ID: 918298889

View in Genome Browser
Species Human (GRCh38)
Location 1:183184538-183184560
Sequence GTGTAATTTGTTTGAATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918298887_918298889 24 Left 918298887 1:183184491-183184513 CCTTAGCTGTAGCTGGAGACTCT 0: 1
1: 0
2: 0
3: 14
4: 187
Right 918298889 1:183184538-183184560 GTGTAATTTGTTTGAATCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918298889 Original CRISPR GTGTAATTTGTTTGAATCCT GGG Intergenic
901563612 1:10093426-10093448 GTGTATTTTACTTGAGTCCTAGG + Intronic
901902679 1:12379341-12379363 GGGTAGTTAGCTTGAATCCTAGG - Intronic
904342687 1:29847377-29847399 GTGTTTCTTGTTTGACTCCTTGG + Intergenic
907950299 1:59176971-59176993 GTGTAAGTTGTTTGTTTCCTTGG + Intergenic
909412722 1:75373862-75373884 GGGTAGTGTGCTTGAATCCTGGG - Intronic
909755966 1:79225989-79226011 GTGTAATTCTTTTAACTCCTAGG + Intergenic
909994537 1:82262644-82262666 CAGTTATTTGTTTGAATCTTTGG + Intergenic
911225769 1:95304032-95304054 GTGTAAGTTTTTTCACTCCTAGG + Intergenic
911844975 1:102741207-102741229 GTGGGAGTTGTTTGAATCATGGG - Intergenic
912184519 1:107258886-107258908 TTATTATTTGTTTTAATCCTTGG + Intronic
915844980 1:159253122-159253144 GTGTCATTTGCTTGTCTCCTGGG - Intergenic
916971616 1:170025661-170025683 GTTTAATTTCTTTGAATCAGGGG - Intronic
918298889 1:183184538-183184560 GTGTAATTTGTTTGAATCCTGGG + Intergenic
920962640 1:210677492-210677514 GTGCAATTTGATTAAATCATGGG + Intergenic
921601445 1:217110735-217110757 GTGGGATGTGTTTGGATCCTGGG - Intronic
921899298 1:220433748-220433770 GTGAAATTTGTCTGTATCCCAGG - Intergenic
922359512 1:224808734-224808756 ATGAAAATTGCTTGAATCCTGGG + Intergenic
924033386 1:239909998-239910020 GTGTAATGTTTTTGAAACCAGGG + Exonic
1065563071 10:26982891-26982913 GAGTGGTTTGTTTGGATCCTGGG - Intergenic
1068341001 10:55702673-55702695 CTGTAATTTGTTTGAATTTCTGG + Intergenic
1069117690 10:64528388-64528410 GTGGAAGCTGATTGAATCCTGGG + Intergenic
1070357282 10:75652575-75652597 CTGTACTTTGTTTTAATCTTTGG + Intronic
1071210412 10:83335635-83335657 GTGTCTTTTGTTTTAAGCCTTGG - Intergenic
1072735765 10:97878497-97878519 GTGTAATTTTATTATATCCTGGG + Intronic
1073679301 10:105684975-105684997 GTCTAATTTGTTTCCATCTTAGG + Intergenic
1075059281 10:119243536-119243558 GGGAACATTGTTTGAATCCTTGG - Intronic
1076085059 10:127620172-127620194 GTGTAATGTGTCTGTATGCTGGG - Intergenic
1076101275 10:127780869-127780891 GTTTAATTTGTGAGATTCCTGGG + Intergenic
1081432639 11:42993255-42993277 GTATAAATTGTTTGACTTCTAGG + Intergenic
1081548572 11:44091453-44091475 GTTTTATTTGTCAGAATCCTAGG + Intergenic
1081695902 11:45108874-45108896 GTGAAATTTCTTTGAAGTCTTGG + Intronic
1081951263 11:47045476-47045498 CTTTAATATGTTTGAATCCATGG + Intronic
1082086164 11:48051704-48051726 ATGTAATTTGTTTAAAAACTAGG - Intronic
1083008242 11:59368688-59368710 GGGTCATTTGTTTGACTCCTGGG - Intergenic
1085876651 11:80415432-80415454 GTGTAACTGGTTTGAAATCTAGG + Intergenic
1087278233 11:96181590-96181612 CTGTAATTTTTTTGCATCTTAGG - Intronic
1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG + Intergenic
1093831526 12:23766471-23766493 TTATATTTTGTTTGAATCCCAGG + Intronic
1096966004 12:55628284-55628306 GTGGACTTTCTCTGAATCCTTGG + Intergenic
1099383112 12:81979986-81980008 GTGAAAGGTGTTTGAATCTTGGG - Intergenic
1099564179 12:84219507-84219529 GTGAAAGTTGATTGAATCATGGG - Intergenic
1100692406 12:97052457-97052479 GTTTTATTTGTTGGAATTCTTGG - Intergenic
1101613047 12:106309574-106309596 GAGTAATTTTTTTAATTCCTTGG - Intronic
1102382574 12:112479999-112480021 GTGGACTGTGTTTGATTCCTGGG + Intronic
1107237927 13:38195558-38195580 TTGTAAATTATTTGAATCTTTGG + Intergenic
1107325960 13:39243115-39243137 GGTTAATTCATTTGAATCCTTGG + Intergenic
1109066800 13:57705664-57705686 GTGTACTGTGTTTGATTTCTAGG - Intronic
1109738394 13:66518294-66518316 GTGGAAGGTGTTTGAATCATGGG - Intronic
1109898585 13:68730523-68730545 TTGTAATTTGTTTCCATCCATGG - Intergenic
1112223427 13:97514292-97514314 GTGTAAGGTGTTTGGATCATGGG - Intergenic
1113141224 13:107152364-107152386 GTGTTATTTCTTTAAATCTTTGG + Intergenic
1113223024 13:108127188-108127210 GTGTAAGCTGTTGGAATCTTTGG - Intergenic
1113988425 13:114338618-114338640 GTGTAACTTGTTAGAACACTAGG - Intergenic
1114401106 14:22411474-22411496 ATGTAATTTGTCTCCATCCTGGG + Intergenic
1114950327 14:27742851-27742873 GTTGAATGTGTTTGAATCATGGG + Intergenic
1116985001 14:51209294-51209316 TTGTAGTATGTTTGAACCCTGGG - Intergenic
1117594513 14:57312475-57312497 GTTTATTATATTTGAATCCTGGG + Intergenic
1118805089 14:69229073-69229095 GTGTGGTTTGTATGAATGCTGGG + Intronic
1118957707 14:70497833-70497855 GGGTCATTTGCTTGATTCCTTGG - Intergenic
1120305184 14:82760671-82760693 GTGTGATTTTCTTGAATCCATGG + Intergenic
1120564086 14:86032884-86032906 GTGGAAATTGTTTGGATCATGGG - Intergenic
1120783821 14:88511734-88511756 GTGCAATTTCTTTTATTCCTTGG - Intronic
1123883321 15:24696333-24696355 GTTACATTTTTTTGAATCCTTGG + Intergenic
1124916052 15:33975438-33975460 TTATAATTTATTTGAATCCTAGG - Intronic
1126455877 15:48861522-48861544 TTGGAATTGGTTTTAATCCTGGG - Intronic
1127197302 15:56602351-56602373 GTGTAAGTTGATTAAAGCCTTGG - Intergenic
1128351648 15:66894842-66894864 GGGGTATTTGTTTGACTCCTGGG - Intergenic
1131659779 15:94501539-94501561 ATATAATTTGTTTTAATCCTTGG + Intergenic
1131964988 15:97832682-97832704 GTGTAATCCTTTTGAAGCCTTGG - Intergenic
1132288515 15:100683269-100683291 GGGTAATTTGTTTAAAGCCCTGG - Intergenic
1133413503 16:5588054-5588076 CTGTAACTTGTTTGAACCTTGGG + Intergenic
1133506540 16:6418027-6418049 GTATAACTTGTTTGAAGGCTTGG - Intronic
1138672946 16:58629978-58630000 GTGTGATTGGTTTAAATCCGCGG - Intergenic
1139122001 16:64031895-64031917 TTTTATTTTGTTTGAATTCTTGG + Intergenic
1141359546 16:83382778-83382800 GTGTAACTGGATGGAATCCTGGG - Intronic
1150143460 17:62749464-62749486 GTGTGCTTTCTTTGGATCCTGGG + Intronic
1152975456 18:212861-212883 GTGTATGTTGTTTTAATGCTCGG + Exonic
1153996185 18:10443984-10444006 GAGTAATTTGTTTGGGTCTTGGG + Intergenic
1157524937 18:48373562-48373584 GTGGAAGTTGTTTGGATCATGGG + Intronic
1158924324 18:62237469-62237491 GTATCATTTGTTTAAATCATGGG - Intronic
1160293653 18:77618021-77618043 GTGTCTTCTGTTTCAATCCTGGG - Intergenic
1164373275 19:27659993-27660015 GTCTCATCTGTTTGAATGCTTGG + Intergenic
1166597360 19:44061683-44061705 GTGTAATGTGTCAGAATCATAGG + Intronic
924959435 2:20457-20479 GTGTAACTTGTTAGAACACTAGG + Intergenic
925693942 2:6554254-6554276 GTGTAAATTGATTTATTCCTAGG + Intergenic
926828917 2:16938512-16938534 TTGTTATTTGTTTGTATCGTAGG + Intergenic
926980580 2:18562816-18562838 GTCTAATCTTTTTGAATCTTAGG + Intronic
928112766 2:28523968-28523990 GTGTGATTTGTTTGTCTCCCTGG + Intronic
928135659 2:28685638-28685660 GTGGGAGGTGTTTGAATCCTGGG + Intergenic
930968910 2:57369842-57369864 GAGTAATTTATTTATATCCTTGG - Intergenic
933947843 2:87302394-87302416 TTATCATTTGTTTGAATTCTTGG - Intergenic
934932724 2:98441416-98441438 CTGTGATTTGGTTGAATCCATGG + Intergenic
936332355 2:111559178-111559200 TTATCATTTGTTTGAATTCTTGG + Intergenic
936622966 2:114119253-114119275 ATGGAATTTGTTACAATCCTGGG - Intergenic
936796986 2:116218243-116218265 GAGTAAGGTGTTTGAATACTAGG + Intergenic
939765929 2:146249832-146249854 ATGTAATTTGTTTGAATGTTTGG + Intergenic
939789909 2:146559475-146559497 GTTTCATTTGTCTGAAACCTTGG + Intergenic
947392991 2:229658502-229658524 TTTTAATTTGTGTGAATCTTTGG - Intronic
1169464576 20:5826366-5826388 TTGTAATATGTTTGAATGCAAGG + Intronic
1169951906 20:11054354-11054376 GTTTATTTTGTTTGAAACATGGG + Intergenic
1172262629 20:33581528-33581550 TTTTGTTTTGTTTGAATCCTGGG + Intronic
1175568788 20:60002528-60002550 GTGTCATTTGTTTGTATTCAGGG + Intronic
1177067466 21:16458829-16458851 GAGTATTTTGTTTGAATTCATGG + Intergenic
1177193407 21:17876696-17876718 GTCTAATTTATGTGGATCCTTGG + Intergenic
1182339716 22:29609936-29609958 GTGTGATTTGTTTATATGCTTGG + Intronic
1183275222 22:36892160-36892182 CTGAAATTTGTTGGAATACTTGG + Intergenic
1183834156 22:40438308-40438330 CTGTAATTTGGTTGAATCACTGG + Intronic
951283457 3:20780277-20780299 GGGTCATTTGCTTGATTCCTGGG - Intergenic
951405832 3:22296344-22296366 GTGTCACTTGTTTGAATCATAGG + Intronic
956458242 3:69444957-69444979 CTGTAATTTTTTAGACTCCTGGG + Intronic
957058837 3:75465259-75465281 GTGTAAGCTGTTTGAAACCCAGG + Intergenic
957206204 3:77201987-77202009 ATATAATTTGTTTTAATCCTAGG - Intronic
957597614 3:82287914-82287936 GGGTGATGTGCTTGAATCCTGGG - Intergenic
960685323 3:120288614-120288636 GAGTCATTTGCTTGACTCCTGGG - Intergenic
962137754 3:132755550-132755572 GTATAATTTTTTTGAAACCTAGG - Intergenic
962556067 3:136552906-136552928 CTCAAATTTATTTGAATCCTAGG - Intronic
963731689 3:148980749-148980771 CTGTAATTAGTTAAAATCCTGGG - Intergenic
964255607 3:154771902-154771924 GGGTCATTTGTTTGTCTCCTGGG + Intergenic
965186383 3:165470010-165470032 GTTAAATTTGTTTTAAGCCTTGG + Intergenic
966990287 3:185222903-185222925 GTTTTATTTGTTTTTATCCTGGG + Intronic
968375024 4:32605-32627 GTGTAACTTGTTAGAACACTAGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
970013769 4:11489627-11489649 ATGTAATTTATTTGAAACCCAGG - Intergenic
971391539 4:26190677-26190699 GTGTAATTTCCTTGAATACAGGG + Intronic
971503003 4:27336692-27336714 GTTTAATTTGTTTGCCTCCCTGG + Intergenic
971898139 4:32623097-32623119 GTATAATGAGTTTGAATCCTTGG + Intergenic
971978490 4:33722183-33722205 CTGTATTTTGTGTGAAACCTTGG + Intergenic
975795610 4:78003668-78003690 GTTTAATCTGTTTGAATCTTTGG + Intergenic
977834257 4:101630614-101630636 GAGTAGTTTTTATGAATCCTCGG + Intronic
979389728 4:120114247-120114269 GTGAAATTTGGTTGTATCTTTGG + Intergenic
981817420 4:148847102-148847124 GTGTGTTTTGTTTGAATCCATGG - Intergenic
983537617 4:168874975-168874997 GTGTCATGTGTTTAAATCTTTGG - Intronic
984429035 4:179625043-179625065 GTATAATGTGGTTGAATCCCAGG + Intergenic
985460019 4:190096439-190096461 GTGTAACTTGTTAGAACACTAGG - Intergenic
985468948 5:25168-25190 GTGTAACTTGTTAGAACACTAGG + Intergenic
986483017 5:8208071-8208093 TTGTAATTTGTAAGAATTCTTGG + Intergenic
988363061 5:30261165-30261187 GTGAATTTTGTTAGACTCCTTGG + Intergenic
991014461 5:61916023-61916045 GTGAAAATTGTTCGAATCCCAGG - Intergenic
991200458 5:63985890-63985912 GTCTAATTTGGTCGTATCCTGGG + Intergenic
992217547 5:74540813-74540835 GTGGAATTTGCTTGAATCTGAGG - Intergenic
994067805 5:95562798-95562820 GCTTAATTTGTTTGAACCATAGG + Intronic
994905078 5:105830414-105830436 GTGGAAGTTGTGTGAATCATTGG - Intergenic
996494574 5:124138978-124139000 ATGTACTTAGTTTGGATCCTAGG - Intergenic
996913780 5:128686409-128686431 GTGTAATTTTTTTCTAACCTAGG - Intronic
997301781 5:132811615-132811637 GTTTAAATTGTTTGCATCTTGGG + Intergenic
997789473 5:136743961-136743983 GTGTAAGTTGATTGGATCATGGG + Intergenic
998687099 5:144540494-144540516 GTGGAACGTGTTTGAATTCTTGG - Intergenic
999569206 5:152899491-152899513 GTGTAAGTTGTTCAGATCCTTGG - Intergenic
1002370480 5:178748951-178748973 GTGTAATTTGTGAGTTTCCTGGG - Intergenic
1003558460 6:7161398-7161420 CTTTAATTTGTTTGCCTCCTGGG - Intronic
1003812148 6:9796379-9796401 TTATAATTTGTTTTAATCTTTGG - Intronic
1004927921 6:20433310-20433332 GTCTAATTCATTTGATTCCTGGG - Intronic
1005154058 6:22783472-22783494 GTGTAATTTGTCATATTCCTCGG + Intergenic
1006440431 6:34050351-34050373 GTGGGATGTGTTTGAATCATGGG + Intronic
1009417104 6:63427954-63427976 GTGTTATTTTTTTGAATACTGGG - Intergenic
1010792326 6:80078669-80078691 GAGGATTTGGTTTGAATCCTTGG - Intergenic
1012012911 6:93813939-93813961 GTGTAATTTCTTAAAATTCTTGG - Intergenic
1014660250 6:124161353-124161375 GTGTGAGGTGTTTGAATCATGGG - Intronic
1015785164 6:136915782-136915804 GTGCAAGATTTTTGAATCCTTGG + Intergenic
1015832639 6:137386832-137386854 GTGGAATGTAATTGAATCCTGGG - Intergenic
1017669804 6:156759392-156759414 GTGTAATTATTTTGACTCTTTGG + Intergenic
1018248345 6:161843463-161843485 GCTTATTTTGTTTGAATCCGTGG + Intronic
1021905952 7:25333281-25333303 GTGCAATTTGTGTAAAGCCTTGG - Intergenic
1027009073 7:74726285-74726307 GTGTATTTTGTTTTAACCTTTGG + Intronic
1030321708 7:108175578-108175600 AAGTAATGTGTTTGAATACTGGG - Intronic
1032610795 7:133410556-133410578 GTCTATTTTGATTGAAACCTTGG + Intronic
1032982344 7:137298850-137298872 ATGTAATTTCTCTGAATCCCTGG - Intronic
1033302621 7:140200163-140200185 GTGTATCTTGCTTGAATCATTGG - Intergenic
1035494818 7:159315424-159315446 GTTTAGTTTGTTTGATTCATGGG + Intergenic
1038233518 8:25728852-25728874 GGGTCATTTGCTTGACTCCTGGG + Intergenic
1038786348 8:30620352-30620374 GTTTAGTTTGTTTGGAACCTTGG - Intronic
1038997195 8:32937040-32937062 GTTTAATTTCATTTAATCCTGGG - Intergenic
1039379781 8:37074434-37074456 TTCTAATTTCTGTGAATCCTGGG + Intergenic
1040828436 8:51649507-51649529 GAGTAAATTGTTTTACTCCTTGG - Intronic
1041095561 8:54345586-54345608 CTGTAATTTGATTGAGTTCTTGG + Intergenic
1041859509 8:62496575-62496597 GTGTCATTTGTTCAAAGCCTAGG + Intronic
1042109662 8:65367399-65367421 GAGTAGTTTCTTTGAATGCTTGG - Intergenic
1042822312 8:72943851-72943873 GTTTGATTTTTTTAAATCCTAGG + Intergenic
1043117097 8:76271176-76271198 CTGTAATTTCTTTGACTCATTGG - Intergenic
1043280968 8:78465786-78465808 GAGTCATTTGCTTGACTCCTGGG - Intergenic
1043424323 8:80133530-80133552 TTGTAATTGGTTTTAAGCCTGGG - Intronic
1046281357 8:112036626-112036648 TGGTAATTTGTTTGGTTCCTTGG - Intergenic
1047096061 8:121627019-121627041 TTGAATTTTGTTTGTATCCTTGG - Intronic
1047137871 8:122102162-122102184 ATGTAATTTGATTCCATCCTTGG - Intergenic
1056127825 9:83554424-83554446 GGGTCATTTGCTTGACTCCTGGG + Intergenic
1056259378 9:84832854-84832876 GAGAAATTGGCTTGAATCCTTGG + Intronic
1203574200 Un_KI270744v1:161545-161567 GTGTAACTTGTTAGAACACTAGG - Intergenic
1188743400 X:33812456-33812478 ATGTAATTTGTTATAATACTTGG + Intergenic
1188842931 X:35037793-35037815 GGGTCATTTGTTTGTCTCCTTGG - Intergenic
1190153041 X:47964592-47964614 GTGTAGTTTCTTTTTATCCTTGG - Intronic
1191247659 X:58240686-58240708 GTGTCTTCTGTTGGAATCCTTGG - Intergenic
1193294582 X:79819767-79819789 GAGTGGTTGGTTTGAATCCTGGG - Intergenic
1193440820 X:81537679-81537701 GTGTAATCTGATTTATTCCTGGG + Intergenic
1193455073 X:81721651-81721673 GTATAATTGCTTTCAATCCTTGG - Intergenic
1194213068 X:91092585-91092607 GTGTTGTTTGTTTGACTCCTGGG + Intergenic
1195018168 X:100798851-100798873 GAGTAGTTGGTTTGGATCCTGGG + Intergenic
1195117974 X:101718705-101718727 GTGTTATTTCTTGCAATCCTAGG - Intergenic
1195397496 X:104426913-104426935 GTGTAATTTATTTGAAAACTTGG + Intergenic
1196676338 X:118424529-118424551 GGGTTATTTGTTTGAATTTTGGG + Intronic
1196850476 X:119933120-119933142 GTCAAATATGTTTAAATCCTTGG + Intronic
1197447657 X:126570591-126570613 GAGAAATTTTTTTGCATCCTTGG - Intergenic
1198038320 X:132823398-132823420 GTGTAGTTTTTTTTAATCCCTGG + Intronic
1199726465 X:150587656-150587678 GTTTCATTTTTTTGCATCCTAGG + Intronic
1199800750 X:151248420-151248442 GTGTCATTTGAATGAGTCCTTGG - Intergenic
1201710333 Y:16984983-16985005 GTGTTATTTGATGGAGTCCTAGG + Intergenic
1201737842 Y:17288854-17288876 TTTTAAATTGTTTGACTCCTTGG + Intergenic
1201930963 Y:19346748-19346770 TTATAATTTGTTTGAATTTTAGG + Intergenic