ID: 918298464

View in Genome Browser
Species Human (GRCh38)
Location 1:183180490-183180512
Sequence CTGGGTAAATTCTCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918298464_918298470 13 Left 918298464 1:183180490-183180512 CCAGCCTCAGAGAATTTACCCAG No data
Right 918298470 1:183180526-183180548 CACTGAACCATTTCCATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918298464 Original CRISPR CTGGGTAAATTCTCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr