-40597845 ACAGCAACTCCAAATCTCAGTGG - Intronic
1024874414 7:54005425-54005447 CAAGCAACTCAAAATCTCAGTGG - Intergenic
1028250653 7:88536063-88536085 CAAACTACCCCAAAACTTAGTGG - Intergenic
1028433833 7:90778736-90778758 CAACCTGCACAAAAGCTCAGAGG - Intronic
1028452005 7:90995488-90995510 CAAGTTACTACAAAACCCAGTGG - Intronic
1029048067 7:97652339-97652361 CCAGCTACCCCAAAACTTAGAGG - Intergenic
1029069993 7:97887741-97887763 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1029674915 7:102061932-102061954 CAAACTGCTACAAATCTCAGTGG + Intronic
1029902505 7:104056489-104056511 CAAGCCACTCTAAAACTTAGTGG + Intergenic
1030351485 7:108493119-108493141 CAAGCCACTCCAAAACTTAGTGG - Intronic
1030876915 7:114825203-114825225 CAAGGTGCTCCAGAGCTCACAGG - Intergenic
1032135413 7:129272409-129272431 CAAACTACCCTAAAGCTTAGTGG - Intronic
1032855734 7:135832301-135832323 CTAGGTACTCTATAGCTCAGAGG - Intergenic
1033162420 7:139009522-139009544 CAAACCACCCCAAAACTCAGTGG + Intergenic
1033302271 7:140197003-140197025 CAAATTACTCCAAAGTTTAGTGG - Intergenic
1033488655 7:141817917-141817939 CAAGTTACCCCAAAACTCAGAGG - Intergenic
1034378776 7:150670708-150670730 GAAACTACTCCAAAACTCAGTGG + Intergenic
1034416171 7:150965369-150965391 CTAGCTTCTCTAAAGCTCTGGGG + Intronic
1034458650 7:151186208-151186230 CAGGCCACTCCAAAGTTCATGGG + Intronic
1036248563 8:7141949-7141971 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1036252249 8:7172395-7172417 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1036365243 8:8115065-8115087 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1036885685 8:12551047-12551069 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1036893305 8:12610119-12610141 AAAGTCACTCCAAATCTCAGTGG - Intergenic
1036981189 8:13471841-13471863 GAAGCCACTCCCAAGCTCACTGG + Intronic
1037034982 8:14155034-14155056 CAAACTACTCCAAAACAGAGTGG - Intronic
1037379292 8:18267111-18267133 CAAATTACTCCAAAGCTCAATGG - Intergenic
1037602807 8:20412328-20412350 CAAACTACTCCCAAACTTAGTGG + Intergenic
1037697313 8:21235797-21235819 CAAGTCACTCCAAAGCTCAGTGG + Intergenic
1038675136 8:29616293-29616315 CCAGCTGCTTCACAGCTCAGGGG + Intergenic
1039031964 8:33320505-33320527 TAAACTACTCCAAAACTCAGTGG + Intergenic
1041192151 8:55365297-55365319 CATACTACAACAAAGCTCAGTGG - Intronic
1041349327 8:56932934-56932956 CCAGCTGCTCCACAGCTCTGAGG - Intergenic
1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG + Intergenic
1041649444 8:60287389-60287411 TAAGCCACTCCAAAGCTTAGTGG - Intergenic
1041757120 8:61326225-61326247 CAAGCTACATCAAAACTTAGTGG + Intronic
1042364835 8:67924214-67924236 CAAGCCACCCCAAAACTTAGTGG + Intergenic
1042414912 8:68508495-68508517 TAATTTACTCCAAAACTCAGTGG + Intronic
1045346380 8:101297562-101297584 CACACTACCCCAAAACTCAGAGG + Intergenic
1045786567 8:105928045-105928067 CAAACCACCCCAAAACTCAGGGG - Intergenic
1046070190 8:109242371-109242393 CAAACCACACCAAAACTCAGTGG - Exonic
1046943794 8:119956149-119956171 CAAGCTACTCCCAAACTTGGTGG - Intronic
1047717947 8:127613062-127613084 CAAACTACCCCAAAGCTTAGTGG - Intergenic
1048321184 8:133401429-133401451 CAAACCACTCCAAAACTCAGTGG + Intergenic
1048326765 8:133445791-133445813 CAAACTACTCCAAACCTTAGTGG + Intergenic
1048638124 8:136322415-136322437 TAAGCTACCCCAATGCTCAATGG + Intergenic
1051674994 9:19549848-19549870 CAAACTACCCCAAAACTTAGTGG - Intronic
1055264196 9:74476355-74476377 CAAGCAAGTCCAAAATTCAGTGG - Intergenic
1055524280 9:77114852-77114874 CAAACTACCCCAAAGGTTAGTGG + Intergenic
1055530040 9:77175113-77175135 CCAGCTACTCCAAGGGTGAGAGG - Intergenic
1055681629 9:78721608-78721630 CAAACTACCCCAAACTTCAGTGG + Intergenic
1056027225 9:82511631-82511653 CAAACCACTCCAAAACTCAGTGG + Intergenic
1056974736 9:91241951-91241973 CAAGTTACTCTAAAACTCAGTGG + Intronic
1057569074 9:96190075-96190097 CAAACTACTTCAAAACTTAGTGG + Intergenic
1059142327 9:111865103-111865125 CAAGCTACTCCAAAGAGAGGTGG - Intergenic
1059373047 9:113858819-113858841 CAAACAACCCCAAAACTCAGTGG - Intergenic
1060009975 9:120035243-120035265 CAAGCCAGTCCAAAACTCAGTGG + Intergenic
1060655637 9:125370933-125370955 CAAGCCCCTCCACAGCTAAGTGG + Intergenic
1061094996 9:128451384-128451406 CAGGCCACCCCGAAGCTCAGAGG - Intergenic
1203658223 Un_KI270753v1:18951-18973 CAAGCAACCCAAAATCTCAGTGG + Intergenic
1185812938 X:3127495-3127517 AAATCTACTTCAAAGCTCATGGG - Intergenic
1187056676 X:15747316-15747338 TAATCTCCTCCAAAGCTCATAGG + Intronic
1187250833 X:17596710-17596732 CCAGCCACTCCAAGTCTCAGGGG + Intronic
1187300459 X:18044223-18044245 CAAACCACTCCAAAGCTCAGTGG + Intergenic
1187600623 X:20825340-20825362 CAAACTACCCCAAAATTCAGTGG + Intergenic
1188049784 X:25470611-25470633 CAAGCCACTTCAAAACTCAGTGG - Intergenic
1188456881 X:30376980-30377002 GAACCTACTCCAAATTTCAGAGG - Intergenic
1188752148 X:33917993-33918015 CAAACTAACCCAAAACTCAGTGG - Intergenic
1189310887 X:40016703-40016725 AAAGCCACCCCAAAGCTTAGTGG + Intergenic
1189355909 X:40309798-40309820 CAAGCTACCCCCAAACTAAGTGG - Intergenic
1189465325 X:41274127-41274149 CAAGCCACCCCAAAACTTAGTGG - Intergenic
1189571460 X:42302244-42302266 CAAGTTACTCCAAAATTTAGTGG - Intergenic
1189589064 X:42492724-42492746 CAAGCCACTCCAAAACCTAGTGG - Intergenic
1190554138 X:51616700-51616722 CAAGCTATTCCAAAGAACAAAGG + Intergenic
1192132903 X:68569487-68569509 AAAGTTACTCCAAAACTCAGTGG - Intergenic
1192297060 X:69861971-69861993 CAAATTACTCCAAAACTTAGTGG + Intronic
1195402868 X:104480311-104480333 CCAGTGACCCCAAAGCTCAGAGG + Intergenic
1195763339 X:108270600-108270622 CAACCCACTCCAAAACCCAGTGG - Intronic
1195979921 X:110566840-110566862 CAAGTTACCCCAAAACTTAGTGG + Intergenic
1198872403 X:141189316-141189338 CAAACTACTCCAAATGACAGAGG - Intergenic
1201765796 Y:17572606-17572628 TAAGCTATTCCAAATCACAGTGG + Intergenic
1201835756 Y:18333383-18333405 TAAGCTATTCCAAATCACAGTGG - Intergenic