ID: 918299143

View in Genome Browser
Species Human (GRCh38)
Location 1:183186345-183186367
Sequence GCCCCGCCATGCCTGCGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918299138_918299143 8 Left 918299138 1:183186314-183186336 CCTGCAGCGGAGACAGAGACTGA 0: 1
1: 0
2: 2
3: 39
4: 523
Right 918299143 1:183186345-183186367 GCCCCGCCATGCCTGCGCTCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
918299133_918299143 29 Left 918299133 1:183186293-183186315 CCGAGGCGCCGGGCAGCGACCCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 918299143 1:183186345-183186367 GCCCCGCCATGCCTGCGCTCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
918299137_918299143 9 Left 918299137 1:183186313-183186335 CCCTGCAGCGGAGACAGAGACTG 0: 1
1: 0
2: 1
3: 12
4: 212
Right 918299143 1:183186345-183186367 GCCCCGCCATGCCTGCGCTCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
918299136_918299143 10 Left 918299136 1:183186312-183186334 CCCCTGCAGCGGAGACAGAGACT 0: 1
1: 0
2: 1
3: 15
4: 171
Right 918299143 1:183186345-183186367 GCCCCGCCATGCCTGCGCTCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
918299134_918299143 21 Left 918299134 1:183186301-183186323 CCGGGCAGCGACCCCTGCAGCGG 0: 1
1: 0
2: 2
3: 22
4: 215
Right 918299143 1:183186345-183186367 GCCCCGCCATGCCTGCGCTCTGG 0: 1
1: 0
2: 1
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918299143 Original CRISPR GCCCCGCCATGCCTGCGCTC TGG Exonic