ID: 918296679

View in Genome Browser
Species Human (GRCh38)
Location 1:183163604-183163626
Sequence CATGCACGCTAGTGTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918296679_918296683 24 Left 918296679 1:183163604-183163626 CCACATGAACACTAGCGTGCATG No data
Right 918296683 1:183163651-183163673 TGTAATTTTTGTAAAGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918296679 Original CRISPR CATGCACGCTAGTGTTCATG TGG (reversed) Intergenic