ID: 918306116

View in Genome Browser
Species Human (GRCh38)
Location 1:183248471-183248493
Sequence CTGGATCCACATGGTCTTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918306116_918306119 -5 Left 918306116 1:183248471-183248493 CCCTCAAGACCATGTGGATCCAG 0: 1
1: 0
2: 1
3: 15
4: 125
Right 918306119 1:183248489-183248511 TCCAGCTGAATCCTCAGCCCTGG 0: 1
1: 0
2: 3
3: 34
4: 288
918306116_918306127 15 Left 918306116 1:183248471-183248493 CCCTCAAGACCATGTGGATCCAG 0: 1
1: 0
2: 1
3: 15
4: 125
Right 918306127 1:183248509-183248531 TGGGACTAGACTAAGGTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 73
918306116_918306121 -4 Left 918306116 1:183248471-183248493 CCCTCAAGACCATGTGGATCCAG 0: 1
1: 0
2: 1
3: 15
4: 125
Right 918306121 1:183248490-183248512 CCAGCTGAATCCTCAGCCCTGGG 0: 1
1: 0
2: 1
3: 34
4: 282
918306116_918306126 14 Left 918306116 1:183248471-183248493 CCCTCAAGACCATGTGGATCCAG 0: 1
1: 0
2: 1
3: 15
4: 125
Right 918306126 1:183248508-183248530 CTGGGACTAGACTAAGGTTGAGG 0: 1
1: 0
2: 0
3: 6
4: 116
918306116_918306123 8 Left 918306116 1:183248471-183248493 CCCTCAAGACCATGTGGATCCAG 0: 1
1: 0
2: 1
3: 15
4: 125
Right 918306123 1:183248502-183248524 TCAGCCCTGGGACTAGACTAAGG 0: 1
1: 0
2: 1
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918306116 Original CRISPR CTGGATCCACATGGTCTTGA GGG (reversed) Exonic
907283669 1:53367076-53367098 CTTGCTCCACATGGAGTTGAGGG + Intergenic
911301416 1:96179220-96179242 CTGATTCCCCATGGTCTAGAAGG + Intergenic
911799512 1:102118043-102118065 CTGGATTAACATGGTGTTGAAGG - Intergenic
912597093 1:110890075-110890097 TGGGAATCACATGGTCTTGAGGG - Intronic
914192773 1:145425574-145425596 CTGGATCCTCAGGGTCTCGCCGG + Intergenic
916951557 1:169785416-169785438 CAGGTTACACATGGACTTGAAGG + Intronic
918306116 1:183248471-183248493 CTGGATCCACATGGTCTTGAGGG - Exonic
919463490 1:197905801-197905823 CTGGATCCACATAGTTTAGCTGG - Exonic
1064033760 10:11899523-11899545 CTGGATCTAGATGGTCTAGATGG - Intergenic
1069785807 10:70987337-70987359 CTGGATCCTCAAAGTCTTGTTGG + Intergenic
1070565597 10:77601764-77601786 CAGGAACCACATGGACTTCAAGG + Intronic
1072198418 10:93137200-93137222 ATGGATCCACATGGACTTATTGG - Intergenic
1073597518 10:104815878-104815900 CTGGAACTACATGGTCTTATGGG - Intronic
1077336906 11:2009359-2009381 CTGGATCCACAGGCCCTGGATGG - Intergenic
1077359825 11:2135980-2136002 CTGGATGCACATGCTCTGTAGGG - Intronic
1081193920 11:40138019-40138041 CTGGATCCTAATGTTCTTCATGG - Intronic
1083495418 11:63047815-63047837 CTGGTTCCCCATGGGCTTCAAGG + Intergenic
1086739991 11:90354698-90354720 CAGGATCCACCTGTTCCTGAAGG - Intergenic
1087933726 11:104006868-104006890 CAGGTTCCACATGGACTTGAAGG - Intronic
1089393417 11:118117433-118117455 CTGGATCTACAATGTCTGGAAGG + Exonic
1089929410 11:122294915-122294937 CTGGACCCACATGGTGTTGATGG + Intergenic
1202819890 11_KI270721v1_random:64541-64563 CTGGATCCACAGGCCCTGGATGG - Intergenic
1094716439 12:33019067-33019089 CTGATTACACATGGGCTTGAGGG - Intergenic
1095351945 12:41223855-41223877 CTGGACCCACAGGGTCATAAAGG - Intronic
1097238313 12:57555053-57555075 CTTGATCCAGATTTTCTTGAAGG - Intronic
1099491454 12:83293062-83293084 CTGGATCCACATGGGGCTTAGGG + Intergenic
1103853749 12:123950362-123950384 CTGGATCCACTGGCTCTCGAGGG + Intronic
1104860277 12:131919842-131919864 CTGGCTCCCCGTGGCCTTGAGGG - Intronic
1105272893 13:18894431-18894453 CTGGATCCACCTTGTCCTCATGG - Intergenic
1106102840 13:26709363-26709385 CTGAATGCAGATGGTCTTGGCGG - Intergenic
1108497372 13:51038997-51039019 ATGGATAAACATGGTCTTTACGG - Intergenic
1108698229 13:52921567-52921589 CTAAATCCACATGGTTGTGAAGG - Intergenic
1110345262 13:74439699-74439721 CTGGCTAAACTTGGTCTTGAAGG + Intergenic
1113703364 13:112406174-112406196 CTGGAGACACATGGTGGTGATGG - Intronic
1115205915 14:30904072-30904094 GTTGATCCTCATGGTCTTCATGG - Intronic
1119974717 14:79012672-79012694 CTGGATCCAGATGGTCTTCTGGG - Intronic
1120063679 14:80014767-80014789 CTGGATCTACTTGATCTGGAGGG + Intergenic
1121796010 14:96735870-96735892 CTGTATACACATGGTATAGAGGG + Intergenic
1121985749 14:98503997-98504019 CTCGATTCACATACTCTTGAGGG - Intergenic
1126329053 15:47512400-47512422 CTGGATCCTCCTGTTGTTGATGG - Intronic
1129269502 15:74411936-74411958 CTGGATCTCCATGATGTTGAAGG + Exonic
1129656008 15:77526252-77526274 CTTCATGCAGATGGTCTTGATGG - Intergenic
1135479361 16:22809393-22809415 GTGGAGCCACATGGTCTGCAGGG - Intergenic
1137772422 16:51027105-51027127 CTGAGTCCACATGGTCTGGAAGG + Intergenic
1138449119 16:57082534-57082556 CTGGATTCCAAAGGTCTTGAGGG - Exonic
1141115916 16:81309150-81309172 CTGGATCAGCGTGGTCTTGGTGG + Intergenic
1142176824 16:88649249-88649271 TTGTCTCCACATGGTCTTGTTGG + Intronic
1142895214 17:2972213-2972235 CTAGATCTAGATGGTCTTGCAGG + Intronic
1143274046 17:5696699-5696721 CTGGAGCCCCCTTGTCTTGAGGG + Intergenic
1146279409 17:31535641-31535663 CTGGATCCACCAGCTCCTGAAGG - Exonic
1149758773 17:59210294-59210316 CTGGATCCCCAGGATCTTGGTGG - Exonic
1150181140 17:63122294-63122316 CTTGTTCCACATGGTTTTGCAGG - Intronic
1151829485 17:76541113-76541135 CTGGAGCCATGTGGTCTTTAGGG + Intronic
1152280533 17:79382558-79382580 CTGGTTCCACATGTGCTTGCTGG + Intronic
1152304901 17:79514727-79514749 GTGGATCCACATGGCCTGGGGGG - Intronic
1153377418 18:4396387-4396409 CTGGGTCCTCATGATCATGAAGG - Intronic
1154464671 18:14632009-14632031 CTGGATCCACCTTGTCCTCATGG - Intergenic
1158496650 18:57961014-57961036 CTGGAGACACATGGTGGTGATGG + Intergenic
1160839882 19:1141569-1141591 CTGGATCCACGTGTCCTTCATGG + Intronic
1161669223 19:5595590-5595612 CTGGCCCCACATGGTGTAGATGG + Intronic
1164914779 19:32043807-32043829 CTGGATCCAAATAGTCTAAAAGG - Intergenic
1165144102 19:33720687-33720709 CTGTGTCCCCATGGTCTTGAGGG - Intronic
1167536185 19:50053335-50053357 CTGGATCCATCTGTTCCTGAAGG + Intronic
1167536779 19:50058606-50058628 CTGGATCCATCTGTTCCTGAAGG + Intergenic
925530234 2:4851061-4851083 GTGGATACACATTGTCTTGTAGG + Intergenic
927494449 2:23543178-23543200 CTCTAACCACATGGTCTAGAGGG + Intronic
929554980 2:42920547-42920569 GTGGTGCCACATGGTCTTGAAGG + Intergenic
933001619 2:76931635-76931657 CTGGATACACATGTTCTCTATGG + Intronic
933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG + Intergenic
937095918 2:119235086-119235108 CTGGATCCCCAAGATCTTCATGG + Intronic
938062076 2:128262050-128262072 CTGGGCCCACATGGTTTTGCTGG + Intronic
939417874 2:141924409-141924431 GGGGATACACATGGGCTTGAAGG - Intronic
946046917 2:216829086-216829108 CTGGATAGAGATGGTCTGGAGGG - Intergenic
947986273 2:234450322-234450344 CTGGACCGACAGGGGCTTGAAGG + Intergenic
1170429688 20:16264704-16264726 CTGGATCCAGATTGTTTTCAAGG + Intergenic
1170932647 20:20782721-20782743 CTGCAAACACATGGTCTTGAGGG + Intergenic
1171973846 20:31581457-31581479 CAGGATTCACATGGTAATGAAGG + Intergenic
1175621719 20:60453173-60453195 GTGTAAGCACATGGTCTTGAGGG + Intergenic
1175873271 20:62218250-62218272 CTGGATGCAGATGGTCCTGAAGG - Intronic
1176809867 21:13526374-13526396 CTGGATCCACCTTGTCCTCATGG + Intergenic
1183710450 22:39500361-39500383 CTAGATCCACTTGCTCTTCAGGG - Intronic
1184965237 22:47966616-47966638 CTGGATCCCCATGCCCTTGCTGG + Intergenic
949893679 3:8753147-8753169 CTGGATCTACATGCTGTTCACGG - Exonic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
960396599 3:117145181-117145203 CTGGCTTCACAAGGTTTTGATGG - Intergenic
961494945 3:127284575-127284597 CTGGGTCTACAGGGTCTTCACGG + Intergenic
963592700 3:147283182-147283204 CTGAAACCACATGGTGTTTAAGG - Intergenic
970046658 4:11861920-11861942 CAGGTTGCACATGGACTTGAAGG - Intergenic
974550208 4:63362784-63362806 CTGGTCACACATGGACTTGAAGG + Intergenic
979133036 4:117072753-117072775 ATGGATGCACATTGTCTAGATGG - Intergenic
993674965 5:90806011-90806033 CTTGATTCACAGGGTCTTGTTGG + Intronic
1001278114 5:170365667-170365689 CTGGATCCTCAAGGGCTGGAGGG - Intronic
1003501536 6:6707253-6707275 CTGCTTCCGCATGGGCTTGAGGG - Intergenic
1003503407 6:6721102-6721124 CTGGAGGCAGATGGTGTTGATGG + Intergenic
1003793646 6:9575652-9575674 CAGGCTCCAAATGGTTTTGATGG + Intergenic
1006054819 6:31376421-31376443 GTGGAATCACAGGGTCTTGAGGG + Intergenic
1006133086 6:31880319-31880341 CAGGATCCACAGGGTCTTCGGGG - Intronic
1006173382 6:32108136-32108158 CTGGGTCCCCAGGGACTTGAAGG + Intronic
1006527645 6:34621013-34621035 CAGAAACCACATGATCTTGATGG - Intronic
1008056234 6:46948809-46948831 TTGGATCAATGTGGTCTTGAGGG - Intronic
1008566164 6:52770651-52770673 CTGGACTCAAATGGTCTGGATGG + Intergenic
1008570412 6:52811314-52811336 CTGGACTCAAATGGTCTGGATGG + Intergenic
1010082630 6:71881905-71881927 CTGGATGAACATGGTTTTGTAGG + Intergenic
1017180951 6:151551554-151551576 CTGGAGTCACTTGCTCTTGAGGG + Intronic
1017522515 6:155214282-155214304 CTGGCTCCTGGTGGTCTTGATGG - Intronic
1021455836 7:20828834-20828856 CTGAATCGACATGGTCAGGATGG + Intergenic
1026175840 7:67996120-67996142 CTGGATCCAAAGGGTCTTGCTGG + Intergenic
1027476637 7:78640050-78640072 CTAGATCCATATGGTCTTTTAGG + Intronic
1027847551 7:83401508-83401530 CTGAAACCACATGGTCTTAAAGG - Intronic
1030742748 7:113129146-113129168 CTCGATCCACAGGGTCTAAAAGG - Intergenic
1031839996 7:126726385-126726407 CTGGATCCACATGCTTGTGAAGG - Intronic
1032284436 7:130530203-130530225 ATGGATCCAGATGGGCTTGATGG + Intronic
1033853462 7:145526879-145526901 CAGGATCCAGACGGTCTTGCAGG + Intergenic
1035911798 8:3575048-3575070 TTGGATCCACATGTTCTCGCTGG + Exonic
1039109379 8:34024965-34024987 CTGGATTCCTATGCTCTTGAGGG + Intergenic
1039994204 8:42517576-42517598 CATGAACCACATGGTATTGATGG - Intronic
1041128375 8:54668525-54668547 TTGGTTCCACATGAACTTGAAGG - Intergenic
1044561334 8:93615343-93615365 CTGGTTCCACATAGTGTTTATGG - Intergenic
1045544674 8:103117969-103117991 CTGGATCCATATGGCCTTGCTGG - Intergenic
1046734209 8:117758853-117758875 CTGAATTTGCATGGTCTTGAAGG + Intergenic
1047541851 8:125775335-125775357 GTGTATCCACATGGTCGAGAGGG - Intergenic
1049400242 8:142423314-142423336 CTGTATCCTCATGGTGGTGATGG + Intergenic
1051263490 9:15288607-15288629 CAGGTTGCACATGGACTTGAAGG - Intronic
1051323342 9:15935070-15935092 CTGGAACTACATGGTGGTGATGG + Intronic
1051589072 9:18757680-18757702 CTGAAGCCACATGGTGTTCAGGG + Intronic
1056332062 9:85529154-85529176 CTGGCTCCACATGGCCCTGGAGG - Intergenic
1058838820 9:108885782-108885804 CTGGATCCACACAGACATGAGGG + Intronic
1059399736 9:114061367-114061389 CTGGAGGGACAGGGTCTTGAGGG + Intronic
1060983388 9:127806562-127806584 TTGGGCCCACATGGCCTTGAGGG + Intronic
1186759520 X:12708914-12708936 CTGGATCCAGAGGGTTTTCATGG + Intronic
1187075668 X:15931993-15932015 CTGGAATCATATGGTTTTGAAGG - Intergenic
1189338103 X:40183108-40183130 CTGGAGCCACATGTTTCTGAAGG - Intergenic
1190717344 X:53115284-53115306 CTGTGTCCACAAGGTCTTGCTGG + Intergenic
1192895266 X:75436627-75436649 ATGTATTCACATGGTTTTGAAGG + Intronic
1193222616 X:78944637-78944659 CTGTATTCACATAGTTTTGAAGG + Intergenic
1193541004 X:82772725-82772747 ATGTATCCACATGGTTTTGAAGG + Intergenic
1195105139 X:101596337-101596359 CTGGCTCCACATATCCTTGAAGG - Intergenic
1195316194 X:103680737-103680759 CCTTATACACATGGTCTTGAAGG + Intronic
1197668833 X:129253392-129253414 CTGTATCCCCAAGGTTTTGATGG + Intergenic
1199541354 X:148960976-148960998 CTGGAACCACGGGGTCTTTAAGG - Intronic
1199581868 X:149368520-149368542 CTGGACTCACAGGGTCTTGCTGG + Intergenic
1200208634 X:154335410-154335432 CTTGCTGCACTTGGTCTTGATGG - Intergenic