ID: 918305297

View in Genome Browser
Species Human (GRCh38)
Location 1:183240462-183240484
Sequence GACTCCCCTTTGCTGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918305297_918305303 21 Left 918305297 1:183240462-183240484 CCTAGCCCCAGCAAAGGGGAGTC 0: 1
1: 1
2: 0
3: 24
4: 216
Right 918305303 1:183240506-183240528 AGTAAATGTGCTTTGTTTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 292
918305297_918305301 -7 Left 918305297 1:183240462-183240484 CCTAGCCCCAGCAAAGGGGAGTC 0: 1
1: 1
2: 0
3: 24
4: 216
Right 918305301 1:183240478-183240500 GGGAGTCTCAGCTTTCCTTAAGG 0: 1
1: 0
2: 1
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918305297 Original CRISPR GACTCCCCTTTGCTGGGGCT AGG (reversed) Intronic
900519096 1:3097052-3097074 GGGACCCTTTTGCTGGGGCTGGG + Intronic
900791789 1:4685654-4685676 GCCTCTCCTTCGCTGGGGCAGGG - Intronic
902501713 1:16915246-16915268 GATTCCCCTTGGCTCTGGCTGGG - Intronic
903359160 1:22766112-22766134 GAGTCCCCTGTGCTGGGCCTGGG - Intronic
903655664 1:24947605-24947627 GCCTCCCATCTGCTGGGGCAGGG - Intronic
904541777 1:31238612-31238634 GAGTTCCCTATGCTGGGGCTAGG + Intronic
904901192 1:33858391-33858413 GAACTCCCTTGGCTGGGGCTAGG - Intronic
906277005 1:44524020-44524042 GTCTCCCCCTTGCTGAAGCTAGG - Intronic
907051846 1:51334930-51334952 GACTCCCCTGTGCTGGGGCTGGG - Intronic
908260928 1:62338858-62338880 GACTTCCCTTGCCTGGGCCTGGG + Intergenic
910635772 1:89405665-89405687 GGCTCCCCTTGGCTGGGGGAGGG + Intergenic
911149198 1:94580615-94580637 CACTTCCCTTGGCTGGGGGTGGG + Intergenic
915642679 1:157241278-157241300 GAATCCCCTTGGCTGGGGGGTGG - Intergenic
915990557 1:160511917-160511939 CACTTCCCTTGGCTGGGGGTGGG - Intronic
916691113 1:167190772-167190794 GGATCCCATTTACTGGGGCTAGG - Intergenic
918305297 1:183240462-183240484 GACTCCCCTTTGCTGGGGCTAGG - Intronic
920060126 1:203221720-203221742 GCCTGCCCTTTGCAGGTGCTGGG + Intronic
920365501 1:205446288-205446310 GTCCTCGCTTTGCTGGGGCTGGG - Intronic
920855197 1:209656164-209656186 GCCTCCCCTCTCCTGAGGCTGGG - Intergenic
922728958 1:227940205-227940227 GACTGCCCTTTTCTGGGGCAGGG + Intronic
1063401574 10:5751515-5751537 GACTCCCACTGGCTGGGTCTGGG - Intronic
1067800186 10:49353354-49353376 GGCTCCCCAGTGCTGGGCCTGGG - Intergenic
1067915530 10:50393866-50393888 GAATCCCCTTGGTTGGGGCTTGG - Intronic
1069632079 10:69903111-69903133 AATTCCTCTCTGCTGGGGCTGGG - Intronic
1069839457 10:71330150-71330172 TGCTCCCCTTTGCTGGGCCAGGG + Intronic
1074160097 10:110829889-110829911 GCCTCTCTTCTGCTGGGGCTGGG - Intronic
1082009038 11:47438119-47438141 GCCTGCCCTCTGCAGGGGCTGGG + Intronic
1084852270 11:71951428-71951450 GACTACCCTCTGCAGGGGCTAGG - Intronic
1085054832 11:73397581-73397603 GACACCCCTGTGCTAGGGTTTGG + Intergenic
1085717669 11:78887347-78887369 TACTCCTCTTGGCTGGGGTTGGG + Intronic
1086301477 11:85431325-85431347 CACTTCCCTTGGCTGGGGGTGGG - Intronic
1086990889 11:93303234-93303256 CACTTCCCTTGGCTGGGGGTGGG - Intergenic
1090277207 11:125428763-125428785 GGCTCCCCATTGTGGGGGCTTGG + Intronic
1090794733 11:130125011-130125033 AACTCCCGTTTGCTGTGGCTTGG + Intronic
1091356891 11:134944236-134944258 GAGTCCCCATGGCAGGGGCTGGG + Intergenic
1091703521 12:2679205-2679227 GACTCCCCTCTGCAGCAGCTGGG - Intronic
1094695075 12:32809797-32809819 CGCTTCCCTTTGCTGGGGGTGGG + Intronic
1095303631 12:40615154-40615176 CACTTCCCTTGGCTGGGGGTGGG - Intergenic
1096839908 12:54373839-54373861 GACTCACCTTGGGTGGGGGTGGG + Intronic
1098151948 12:67555955-67555977 GGCTTCCCTTGGCTGGGGGTGGG + Intergenic
1101730881 12:107426038-107426060 GAGTCCCCCTTGCTGGGGGTGGG - Intronic
1101754518 12:107610433-107610455 GAATCCCCTCTGCAGGCGCTGGG + Intronic
1102462618 12:113109501-113109523 GAGTCACCTCTGCTGGTGCTGGG - Intronic
1102619578 12:114183296-114183318 GACTACCTTTTGTTGGGGGTGGG - Intergenic
1103727495 12:123005311-123005333 GGCTCCCCATTGCTGCTGCTGGG + Exonic
1104622030 12:130321791-130321813 GAGTCCGGTTTGCTGTGGCTGGG + Intergenic
1104879707 12:132062147-132062169 GACTGCCCGTGGCGGGGGCTGGG - Exonic
1106425436 13:29624770-29624792 TACTTCCCTTGGCTGGGGGTGGG - Intergenic
1112449191 13:99493862-99493884 GACTGCCCATTGCTGGGGGCTGG + Intergenic
1112687371 13:101845860-101845882 GACTTTCCTTTGCAGGGGGTAGG + Intronic
1113803418 13:113098167-113098189 GCCTCCACTGTGCTGGGGCTGGG - Intronic
1115339016 14:32272635-32272657 GGCTTCCCTTGGCTGGGGCAGGG - Intergenic
1115398713 14:32935898-32935920 AACTCCCCATTTGTGGGGCTTGG + Intronic
1116332791 14:43616235-43616257 TACTCCCTTTTGGTAGGGCTAGG + Intergenic
1117745005 14:58860555-58860577 GCCACCCCTTTGCTAGGGGTTGG + Intergenic
1118458475 14:65966491-65966513 GACTCCCGTCTGCTGTGACTTGG + Intronic
1121015282 14:90545298-90545320 GACGCCCCTTTCCTGTTGCTTGG - Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121221968 14:92292364-92292386 CACTGCCCTTTGGTGGGCCTCGG - Intergenic
1121842479 14:97145750-97145772 GACTCCCTTCTGCTGGGAGTTGG + Intergenic
1122044659 14:99014840-99014862 GTCACCTCTTAGCTGGGGCTGGG + Intergenic
1122939485 14:104974864-104974886 GCCCCCCACTTGCTGGGGCTTGG + Intronic
1123098427 14:105777206-105777228 GACTGCACTTGGCTGGGGCAGGG + Intergenic
1124677113 15:31696074-31696096 GAGTCCCCTGTGCAGGGGGTTGG + Intronic
1124918293 15:33998162-33998184 GATGGCCCATTGCTGGGGCTTGG - Intronic
1129233477 15:74209483-74209505 GACTCCCCTTAGCTGTGGTCAGG - Intronic
1129971244 15:79779953-79779975 CACTTCCCTTGGCTGGGGGTGGG - Intergenic
1132347348 15:101116275-101116297 GACTTCCCTGTGCTGGGGGAGGG - Intergenic
1132618252 16:852782-852804 GTCTCCCCCTTGCAGAGGCTGGG + Intergenic
1134804816 16:17115167-17115189 GACTCTTCCTTGTTGGGGCTGGG + Intronic
1135125995 16:19809792-19809814 GACTCCAGTTTTCTGGGGGTGGG - Intronic
1135908858 16:26541066-26541088 CACTCCGCTTTCCTGGGCCTTGG + Intergenic
1136144330 16:28307058-28307080 TACTGCACTGTGCTGGGGCTGGG - Intronic
1137937928 16:52652514-52652536 CACTCCCCACAGCTGGGGCTTGG + Intergenic
1137943723 16:52714185-52714207 AACTCCCCTCTGCCGGGGCTTGG + Intergenic
1138431687 16:56972982-56973004 GACTGCCCTCTGCAGGGGCAGGG + Intronic
1138458290 16:57133487-57133509 GGCTTCCCTTTTCTGGGCCTCGG + Intronic
1140696041 16:77535351-77535373 GTCTCCCCTTTCTTGGGACTTGG - Intergenic
1142275470 16:89116477-89116499 CACGCCCCTTTGCTGGGCCTGGG + Intronic
1143032616 17:3976369-3976391 GACTCCTGTGTGCAGGGGCTGGG + Intergenic
1145786276 17:27595821-27595843 GTCTCCTCTGTGCTGTGGCTGGG + Intronic
1146179239 17:30686811-30686833 TTCTCCCCCTTGCTTGGGCTCGG + Intergenic
1147140542 17:38458390-38458412 GACTCCCTTCTGCTGTGGCCTGG + Intronic
1147742140 17:42675649-42675671 GACTCCCGTGTGCTGTGGCCCGG - Intronic
1148071364 17:44910700-44910722 GACACCCCTAGGCTGGGTCTTGG + Intronic
1148089387 17:45013719-45013741 GCCCCCCTTTTGCTGGGGGTGGG - Intergenic
1150272664 17:63876658-63876680 TCCTCCTCTTTGCTGGTGCTGGG - Intronic
1151416476 17:73969386-73969408 GAATCGCATTTGCTGGGGTTTGG - Intergenic
1151730186 17:75906385-75906407 GAGACCCCTCTCCTGGGGCTGGG - Intronic
1151995154 17:77603672-77603694 GTGTCCCCTCTGCTGGGTCTGGG - Intergenic
1152609742 17:81309759-81309781 GCCTCCCCCTTCCTGGGGCTGGG - Intergenic
1152735527 17:81995268-81995290 GAGTGCCCTTTGCTGGGGTGGGG + Intronic
1153209977 18:2751378-2751400 GACTCACATTTGCTGGGGGTCGG - Exonic
1153931839 18:9885987-9886009 GGCTCCCCTGTGCTGAGGCTGGG - Exonic
1160217368 18:76944222-76944244 CATTCCTCTCTGCTGGGGCTTGG + Intronic
1161592827 19:5136506-5136528 CACTCTGCTTTGCTGGGCCTGGG + Intronic
1162758560 19:12874690-12874712 CACTGCACTTCGCTGGGGCTAGG - Exonic
1162979385 19:14228758-14228780 TTCTCCCCCTTGCTTGGGCTCGG - Intergenic
1163655730 19:18543714-18543736 GCCTCCCGGCTGCTGGGGCTGGG + Intronic
1163886255 19:19967254-19967276 TGCCCCCCTTGGCTGGGGCTGGG + Intergenic
1164129921 19:22352275-22352297 GTCTCCTCTTTGCTGGGTCCAGG - Intergenic
1166707510 19:44916191-44916213 GGGTCCCCTGGGCTGGGGCTGGG - Exonic
1166709538 19:44927796-44927818 GAGCCCCCTAGGCTGGGGCTGGG - Intergenic
1168272125 19:55255712-55255734 GACTGCCCTCAGCCGGGGCTGGG + Intronic
1168290463 19:55354780-55354802 GGCTCCCATTGGCTGGGGCTCGG - Exonic
925159462 2:1673869-1673891 GAAACCCCTGTGCTGGGGATGGG - Intronic
925898299 2:8489926-8489948 GATTCCCCTGTGCTGTGTCTGGG - Intergenic
926987600 2:18640668-18640690 CACTTCCCTTGGCTGGGGGTGGG + Intergenic
927126709 2:20018985-20019007 GACTGCCCTGTGCTGGGCATTGG + Intergenic
929520258 2:42643228-42643250 CAGTTTCCTTTGCTGGGGCTTGG + Intronic
930469599 2:51795471-51795493 GACTCTCCTTGGGTGGCGCTTGG - Intergenic
930607608 2:53508834-53508856 GACTCCCCTGTGGTGAGACTGGG + Intergenic
932379447 2:71269236-71269258 TACTTCCCTTGGCTGGGGATGGG - Intergenic
932812142 2:74834484-74834506 GACTGCTTTGTGCTGGGGCTCGG - Exonic
934566481 2:95344322-95344344 CACTCCCCTTCCCTGGGACTTGG - Intronic
935017797 2:99200648-99200670 GACTCCCCTGGGGTGGGGCGGGG + Intronic
937697277 2:124821807-124821829 GACTCCCAATTTCTGGGGATGGG + Intronic
938079820 2:128363933-128363955 GAGCCCCCTTTGCAAGGGCTTGG + Intergenic
938158011 2:128957926-128957948 CACTGCCCTTTGCTGGGGGTGGG - Intergenic
938959336 2:136327184-136327206 AAGTCCCTTTTGCTGAGGCTGGG + Intergenic
939180247 2:138795264-138795286 CACTTCCCTTGGCTGGGGGTGGG + Intergenic
939976333 2:148720712-148720734 CACTTCCCTTGGCTGGGGATGGG + Intronic
941688940 2:168478326-168478348 CACCCCTCTCTGCTGGGGCTGGG + Intronic
943470940 2:188292665-188292687 GCCTCCCTTTTGTTGGCGCTGGG + Intronic
944119523 2:196226089-196226111 CAATCCCCATTGCTGGGGGTGGG + Intronic
945208659 2:207359113-207359135 GACTCTCCCTTCCTGGGTCTGGG - Intergenic
948845826 2:240682432-240682454 GACGCGCCTCTGCTGGGCCTGGG - Exonic
948885995 2:240885106-240885128 GCCTCCCCTCTGATGGGGATTGG + Intergenic
1168858501 20:1027949-1027971 GACTCCCCTGGGTTGGGGATAGG - Intergenic
1172020202 20:31908580-31908602 CACTCCCCTTCGCTGGGGGTGGG - Exonic
1173499087 20:43539405-43539427 GCCTCCCCCTTGGTGGGGCCTGG - Intronic
1173505750 20:43585806-43585828 GCCTCCCCTTAGCTAGGGCCAGG + Intronic
1173510483 20:43624332-43624354 GACTCCATTTTCCTGGGACTTGG - Intronic
1173550593 20:43930596-43930618 CACTCCCAGTTGCTTGGGCTGGG + Intronic
1174804084 20:53592367-53592389 GACTACCCTTTTCTGGGGGGTGG + Intronic
1175592010 20:60200683-60200705 CACTTCCCTTGGCTGGGGGTGGG + Intergenic
1175875856 20:62228967-62228989 GACTCCCCTCCCCTGGGTCTGGG + Intergenic
1175921659 20:62453112-62453134 GGCTGCCCTTCCCTGGGGCTTGG + Intergenic
1176091338 20:63319863-63319885 AACCCCCCCTTGCTGGGCCTCGG - Intronic
1176236759 20:64057011-64057033 CCCTCCTGTTTGCTGGGGCTCGG + Intronic
1176371795 21:6066790-6066812 GTCTCCTCCTGGCTGGGGCTGGG - Intergenic
1177117529 21:17104506-17104528 CACTTCCCTTTGCTGGGGGTGGG - Intergenic
1178342992 21:31801777-31801799 CTCTCCCCTTTGCTGAGGTTGGG + Intergenic
1179751724 21:43471749-43471771 GTCTCCTCCTGGCTGGGGCTGGG + Intergenic
1181002052 22:19992464-19992486 GGCTCCCCTGTGTTGGGTCTGGG - Intronic
1181491271 22:23262309-23262331 GCCTCCCCTTGGCTGGTGCTGGG + Intronic
1181621779 22:24096226-24096248 AACTCCCATTTGCTGGGCCAAGG + Intronic
1182194782 22:28505506-28505528 TACTTCCCTTGGCTGGGGGTGGG - Intronic
1183089681 22:35513181-35513203 GAGTCCCCATTGCTAGAGCTTGG - Intergenic
1184242402 22:43218055-43218077 CACTCCTCTGTGCTGGGCCTCGG - Intronic
1184430266 22:44438279-44438301 GACTCCCCTGTGAAGGGCCTGGG + Intergenic
1184449876 22:44576524-44576546 GCCTCCCCTTTCCCAGGGCTGGG - Intergenic
1185156009 22:49193980-49194002 GACTCCCCTTGGCTGGCACTGGG + Intergenic
950587316 3:13903914-13903936 CACTTCCCTTGGCTGGGGGTGGG - Intergenic
954578159 3:51688176-51688198 GATACCCCTTTCCTGGGACTTGG - Intronic
958816983 3:98927696-98927718 CACTTCCCTTGGCTGGGGTTGGG - Intergenic
962923896 3:139974498-139974520 ATCTCCCCTTTGCTGGGCCCTGG - Intronic
965152580 3:164998469-164998491 TACTCACTTTTGCTGGTGCTAGG - Intronic
967574604 3:191076209-191076231 TACTTCCCTTGGCTGGGGTTGGG - Intergenic
969394593 4:6911804-6911826 GCATCCCCTGTGCTGAGGCTGGG - Intronic
969486642 4:7475951-7475973 CAGTCTCCTTGGCTGGGGCTGGG + Intronic
969497197 4:7533019-7533041 GAATCCCCAGGGCTGGGGCTGGG - Intronic
984883313 4:184429160-184429182 TTCTCTCCTTTCCTGGGGCTGGG + Intronic
984990092 4:185371859-185371881 GACTGCCCTGAGCTAGGGCTCGG + Intronic
985646255 5:1086057-1086079 GGATCCCCTTTGGTGGGGGTGGG - Intronic
986682417 5:10246132-10246154 GAATCCCCTATTCTGGGGCCTGG + Intronic
987260112 5:16194955-16194977 CACTTCCCTTGGCTGGGGGTGGG - Intergenic
987901916 5:24023456-24023478 GATTCTCCTTGGGTGGGGCTTGG - Intronic
988732128 5:33982882-33982904 GCCTGACCTTTGCTGGGGCTGGG - Intronic
995685434 5:114766800-114766822 CACTTCCCTTGGCTGGGGATGGG + Intergenic
996778852 5:127161027-127161049 CACTTCCCTTGGCTGGGGGTGGG + Intergenic
997389363 5:133501297-133501319 AACTTTCCTTTGCTGGGGATTGG + Intronic
999042382 5:148428313-148428335 GACTTGACGTTGCTGGGGCTGGG + Intronic
999805243 5:155074861-155074883 GCTTCCTCTTTGCTGGAGCTGGG + Intergenic
1001177142 5:169480913-169480935 GACTCTTCTTAGGTGGGGCTTGG + Intergenic
1002754725 6:148275-148297 CACGCCCCTGTGCTGGGGGTGGG + Intergenic
1002967077 6:1977673-1977695 CACTTCCCTTGGCTGGGGGTGGG - Intronic
1005960306 6:30688917-30688939 TACTACCATGTGCTGGGGCTGGG - Exonic
1006398928 6:33804706-33804728 GGCTCGCTGTTGCTGGGGCTGGG + Intergenic
1006436323 6:34027746-34027768 GATTTCCCTGTGCTGGGGCCTGG - Intronic
1006706805 6:36027775-36027797 GGCTCCCGTTTGCTGGCTCTTGG + Exonic
1006830826 6:36967268-36967290 GACTCCCCTCTGAAGGGCCTGGG + Intergenic
1007299490 6:40856036-40856058 GTCTCCCTTTTTCTGGGGCCAGG + Intergenic
1011424734 6:87214054-87214076 GACTCACTTTTGCAGGTGCTGGG - Intronic
1011746694 6:90413506-90413528 GCTTCCCCTTTCCTGGGGCAAGG - Intergenic
1012086436 6:94831731-94831753 GACTCCCCTATACTGGGCATAGG + Intergenic
1012093768 6:94932383-94932405 CACTTCCCTTGGCTGGGGGTGGG + Intergenic
1013007672 6:106089032-106089054 GCAGCTCCTTTGCTGGGGCTGGG + Intronic
1016528914 6:145036709-145036731 CACTCCCCTCTGCTGTGCCTTGG + Intergenic
1017432817 6:154387207-154387229 CACTCCTCCTTGCTGGTGCTGGG + Intronic
1019053619 6:169203645-169203667 GATTGGCATTTGCTGGGGCTGGG - Intergenic
1019274881 7:171051-171073 GCCTCCCCTGGGCTGAGGCTGGG + Intergenic
1019351083 7:554286-554308 GGCTCTCCTGTGCGGGGGCTTGG - Intronic
1021340237 7:19455750-19455772 GACTCTCCTTGGGTGGGGCTTGG + Intergenic
1022499145 7:30871694-30871716 GACATCCCTTTTCTGAGGCTTGG + Intronic
1024427169 7:49239749-49239771 GAGTCCACTGTGCTGGGGGTGGG + Intergenic
1026870920 7:73850950-73850972 AGCTCCCCTTTCCTGGGGATAGG + Intergenic
1027371735 7:77513184-77513206 GACTCCCCATTGCTGCAGCAGGG + Intergenic
1027371763 7:77513463-77513485 GACTCCCCATTGCTGCAGCAGGG + Intergenic
1028190643 7:87846982-87847004 GATTTCCCTTTGGAGGGGCTGGG - Exonic
1032013341 7:128360671-128360693 CCCTCCCGTTTCCTGGGGCTGGG + Intronic
1034496710 7:151427548-151427570 GACCCAGCCTTGCTGGGGCTGGG - Intergenic
1034694478 7:153041794-153041816 GGCTCCCATGTGCAGGGGCTGGG - Intergenic
1034878702 7:154747758-154747780 GTCTCCGCATTGCTGAGGCTGGG - Intronic
1035729786 8:1845897-1845919 GACACTCCTCTGCTGGGGCTGGG + Intronic
1039448276 8:37649659-37649681 TACTGCCCTTTGGTGGGGCTGGG - Intergenic
1046702631 8:117418568-117418590 CACTTCCCTTGGCTGGGGGTGGG - Intergenic
1048885929 8:138909804-138909826 GACTTCCCTTTGCTTGTGCCAGG + Intronic
1048934832 8:139346164-139346186 ATCTCCCCTTTCCTGGGGTTTGG - Intergenic
1049098166 8:140560928-140560950 GTCTCCCCACGGCTGGGGCTGGG - Intronic
1049328182 8:142034907-142034929 GACTGCACTGTGCTGGGGGTCGG - Intergenic
1049872439 8:144991029-144991051 GGCTTCCCTTAGCTGGGGCAGGG + Intergenic
1055101219 9:72467567-72467589 CACTGCCCTTTCCTGGGGTTGGG + Intergenic
1056081265 9:83096422-83096444 GACCCACCTTTGCTGGGGTCTGG + Intergenic
1058128877 9:101227017-101227039 CAGGCACCTTTGCTGGGGCTTGG - Intronic
1058707909 9:107652458-107652480 GGCTCCCCTTTGCTTCAGCTTGG + Intergenic
1058743647 9:107968523-107968545 GTTTCTCCTTTGCTAGGGCTCGG - Intergenic
1059407555 9:114110971-114110993 GACTCTCTGTGGCTGGGGCTAGG - Intergenic
1060781472 9:126416340-126416362 GACTCCCTGGTGCTGGCGCTGGG + Intronic
1060811436 9:126613279-126613301 CACTCCCCGTTCCTGGGCCTGGG + Intergenic
1060934476 9:127507260-127507282 GACTCCGGGGTGCTGGGGCTGGG + Exonic
1061004068 9:127918450-127918472 GCCTCCCCTATCCAGGGGCTGGG + Intergenic
1062000242 9:134212191-134212213 TCATCCCCTTTGCAGGGGCTGGG - Intergenic
1062161015 9:135079905-135079927 GACTACTGTTTGCTGGGTCTCGG + Intronic
1062346100 9:136116018-136116040 GTGTCCCGTTGGCTGGGGCTGGG + Exonic
1062352152 9:136144473-136144495 GACTTCCCTCTGCTGGGTCACGG + Intergenic
1062429775 9:136521789-136521811 GCTTCCCCTTTGCAGGGGCCAGG + Intronic
1062434746 9:136541954-136541976 TTGTCCCCTTTGCTGGGGCCTGG - Intronic
1187173225 X:16870891-16870913 GACTGGCCTTTCCTGGGGCCCGG + Intergenic
1191252661 X:58266922-58266944 GCAGCCCCTTTGCCGGGGCTGGG - Intergenic
1191638641 X:63406202-63406224 GAATTCCCTTTTCTTGGGCTGGG + Intergenic
1192292678 X:69814757-69814779 GGCTTCCCTTGGCTGGGGATGGG - Intronic
1192492824 X:71591167-71591189 GACTCCCCTGGGCTGGAGTTTGG + Intronic
1192493077 X:71593378-71593400 GACTCCCCTGGGCTGGAGTTTGG + Intronic
1192726887 X:73763459-73763481 GACCCCCCTTTGCAGGGACATGG - Intergenic
1193360614 X:80574682-80574704 GACTGCTTTGTGCTGGGGCTCGG + Intergenic
1193595493 X:83439695-83439717 CACTTCCCTTGGCTGGGGGTGGG + Intergenic
1194466203 X:94237665-94237687 GACTCTCCTTGGGTGGGCCTTGG + Intergenic
1197048599 X:122030407-122030429 TACTCCCCTTTGCTGGGTATTGG + Intergenic
1199929579 X:152504993-152505015 AACTCCCCTCTCCTGGGGCAGGG - Intergenic
1200228285 X:154431432-154431454 GACTCTCCTTTTCTCTGGCTGGG + Intronic
1200237967 X:154478321-154478343 AACCACCCTTTGGTGGGGCTCGG + Exonic