ID: 918307198

View in Genome Browser
Species Human (GRCh38)
Location 1:183258102-183258124
Sequence TCTCCTCCATGGGCTCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918307198_918307203 -3 Left 918307198 1:183258102-183258124 CCTACAGGAGCCCATGGAGGAGA 0: 1
1: 0
2: 4
3: 29
4: 286
Right 918307203 1:183258122-183258144 AGAGGCACCAACAGGTATAAAGG 0: 1
1: 0
2: 2
3: 15
4: 203
918307198_918307205 17 Left 918307198 1:183258102-183258124 CCTACAGGAGCCCATGGAGGAGA 0: 1
1: 0
2: 4
3: 29
4: 286
Right 918307205 1:183258142-183258164 AGGACTCCAGTGACACATTTTGG 0: 1
1: 0
2: 1
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918307198 Original CRISPR TCTCCTCCATGGGCTCCTGT AGG (reversed) Intronic
900083780 1:877012-877034 GCTCCTTCCTGGGCCCCTGTCGG - Intergenic
900565491 1:3329863-3329885 GCTCAGCCATGGGCACCTGTGGG - Intronic
901146964 1:7071699-7071721 TCTACTCTCTGGGCTCCTATTGG + Intronic
901162937 1:7193803-7193825 TCTCCTCCGAGTGCTCCTTTAGG + Intronic
901416396 1:9119725-9119747 TCTCCTCCATGAGCTGGTGGAGG - Intronic
902650404 1:17833573-17833595 CCACCTCCATGGCCTCCTGATGG - Intergenic
902988642 1:20171066-20171088 CCTCCACCCTGGGCTCCTGTGGG - Intronic
903549569 1:24148580-24148602 TCACTTCCCTTGGCTCCTGTGGG - Intergenic
905790365 1:40786190-40786212 TGCCCTCCGTGGGCTCCTCTTGG + Intronic
907980091 1:59472367-59472389 CCTGTTCCGTGGGCTCCTGTGGG + Intronic
911010797 1:93278979-93279001 TCTTCTCCATTGTCTCCTTTTGG + Intergenic
914258283 1:145977973-145977995 TCTTCTCCAGGGTCTCATGTGGG - Exonic
914438402 1:147680844-147680866 CCCCCTCCGTGGACTCCTGTGGG - Intergenic
914915219 1:151815290-151815312 TCTGCTCCTTGGGCCCCTGCTGG + Exonic
915732857 1:158066612-158066634 CTGCCTCCATGTGCTCCTGTAGG + Intronic
915834623 1:159166062-159166084 TCTCCTCCATGTGCTCTTTGAGG - Intergenic
916652698 1:166846030-166846052 GCTCCTCCCTGGGCAGCTGTGGG + Intronic
917437876 1:175039356-175039378 TCACCTCACTGGGCTGCTGTGGG + Intergenic
918307198 1:183258102-183258124 TCTCCTCCATGGGCTCCTGTAGG - Intronic
919741546 1:200984098-200984120 TATCCTCCATGTGCTGCTCTGGG - Intronic
919744447 1:200999906-200999928 TCTCCTCGCTGTTCTCCTGTTGG + Exonic
919756836 1:201071251-201071273 TCTCCATCATGGCCACCTGTAGG + Intronic
919837085 1:201582484-201582506 TTTCCTCCAGTGCCTCCTGTGGG + Intergenic
919872742 1:201835286-201835308 TATCCTCCATGCTCTCCTTTGGG + Intronic
919986108 1:202676299-202676321 TCTGCCCCATGGGCTCCTCCAGG - Intronic
920312689 1:205057994-205058016 GCTCCTCCGTGGACTCCTCTGGG - Exonic
920379123 1:205525755-205525777 TCACCTCTTTGGGCTCCTGGAGG - Intronic
920543438 1:206796467-206796489 TTTCCCCCATGAGTTCCTGTAGG + Intergenic
921094370 1:211874341-211874363 CCCCCCCCATGGGCTCCTGGCGG - Intergenic
922195081 1:223352822-223352844 TCGCCCCCATGGGCTCAGGTAGG - Intronic
924708003 1:246513617-246513639 ATTCATCCATGGTCTCCTGTGGG + Intergenic
1062985679 10:1766274-1766296 TCTCCTGCATGGACAACTGTGGG + Intergenic
1064985668 10:21207629-21207651 TCTCCTGCAGGGGCTCCCATTGG - Intergenic
1068789677 10:61013784-61013806 TTTCCTTCATGGGCACCTTTTGG - Intergenic
1071288748 10:84172952-84172974 TCGCCTCAAGGAGCTCCTGTTGG - Intergenic
1071554418 10:86591556-86591578 TTTCCTCCATGGGAAGCTGTGGG + Intergenic
1072734126 10:97867614-97867636 TGCCCTCCCTGGGCCCCTGTGGG + Exonic
1073069288 10:100783047-100783069 TCTGCTGCATGGGCTCCTGTGGG + Intronic
1074721504 10:116269904-116269926 TTTCTTCCATTGGCTCCTGGAGG - Intronic
1075913738 10:126148432-126148454 TCTCCTTAAGGGGCTCCTGCTGG + Intronic
1076180634 10:128404693-128404715 TCTCCTCTGTGTGCTCCTGATGG - Intergenic
1076304710 10:129457013-129457035 CCTCCTCCAGGGGCTTCTTTGGG + Intergenic
1076335276 10:129702647-129702669 TCTCCTGCACTGGCTCCTGCTGG + Intronic
1076585858 10:131547258-131547280 ACTCCTCCATGGATTCCTGAAGG + Intergenic
1077211729 11:1374222-1374244 TCCCCTCCATGGACTTCTGGGGG - Intergenic
1077465706 11:2732820-2732842 TCCCCTCCCTGGGCCCCAGTGGG - Intronic
1078264931 11:9747987-9748009 GCTGCTCCATGGCCTCCTGCAGG - Exonic
1079181441 11:18197194-18197216 ACTTCTTCATGGGCTCCTTTAGG + Intronic
1079259371 11:18863681-18863703 ACTTCTTCATGGGCTCCTTTAGG - Intergenic
1079261523 11:18887059-18887081 ACTTCTTCATGGGCTCCTTTAGG - Intergenic
1080585053 11:33674368-33674390 TCTTCTCCCTTGGGTCCTGTTGG - Intergenic
1081122456 11:39284402-39284424 TATACACCAAGGGCTCCTGTGGG - Intergenic
1081484367 11:43516349-43516371 CCTCCTCCCTGGCCTCCTGAGGG - Intergenic
1082272159 11:50183556-50183578 CCCACTCCGTGGGCTCCTGTGGG + Intergenic
1083183571 11:61004446-61004468 TCTCCTCCAGGGGCTCAGGCTGG + Intronic
1083860916 11:65419489-65419511 CCTTTTCCAGGGGCTCCTGTGGG + Intergenic
1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG + Intergenic
1087293386 11:96342582-96342604 TCTCCTCTTTGGGGTACTGTAGG + Exonic
1089677547 11:120099944-120099966 TCATCTCCATGGGATCGTGTGGG + Intergenic
1090229265 11:125089779-125089801 CCCGCTCCATGGGCTCCTGTGGG + Intronic
1090372351 11:126265393-126265415 TCTGCACCAGGGACTCCTGTAGG + Exonic
1091357499 11:134948782-134948804 TCTCCTCCATGGGCTCTCTAAGG + Intergenic
1091703679 12:2679849-2679871 TCTCCTCCACTGTCTCCTGAGGG - Intronic
1092077657 12:5686649-5686671 TCCCCTCCATGGGCCCCTCTGGG + Intronic
1092132114 12:6119940-6119962 ACTCCTCCATGAGCTCCTCAGGG - Intronic
1093974768 12:25409308-25409330 TCTTCTCCATTGTCTCCTTTTGG + Intronic
1094327600 12:29256925-29256947 CCTCCTCCGTGGTCTCCTGTGGG + Intronic
1094641728 12:32282457-32282479 TCCCCTCCCTGGCCTTCTGTTGG - Intronic
1096188637 12:49600193-49600215 CCTCCTCCCAGGGCTCCTCTTGG + Exonic
1096188692 12:49600547-49600569 CCTCCTTCATCGGTTCCTGTTGG + Exonic
1096973491 12:55685189-55685211 TCTCCTCCTTGAACTGCTGTCGG + Exonic
1097017880 12:56000224-56000246 CCTTCGCCGTGGGCTCCTGTGGG - Intronic
1098107218 12:67081857-67081879 ACGCCTGCATGGGCTACTGTGGG - Intergenic
1101572178 12:105963816-105963838 TCTCATCCATGGGGTCCAGAGGG - Intergenic
1101589145 12:106110975-106110997 TCTCCCACATTGGCTGCTGTGGG + Intronic
1101765692 12:107697130-107697152 CCTCCTTCATGGGGTGCTGTGGG - Intronic
1102040300 12:109796573-109796595 TCTCCTCCCTGGACACGTGTGGG - Exonic
1103280715 12:119756038-119756060 TCTCCTTTATAGGGTCCTGTGGG - Intronic
1103573550 12:121860225-121860247 TCTCCTCCATGGGAACCTTCTGG - Intronic
1103641374 12:122355240-122355262 TCTCCTTCAGGGCCTCCTGGAGG + Exonic
1103715243 12:122941223-122941245 TCGCTTCCATCTGCTCCTGTGGG - Intronic
1104119249 12:125783289-125783311 TCAATTCCATGGGCTCCTGTTGG - Intergenic
1104729673 12:131097962-131097984 CCTCCTGCCTGGGCTCCTGCTGG + Intronic
1106455913 13:29926621-29926643 CTTCCTCCTTCGGCTCCTGTTGG - Intergenic
1108212171 13:48150046-48150068 TCTAAGCCATAGGCTCCTGTTGG - Intergenic
1108378633 13:49836664-49836686 TCTGCTCCACGGCCTCCTGCAGG + Intergenic
1108467502 13:50731497-50731519 TCTCCTCCCTGGGAATCTGTTGG + Intronic
1112533133 13:100224127-100224149 CCCCCTCCCTGGGCTCCTGTGGG - Intronic
1112562973 13:100529941-100529963 TCCCTTCGATGGGCTCCGGTGGG + Intronic
1113877270 13:113602165-113602187 ACTCCTCCCTCGACTCCTGTGGG - Intronic
1114985096 14:28217178-28217200 ACTCCCCCATGGGCTGCTGATGG - Intergenic
1116144503 14:41046860-41046882 TCCACTCCATGGGCTCCTGAGGG + Intergenic
1116856428 14:49956247-49956269 TTTCCTCTATGAGCTCCTGGGGG - Intergenic
1117070160 14:52048966-52048988 TCTAGTCCATGGCCTCCTCTGGG + Intronic
1117071693 14:52063293-52063315 TCTCCTCTCTGGGATCCTGGGGG - Intronic
1117445226 14:55797909-55797931 ACTCCTCCATGGCTTCCTGTTGG + Intergenic
1117571651 14:57055089-57055111 TCGCCTCCATGGGCTACTTCTGG + Intergenic
1118234832 14:63992821-63992843 TCTCCTCCAAGGCCTCCTTGAGG - Intronic
1118475806 14:66115765-66115787 TCTGCTTCATGGTCTCTTGTTGG - Intergenic
1119030734 14:71190297-71190319 TCTCTCCCGTGGGATCCTGTGGG + Intergenic
1119180710 14:72603366-72603388 TCTCCTCCCCTGGCGCCTGTGGG - Intergenic
1119743092 14:77026909-77026931 GCTCCCCCAGGGGCTCCTGGGGG - Exonic
1121310112 14:92931353-92931375 ACTCCTGCATGGGCTCCGGGAGG - Exonic
1121417712 14:93790257-93790279 TAGCCTCCATGGGCACCTGCTGG + Intergenic
1121530602 14:94650003-94650025 TCTCTGCCATGGGCTCCTTGAGG - Intergenic
1121707739 14:96011681-96011703 TCTCCTCCACCAGCTCCTCTAGG + Intergenic
1122203394 14:100136126-100136148 GCTCCCACATGGGCTCCTGGGGG - Intronic
1122420753 14:101575633-101575655 CCTCCTGCCTGGGCTCCTGCTGG - Intergenic
1123799182 15:23803196-23803218 CCCGCTCCGTGGGCTCCTGTGGG + Intergenic
1126121232 15:45253334-45253356 GCTGCTGCATGGGCTCCTGTAGG + Intronic
1127395646 15:58542047-58542069 TCTCCTGCCTGGGCTGCTGTTGG - Intronic
1127704309 15:61532161-61532183 TCTCCTGCCTGGCCTGCTGTAGG + Intergenic
1128656679 15:69467757-69467779 TCCCCTCCCAGGGCCCCTGTTGG + Intergenic
1128749741 15:70140443-70140465 CCACCTCCAGTGGCTCCTGTAGG + Intergenic
1128766742 15:70255711-70255733 TGTCCTCCCTGGGCTCCTGCAGG - Intergenic
1129466324 15:75726134-75726156 GCTCCTCCATGGGGACCTGCGGG - Exonic
1130403591 15:83579279-83579301 TTTCCTCCAAGGCTTCCTGTGGG + Intronic
1130820237 15:87487441-87487463 TCTCTTCTATAGGGTCCTGTAGG - Intergenic
1131138747 15:89959906-89959928 CCACGTACATGGGCTCCTGTGGG + Intergenic
1132608008 16:801511-801533 TGTACCCCTTGGGCTCCTGTGGG + Intergenic
1132621815 16:871364-871386 TCTCGTGCAGGGGCTCGTGTGGG + Intronic
1132656720 16:1044558-1044580 TCTCCTCCCTGGGCTCCCAGAGG - Intergenic
1134392152 16:13830011-13830033 TCTCCTCCATGTGCCAGTGTTGG + Intergenic
1134576858 16:15339715-15339737 TCTCCCACATGGGCTCCCTTAGG + Intergenic
1134686978 16:16165850-16165872 GCTCTTCCAGAGGCTCCTGTGGG - Exonic
1135039013 16:19103397-19103419 TCTGCTCCATGAGCCACTGTTGG - Intergenic
1136077117 16:27824821-27824843 TCACCTCCTTGGGCATCTGTGGG - Intronic
1136275686 16:29178035-29178057 CCTCCTCCATCCCCTCCTGTGGG - Intergenic
1136309397 16:29397594-29397616 GCTCCTCTTTGGGCTCCTGCTGG - Intronic
1137074233 16:35942357-35942379 TTGCCTCAATGGGCTCCTGAAGG + Intergenic
1140211329 16:72972925-72972947 TCTCCTCCCTGTTCTCCTGTAGG + Intronic
1140311462 16:73852747-73852769 TCATCTCCATGTGATCCTGTTGG + Intergenic
1141907004 16:87033434-87033456 TTCCCCCCATGGGCTGCTGTGGG - Intergenic
1142089713 16:88203419-88203441 CCTGCTCCCTGGGCTGCTGTGGG - Intergenic
1142399456 16:89851737-89851759 TCTCCTCCATGAGATGCTGACGG - Intronic
1142432441 16:90037225-90037247 TGTCCTCCATCTGCTCCTGCAGG - Exonic
1145230406 17:21169752-21169774 ACTCCTCCGTGGGCCCCTGGAGG - Intronic
1147648740 17:42050246-42050268 CCTCCTCCCCGGGCTCCTGGGGG + Intronic
1147725168 17:42562466-42562488 TCCCCTCCCCCGGCTCCTGTCGG + Exonic
1148475791 17:47927869-47927891 TGTCCTCCCTGGGCCCCTGGTGG + Exonic
1149403095 17:56318960-56318982 TCTCCTAAGTGGACTCCTGTTGG + Intronic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1150614978 17:66763363-66763385 TCTCCTCCACTTGCTACTGTGGG - Intronic
1150712842 17:67546452-67546474 CCTCTTCCCTGTGCTCCTGTAGG + Intronic
1150818879 17:68418756-68418778 TCTCCTACAGGGGACCCTGTAGG - Intronic
1151178533 17:72309098-72309120 CCTCCTCCCTGGGCCACTGTAGG + Intergenic
1151224261 17:72636963-72636985 TCTCCTCCAGGGGCTCAAGTGGG - Intergenic
1151363077 17:73600228-73600250 TGCCATCCATGGGCTCCTGGAGG - Intronic
1152284004 17:79402064-79402086 CCTCCACCCTGGGCTCCTGGTGG - Intronic
1153517564 18:5918412-5918434 TCTCCTCAATGGGCCTCTCTGGG + Intergenic
1154118574 18:11633302-11633324 GCTCCTCTTTGGGCTCCTGCTGG - Intergenic
1154167160 18:12024591-12024613 TGTCCCCCATGGCCTCCTCTGGG + Intronic
1156246226 18:35301949-35301971 AATTCTCCATGGGCTCTTGTGGG + Intergenic
1156461830 18:37325601-37325623 CCTCCTCCATGGCGTGCTGTTGG + Intronic
1157136480 18:45061868-45061890 TCTTCCACATGGGCTCCTTTCGG + Intronic
1157762115 18:50272889-50272911 TCTCCTCCTTGTCCTCCTCTGGG + Exonic
1158305171 18:56097373-56097395 TCTCCTCCAGTGGCTCTTTTGGG + Intergenic
1159472908 18:68880073-68880095 CCCCCTCCATGGGCTCCCGTGGG - Intronic
1161947124 19:7444379-7444401 CCTCCTCCAGGGACTCCTGGCGG - Exonic
1162584640 19:11551524-11551546 TCTCCTCCTTGGAATCCTGATGG - Intronic
1162876489 19:13624480-13624502 TCTCTTCCACTGGTTCCTGTCGG + Intergenic
1163304599 19:16469955-16469977 TCTACACCATGGGTTACTGTTGG - Intronic
1163555507 19:17990168-17990190 TCTGATCCATGGGATCATGTAGG + Intronic
1164157758 19:22606873-22606895 TCTTCTCCAAAGGCTCCTCTAGG - Intergenic
1166521957 19:43486632-43486654 TCTCCGCCATGGCCTGCTGCAGG + Exonic
1167372287 19:49090329-49090351 TCCTCTCCATGCGCTCCTCTCGG - Exonic
925579618 2:5397255-5397277 TCTCCTACAGGGGCTCCTGTTGG + Intergenic
925766438 2:7240470-7240492 TTTCCTCCACTGGCTTCTGTAGG + Intergenic
925766492 2:7241325-7241347 TCTTCTCCACTGGCTTCTGTAGG + Intergenic
926091784 2:10055923-10055945 CCTCCTCCCTCGGCTGCTGTTGG - Intergenic
927117391 2:19918217-19918239 TCTCCTACAAGAGCTCCTGAAGG + Intronic
927877929 2:26671012-26671034 GCTCATCCATGGGCCTCTGTGGG - Intergenic
928936936 2:36688544-36688566 TGCCCTCCATGGGCTCCTTGCGG + Intergenic
931258674 2:60597916-60597938 TCTCCTTCTTTGCCTCCTGTGGG - Intergenic
931995471 2:67835290-67835312 ACTCCTGCATGTGCGCCTGTTGG + Intergenic
934502902 2:94873293-94873315 TTTCCTCCAGGGCCTTCTGTGGG - Intronic
936292731 2:111238916-111238938 TCTTCTCCAGTGGCTCCTGGAGG + Intergenic
936403661 2:112184293-112184315 GCTCCTCCATGGGCTGACGTGGG + Intronic
936851486 2:116904218-116904240 TTTCCTTCATGGGTTCCTCTGGG + Intergenic
937972222 2:127559634-127559656 TGTGCTCCAGGGGCTCCTATTGG + Intronic
938163703 2:129008653-129008675 TGTCCTCCCTGGGCTCCCATGGG - Intergenic
939738740 2:145880977-145880999 CCCCCTCCATGGGCTCCCGTGGG - Intergenic
939901785 2:147859306-147859328 ACTCTTCTAGGGGCTCCTGTAGG + Intronic
939957618 2:148540014-148540036 TCTCCTCCATGGACGGCTGTCGG - Intergenic
940215128 2:151296240-151296262 GCGCCTCCGTGGGTTCCTGTGGG + Intergenic
940869358 2:158847298-158847320 AGTCCTCCATGGGCTGGTGTAGG - Intronic
941712085 2:168724975-168724997 CCCCCTCCGTGGGCTCCTGTGGG - Intronic
944282876 2:197918310-197918332 TCTCCGCCTTAGGCTCCTCTCGG - Intronic
944539415 2:200741793-200741815 TCTCCTCACTGCACTCCTGTGGG + Intergenic
944699298 2:202231812-202231834 TCTTCTCCAATGGCTCCTTTTGG - Intronic
947941323 2:234058375-234058397 TCTCCTTGTTCGGCTCCTGTTGG + Intronic
948275579 2:236705559-236705581 TCCCCTCCATGTGCTCCGCTGGG + Intergenic
1170232367 20:14064136-14064158 TCTCCTCCGTGGGCTTCTGCTGG + Intronic
1172146821 20:32762975-32762997 TCTCCTCTTCGGGCTCCTGGAGG - Intronic
1172188101 20:33044089-33044111 TCTCCTCCATGGGGTGCAGGTGG - Intergenic
1172353614 20:34263064-34263086 TCAGCTCCCTGGGCTTCTGTGGG - Intronic
1172676741 20:36677675-36677697 CCTTCTCCAGGGCCTCCTGTCGG + Intronic
1173929858 20:46809541-46809563 TCTCCTCCCTTGTCACCTGTGGG - Intergenic
1174619281 20:51861908-51861930 TCACCTCCCAGGGCTCCTGATGG + Intergenic
1175308193 20:57992443-57992465 TCACCTCCCTGGGTTCCTGGAGG + Intergenic
1175780077 20:61676681-61676703 TCACTTCCATAGGCTCCTGGGGG - Intronic
1178363410 21:31968590-31968612 TCTCCTCCAGGTGCCCCTGCAGG - Intronic
1178586358 21:33874440-33874462 TGCCCTCCAAGGGCACCTGTTGG + Intronic
1178795309 21:35738608-35738630 TCTCCTCCATGGGCCCCCAATGG - Intronic
1178898935 21:36583726-36583748 TCCCCTGGATGGGATCCTGTGGG - Intergenic
1179191402 21:39125224-39125246 TTTGCTGCCTGGGCTCCTGTTGG - Intergenic
1179605009 21:42509503-42509525 TCTCCTCACTGGGCTCCTGTAGG + Intronic
1181053629 22:20249136-20249158 TCTCCACCAAGGGCTCATCTTGG + Intronic
1181462754 22:23095086-23095108 TCTCCTCCATGGGGCGCTGTAGG - Intronic
1181644564 22:24224184-24224206 GCTGCACCATGGGCTTCTGTGGG + Intronic
1182143230 22:27980615-27980637 TCTGCTCCATGTGCTGCTGGTGG + Exonic
1182941015 22:34277530-34277552 GCTCCACCATGGGAACCTGTGGG - Intergenic
1182990037 22:34758941-34758963 TCTTCTCCATGGTTTTCTGTTGG + Intergenic
1183297316 22:37037870-37037892 CCTCCTCCCTTGGCTCCTGGCGG - Intergenic
1183306642 22:37086382-37086404 CCTCCACCACGGGCTCCTGGCGG + Exonic
1183456863 22:37927615-37927637 ACTCCTCCCTGGCCTCCTCTGGG + Exonic
1184969614 22:48006488-48006510 GATCCTCCATGGGATCCTGTAGG - Intergenic
1185256367 22:49835176-49835198 TCTCCTCCAGGATGTCCTGTAGG + Intergenic
1185333153 22:50260633-50260655 TCACCCCCAGGGGCTCCTGAGGG + Intronic
950400936 3:12768870-12768892 GCCCCGCCATGGGCTCCTGCAGG - Intronic
953627552 3:44583387-44583409 TCTTCTCCATTGGCTCATGTAGG - Intronic
953755642 3:45643689-45643711 CCTGCTCCATGGGCTTCTGGCGG - Intronic
955641327 3:61088602-61088624 GTTCCTTCATTGGCTCCTGTTGG - Intronic
956259566 3:67323918-67323940 TCTCCTCCAGGGGCTCCCAATGG + Intergenic
956541168 3:70341239-70341261 GCTCTTCCATGGTCTCTTGTGGG - Intergenic
956742930 3:72289158-72289180 CCTCCTCCCTGGGCTGCTGGGGG + Intergenic
958139930 3:89549291-89549313 TTTCAGTCATGGGCTCCTGTTGG + Intergenic
959791635 3:110368657-110368679 TCTCATCTATGGTTTCCTGTAGG + Intergenic
962200399 3:133396587-133396609 TGTCCTCCATGGATTCCTGAGGG - Exonic
962267726 3:133955481-133955503 TCTCCTCCATGGGCACTGGTGGG + Intronic
962752323 3:138442566-138442588 TCTTGTCCATGGGCTCCTACAGG + Intronic
967874459 3:194257492-194257514 TTCCCTCCATGGGCCTCTGTTGG + Intergenic
968474062 4:794923-794945 TCTGCTCCAGGGGTGCCTGTGGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
970135392 4:12916449-12916471 TCTCCTCACTGGGCTACTTTAGG + Intergenic
971380557 4:26093446-26093468 TCTGCTGCATGTGCTACTGTTGG - Intergenic
977400116 4:96521409-96521431 TCCCCGCCGTGGGCTCCCGTGGG + Intergenic
978725523 4:111964951-111964973 TTTCCTCCATTGCCTCCTTTGGG - Intergenic
979499802 4:121426984-121427006 TCTCCTCTATGGCCTTCAGTTGG - Intergenic
984576576 4:181455368-181455390 TCTGCTCCATGGCATCATGTGGG - Intergenic
986372396 5:7092975-7092997 CCTCCTCCATTGGCTCTGGTGGG - Intergenic
987179621 5:15353848-15353870 TTTCCTCCATGGGCACGTTTTGG + Intergenic
987486348 5:18532320-18532342 TCTCCTACATGGCCAGCTGTAGG - Intergenic
987776415 5:22372888-22372910 CCACTTCCATGGGCTGCTGTGGG + Intronic
988359481 5:30216672-30216694 TCTTCTCCACGTGCTGCTGTTGG - Intergenic
988968758 5:36445290-36445312 CCTGCTCCAGGGGCTCCTCTGGG + Intergenic
990387486 5:55280569-55280591 TCTGGCCCATGGGCTCCTGCGGG - Intronic
990729868 5:58796533-58796555 TCTCTTCCATTGACTCATGTGGG - Intronic
992494589 5:77280333-77280355 TCTCCTCCCTGTCCTCCTGCAGG + Intronic
995837121 5:116410034-116410056 TCTTCTCCATTAGCTCCTGGAGG + Intronic
997848443 5:137309356-137309378 CCTCCTCTGTGGGCTCCTCTTGG + Intronic
999222256 5:149990064-149990086 TCTCATTCAGGGGCTCCTTTAGG + Intronic
999765991 5:154741279-154741301 TCCCCTCTCTGGGCTTCTGTAGG - Intronic
1003569492 6:7246863-7246885 TCTCGTCCTTGGGCTCCTGGCGG - Exonic
1003908169 6:10720873-10720895 CCACCTCCGTGGGCTCCTGTAGG + Intergenic
1005874231 6:29999108-29999130 AGTGCTCCTTGGGCTCCTGTGGG - Intergenic
1008007319 6:46424642-46424664 TCTGCTCCATTGGCTCCTTGAGG - Intronic
1008060306 6:46990007-46990029 TTTCCTTGATTGGCTCCTGTGGG - Intergenic
1009940164 6:70281315-70281337 TCTTTTCCCAGGGCTCCTGTGGG - Intronic
1011014999 6:82744748-82744770 CATCCTCCCTGGGCTGCTGTGGG + Intergenic
1012054894 6:94393823-94393845 TCACCTCCAAGGGTTCCTGATGG - Intergenic
1012725285 6:102803183-102803205 TTTGCTCCAGGTGCTCCTGTGGG + Intergenic
1015439384 6:133231053-133231075 TCTTCTCCTTTGGCTTCTGTGGG - Intergenic
1015790015 6:136957373-136957395 CCTCCTCCTTGAGCTCCAGTCGG - Intergenic
1018002166 6:159589031-159589053 CCTTCTCCATGGGATCCAGTAGG + Intergenic
1018540052 6:164869708-164869730 GCTCCACCATGGGCTCATGAGGG - Intergenic
1018963607 6:168466415-168466437 CCTGCTCCAGGGGCTCCTCTAGG + Intronic
1019978627 7:4604825-4604847 GCGTCTCCATGGGGTCCTGTGGG + Intergenic
1020698458 7:11446481-11446503 TTTTCTACATAGGCTCCTGTTGG + Intronic
1021404816 7:20252809-20252831 TTTCCTCCATGTTCTCTTGTAGG - Intergenic
1022498707 7:30869160-30869182 TCTCCTCCATGTCCTCCTGGGGG - Intronic
1022505631 7:30907363-30907385 TCTGGCCCATGGCCTCCTGTGGG + Intergenic
1023911810 7:44561744-44561766 TCCCCTCCAAGGGTTCCTGTAGG - Intergenic
1024976977 7:55122397-55122419 TGTCCTCAATGGGCTGCTGGTGG + Intronic
1025967239 7:66285484-66285506 CCTCTTCCCTGGGCTTCTGTGGG - Intronic
1026594501 7:71723180-71723202 TCTCCGCCTGGGGCTCATGTGGG + Intergenic
1026968880 7:74455833-74455855 TTTCCTCTGTGGGGTCCTGTGGG - Intronic
1029261556 7:99306179-99306201 TCTCCTCCTTGGAATCCAGTGGG + Intergenic
1030074083 7:105721566-105721588 TCTCCTCCCAGGGCTCTGGTCGG + Intronic
1030601701 7:111600694-111600716 TCTCCTCCACGGCCTACTTTAGG + Intergenic
1031290804 7:119931018-119931040 TCACATTCATGGACTCCTGTAGG - Intergenic
1031464755 7:122094816-122094838 TCTCCTCCTTGGGCCCTTCTTGG + Intronic
1033344893 7:140519017-140519039 TCTCCTCCCCTGGCTCCTGAGGG - Intronic
1035102933 7:156416267-156416289 TCTCCTCCAGGGCCTCAGGTGGG - Intergenic
1035494442 7:159310927-159310949 TTTCCACCATGGGCTTATGTAGG + Intergenic
1035667811 8:1391906-1391928 GCTCCTCCATGGCCCCTTGTTGG - Intergenic
1036215729 8:6878219-6878241 TCTCCTCCATGTGATCCAGAAGG - Intergenic
1036719905 8:11164441-11164463 TCTCCCCTATGGGTTCCTGTGGG + Intronic
1036926380 8:12909736-12909758 CCTCCTCCAGGGCCTCCTGGGGG + Intergenic
1037454993 8:19054098-19054120 TCCCCTTCATGGGATCCTCTAGG + Intronic
1037791115 8:21943126-21943148 TGTGGTCCATGGGCTCCTGGGGG - Intronic
1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG + Intronic
1040882934 8:52227852-52227874 TCTCTTCCCTGGGCTGATGTAGG + Intronic
1042778943 8:72468392-72468414 TCTCCTCCAGGGCCTCCATTTGG - Intergenic
1043918854 8:85957838-85957860 TCTCCTCCATGTTCTCTTCTAGG + Intergenic
1044208654 8:89522875-89522897 TCTCCTCCATTCTCTCCTATTGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045413620 8:101944634-101944656 TCTCCTGCATGGTCTCCAATTGG - Intronic
1045494744 8:102698897-102698919 CCTCCTCCAGGGGCTGCAGTGGG - Intergenic
1055793480 9:79948756-79948778 TCTCATCCATGGGCTTTTGCTGG + Intergenic
1056743786 9:89282708-89282730 CCCCCTCCATGGGCTCCTGTGGG + Intergenic
1059523369 9:114965061-114965083 TCTTCTCCATTGCCTCCCGTTGG + Intergenic
1059640757 9:116214349-116214371 GCACCTCCTTGGGCTACTGTGGG - Intronic
1059759834 9:117327345-117327367 TCCCCTCCAGGTGCTGCTGTAGG - Intronic
1059800917 9:117748812-117748834 TCTCCTTCATCAGCCCCTGTAGG + Intergenic
1061175944 9:128997157-128997179 TCTCCTCCACGGGCTCCACCTGG - Intronic
1062416821 9:136455394-136455416 TCCCCTCCATGGGCTCCTCAGGG + Intronic
1062656480 9:137606446-137606468 TCTCTACCTTGGCCTCCTGTGGG + Intronic
1187185529 X:16981197-16981219 TCTGCTCCATGGAGTACTGTGGG - Intronic
1188823843 X:34805776-34805798 TCTCCACCATGTGCTGCTGGGGG + Intergenic
1194323156 X:92477381-92477403 TATTCTCCATGGCCTCATGTTGG - Intronic
1197243587 X:124145819-124145841 ACTCCTCCATGGGCTGCGGTTGG - Intronic
1197359204 X:125477671-125477693 TCCCCACCTTGTGCTCCTGTGGG - Intergenic
1198241416 X:134790945-134790967 TCTCTTCCACAGTCTCCTGTTGG - Intronic
1198921775 X:141737049-141737071 TCAACTTCATGGGCTCCTGAAGG + Intergenic
1199882536 X:151986029-151986051 TCTCCTCCCTTTGCTCCTGCTGG + Intergenic
1200074653 X:153545032-153545054 TCTCCGCCCAGGGTTCCTGTGGG - Intronic
1200631254 Y:5590538-5590560 TATTCTCCATGGCCTCATGTTGG - Intronic
1202372893 Y:24210320-24210342 GCTTCTCCATGGCCTCCTGCAGG + Intergenic
1202497889 Y:25459800-25459822 GCTTCTCCATGGCCTCCTGCAGG - Intergenic