ID: 918310789

View in Genome Browser
Species Human (GRCh38)
Location 1:183283862-183283884
Sequence CAGGGTCTCCTCTCGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918310789_918310795 -4 Left 918310789 1:183283862-183283884 CCCTCTTCCGAGAGGAGACCCTG 0: 1
1: 0
2: 2
3: 15
4: 162
Right 918310795 1:183283881-183283903 CCTGCTGCAAAACAGTCCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 218
918310789_918310793 -5 Left 918310789 1:183283862-183283884 CCCTCTTCCGAGAGGAGACCCTG 0: 1
1: 0
2: 2
3: 15
4: 162
Right 918310793 1:183283880-183283902 CCCTGCTGCAAAACAGTCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918310789 Original CRISPR CAGGGTCTCCTCTCGGAAGA GGG (reversed) Intronic
900646808 1:3712800-3712822 CAGGGTCACCTGTCAGCAGAGGG + Intronic
901436731 1:9251141-9251163 CAGGGTCATCTCTGGGATGAAGG - Intronic
902038278 1:13473447-13473469 CAGAGTCTCCTCTAGGCTGAAGG + Intergenic
905201512 1:36319958-36319980 CAGGGTCTCCTCTGGGATGATGG - Exonic
906142475 1:43542071-43542093 CAGGGTCACCTGTGGGGAGAAGG - Intronic
909599669 1:77448394-77448416 CTGGGTCTCCTCTCCGCTGAGGG + Intronic
910873602 1:91856855-91856877 CAGGGTCTCCTCCCTAGAGAAGG + Intronic
912688537 1:111786123-111786145 CCAGGTTTCCTCTCAGAAGAGGG - Intronic
914992774 1:152513171-152513193 CAGGATCTCCTCTGGGAAAATGG - Intronic
916648787 1:166816297-166816319 CAGGGTCTCTTCTTGGCTGAGGG - Intergenic
918310789 1:183283862-183283884 CAGGGTCTCCTCTCGGAAGAGGG - Intronic
920346644 1:205310121-205310143 CTGGGACTCCTCTAGGGAGAAGG - Intronic
920434060 1:205936838-205936860 CAGGCTCTCCTCTGGGAAGTTGG - Intronic
923143565 1:231182256-231182278 CAAGGTCTCATCTCCCAAGATGG + Intronic
923468714 1:234270963-234270985 CATGGCCTCTTCTGGGAAGAAGG + Intronic
924258823 1:242209279-242209301 CAGGGAGTCCTGTGGGAAGACGG - Intronic
924793760 1:247277256-247277278 CAGAGTCTCCACTAGAAAGAAGG - Intergenic
1062949512 10:1487455-1487477 CAGGGTCTCCACTCAGCAGCAGG - Intronic
1064956875 10:20921324-20921346 CAGGGTCTCCTCCTGGGACATGG - Intronic
1065407908 10:25389318-25389340 CAGGGTCTCCTCTTTGCTGAGGG + Intronic
1065554344 10:26899984-26900006 CTGGGTCTCCACTTGTAAGATGG + Intergenic
1066449703 10:35517597-35517619 CAGTGTCTGCTCTAGGCAGAAGG + Intronic
1068433012 10:56957286-56957308 CAGGATCTCCTTTCAGCAGATGG + Intergenic
1069962907 10:72088808-72088830 CAGGATCTCCCCGGGGAAGATGG + Intronic
1070313996 10:75294120-75294142 CAGCGTCTCCTTTGGGAAGTGGG + Intergenic
1070401354 10:76056163-76056185 CTGGGTCTCCTCTCTGCTGAGGG - Intronic
1070638740 10:78150493-78150515 CAGGCTCTGCTCTAGGAAGCAGG - Intergenic
1073260684 10:102188234-102188256 CAGGGCCTCCTCTCTGCTGAGGG - Intergenic
1073854455 10:107658783-107658805 CAGGGTGTCCTTTGTGAAGAAGG - Intergenic
1075571746 10:123551414-123551436 CATGCTCTCCCCTCGGAACATGG - Intergenic
1081597263 11:44467676-44467698 CTGGGACTCCTCTCAGCAGAGGG + Intergenic
1083614703 11:64020604-64020626 GAGGGTCTCCTCCAGGCAGAGGG - Intronic
1084714378 11:70864352-70864374 CAGGGTCACCTGTCCGAAGCTGG - Intronic
1085164484 11:74384864-74384886 CAGGGTCTCCACCCGCAATAGGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1087926281 11:103922502-103922524 CAGGGGCACCTCTCGCATGAGGG - Intronic
1089785540 11:120904450-120904472 CAGGGTCTCATCTCAGGAGAGGG + Intronic
1090355966 11:126140526-126140548 AAGGGTCTCAGCTGGGAAGAGGG + Intergenic
1091321607 11:134656221-134656243 CAGGGACGCCTGTCGGAGGAGGG + Intergenic
1091452438 12:581634-581656 CAGGGTCTGCTCTGGGGAGAAGG + Intronic
1096355491 12:50937781-50937803 CTGGGTCTCCTCTCTGCTGAGGG - Intergenic
1098290823 12:68955725-68955747 CTGGGTCTCCTCTCAGCTGAGGG - Intronic
1104245843 12:127040611-127040633 CAAGGTCTTATCTCAGAAGATGG - Intergenic
1105358399 13:19681655-19681677 CAGGGTTTCCTTTCGGAGAAAGG + Intronic
1105465191 13:20633393-20633415 AAGGGTCACCTCTAGGAAGGGGG + Intronic
1106979067 13:35256065-35256087 CTGGGTCTCCTCTCTGCTGAGGG - Intronic
1107806481 13:44158277-44158299 CAAGGACTCCTCTTGGCAGATGG + Intronic
1107870980 13:44746318-44746340 CAGGGTTTCCTTTAGGCAGAGGG + Intergenic
1114491391 14:23104437-23104459 CAGGGTCTCGACTCAGAAGCAGG + Intergenic
1116202589 14:41817628-41817650 TAAGGTCTTCTCTCAGAAGAAGG - Intronic
1116448510 14:45039106-45039128 CTGGGTCTCCTCTCCGCTGAGGG - Intronic
1118605146 14:67497288-67497310 CTGGGTCTCCTCTCTGTAAAGGG - Intronic
1121348106 14:93151015-93151037 CAGGGTCTCTGCCCTGAAGAAGG + Intergenic
1121947941 14:98141092-98141114 AAGGGACTCTTGTCGGAAGAGGG + Intergenic
1125226047 15:37397354-37397376 CTGGGTCTCTTCTCAGAAGTAGG + Intergenic
1125975227 15:43945174-43945196 TAGGGTCTACCCTTGGAAGAAGG - Intronic
1128235844 15:66066565-66066587 CAGGGTCTCCACTTGGACGCAGG - Intronic
1128743295 15:70097408-70097430 CAGGCTCTCCTCTCCGAGGGGGG - Exonic
1129159119 15:73737408-73737430 CAGGGGCTCCTCTGGGGAGAGGG - Exonic
1130679702 15:85985697-85985719 CATGGTCTGCTCTCGATAGATGG + Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132925038 16:2424828-2424850 CAGACTCTCCTCACGGCAGATGG - Intergenic
1137813856 16:51379431-51379453 CATATTCTCCTCTCAGAAGAAGG - Intergenic
1139341296 16:66269861-66269883 CCGGGTCTCCCCTCCGCAGAGGG - Intergenic
1139459520 16:67110441-67110463 CAGGGTCTCTTCTGGGACGGTGG + Intronic
1139487178 16:67264536-67264558 CAGGGACTCCTCTTGGGAGCTGG + Intronic
1139625795 16:68187644-68187666 CAGGGTCTCCTCTCTGCTGAGGG - Intronic
1141500498 16:84441008-84441030 CTGGGGCTCCTCTCTGAAAAGGG + Intronic
1143736124 17:8913174-8913196 CAGGGAGGCCTCTCTGAAGAAGG + Intronic
1144708493 17:17385264-17385286 CAGGGGCTCCTCTCGGCCTAGGG - Intergenic
1145943738 17:28758366-28758388 CAGGCTCTGTTCTCGGAAGCAGG + Exonic
1146611423 17:34308588-34308610 CAGGATTTCCTCTCACAAGAGGG - Intergenic
1147924961 17:43940593-43940615 CAGGGACTCCTCTGAGCAGATGG - Intergenic
1152852141 17:82643419-82643441 CAAGATCCCGTCTCGGAAGAAGG + Intronic
1156527305 18:37778830-37778852 CCGGGTCTCCTCTCAGAGAATGG + Intergenic
1157812627 18:50708600-50708622 TAGGGTCTCCACCAGGAAGACGG + Intronic
1160083544 18:75753616-75753638 CCGGGTCTCCTCTCTGCTGAGGG - Intergenic
1161025685 19:2035688-2035710 AAGGGTCTCCTCCTGGGAGAGGG - Intergenic
1161207275 19:3047466-3047488 CAAGGGGTCTTCTCGGAAGAAGG - Intronic
1161612288 19:5250204-5250226 AAGGGTGTGCTCTAGGAAGAGGG + Intronic
1163195491 19:15716772-15716794 CATGGTCACCTCTAGGAGGAAGG + Intergenic
1163804615 19:19387890-19387912 CAGTGTCTCCCATCGGGAGACGG - Intronic
1164436029 19:28230213-28230235 CACTGTCTCTTCTGGGAAGAGGG + Intergenic
1166195588 19:41203609-41203631 CAGGGTGTACCCTCGGAAGCGGG - Exonic
1167077970 19:47260577-47260599 CAGGTTCTTCTCCTGGAAGAGGG - Exonic
1167422866 19:49414230-49414252 CAGGGTCTACTCCCGGAAGATGG + Intronic
1167782535 19:51608502-51608524 CTGGATCTCCTCTCGGATAAGGG + Intergenic
926847634 2:17159804-17159826 CAGTGTGTCCTCTCCCAAGAGGG + Intergenic
926859234 2:17291560-17291582 CAGGGCCTCCTCTCTGCTGAGGG - Intergenic
928102806 2:28449332-28449354 CAGGGGTTCCTCTCCCAAGAAGG + Intergenic
929575621 2:43050087-43050109 CAGGGCCCCCTCTGGGAAAACGG - Intergenic
929689344 2:44061591-44061613 CAGGGTGGCCTCTGGGCAGAGGG + Intergenic
930473456 2:51849912-51849934 CAGGGTTTCATCTAAGAAGATGG - Intergenic
932480505 2:72036319-72036341 CAGGGTTTTCTCACTGAAGAGGG - Intergenic
935809308 2:106781482-106781504 CAGCCTCTACTCTGGGAAGAGGG + Intergenic
937049487 2:118876636-118876658 CAGGGTCTGCTCTCACAGGAGGG - Intergenic
937969066 2:127535871-127535893 GGGGGTCACCTCTCTGAAGAGGG + Intronic
938449736 2:131407161-131407183 CAGGGTCTCCTCACAGAAAGAGG - Intergenic
938611407 2:132951176-132951198 CAGGGGCTCCTCTAGAAAGCAGG - Intronic
943345608 2:186734290-186734312 CTGGGTCTCCTCTCTGCTGAGGG - Intronic
944684813 2:202108957-202108979 CAGGGCCTGCTCTAGGAAGCAGG - Intronic
945721362 2:213421872-213421894 CTGGGTCTCCTCTCTGTGGAGGG + Intronic
946001807 2:216488670-216488692 CAGTTTCTCCTCTAGGAAGGTGG + Intergenic
946478159 2:220028881-220028903 CATGGGCTCCTCTCAGAAGAGGG - Intergenic
948552850 2:238786221-238786243 CAGAGTCTCATTTGGGAAGATGG - Intergenic
1172208774 20:33182855-33182877 GAGGGCCTCCTCTCTGATGAAGG + Intergenic
1173364811 20:42375506-42375528 CAAAGTGTCCTCTTGGAAGAAGG + Intronic
1175489657 20:59371332-59371354 CAGGGTCTCCTCCAGGACAAGGG - Intergenic
1175809777 20:61851787-61851809 CAGGGAGGCCTCTCGGAGGAGGG - Intronic
1175933049 20:62502451-62502473 CAGGGTCGGCTCTCGGGAGCTGG + Intergenic
1176059482 20:63166144-63166166 CAGGGCCTCCTCCTGGAAGCCGG + Intergenic
1176299960 21:5094874-5094896 TGGGGTCTCCTCCCGGAAGTGGG + Intergenic
1178440296 21:32593074-32593096 AAGGGTATCCTCTGGGAAGAAGG - Intronic
1179857062 21:44167037-44167059 TGGGGTCTCCTCCCGGAAGTGGG - Intergenic
1179950656 21:44707258-44707280 CAAGGTCTCCACCAGGAAGATGG + Intronic
1181235535 22:21445885-21445907 CCGGCACTCCACTCGGAAGAAGG + Exonic
1181571408 22:23769557-23769579 CAGTTTCTCCTCTCTGAAGGGGG + Intronic
1182424379 22:30264381-30264403 CAGGGTCTCCTCACTGGGGAAGG + Exonic
952906523 3:38142638-38142660 CAGGCTGTCCTCTGGGGAGAAGG + Exonic
953815612 3:46153855-46153877 CAGCCCCTCCTCTGGGAAGAAGG - Intergenic
954324751 3:49857387-49857409 CAGGGTTTCTTCTGGGTAGAGGG - Intergenic
954615178 3:51965883-51965905 GTGGGTCTCCTCATGGAAGAGGG + Intronic
955750465 3:62181213-62181235 CAGGGTCCCACATCGGAAGAAGG + Intronic
962630729 3:137272814-137272836 CAGGGTCACCTCTAGGGTGAGGG + Intergenic
964927801 3:161978772-161978794 CCGGGTCTCCTCTCTGCTGAGGG - Intergenic
968134964 3:196214730-196214752 CAGGGTCTCCTCTTGGCAGTTGG - Intronic
968142921 3:196273558-196273580 CTGGGTCTCCTCTCCGCTGAGGG - Intronic
969976754 4:11110710-11110732 TAGGATGTCCTCTGGGAAGAGGG - Intergenic
972695830 4:41445439-41445461 CAGGGGTTCGTCTCAGAAGATGG - Intronic
973011182 4:45075972-45075994 CAGCTTCTCCTCTCGTAAGTTGG - Intergenic
974320570 4:60343579-60343601 TAGGTTCTTCTCTAGGAAGAAGG + Intergenic
978219695 4:106255995-106256017 CAGGGTCTTCTCTCTGCTGAGGG - Intronic
979415994 4:120439431-120439453 CAAGGTGCCTTCTCGGAAGAGGG + Intergenic
980846016 4:138326020-138326042 CAGCATCTCCTTTCGGAACACGG + Intergenic
981282420 4:142973630-142973652 CAGTGTTTTCTCTCTGAAGATGG + Intergenic
982181444 4:152751747-152751769 CAGGGTCTCCTCTCCCCTGAGGG + Intronic
982181472 4:152751887-152751909 CAGGGTCTCCTCTCCACTGAGGG + Intronic
983843636 4:172488362-172488384 CAGGGCCTCACCTGGGAAGATGG + Intronic
992693098 5:79259251-79259273 CAGGGTCTCCTCTCTGCTGAGGG - Intronic
992838893 5:80668113-80668135 CAGGGTCCCCTCTCGGCTGAAGG - Intronic
994013948 5:94943227-94943249 CAGGAACTCCTCTCTGAGGAAGG + Intronic
994916254 5:105983064-105983086 CTGGGTCTCCTCTCTGCAGAGGG + Intergenic
998202170 5:140133746-140133768 CTGGGTCACCTCTCAGAATAAGG - Intergenic
999297047 5:150466206-150466228 CTGGGTTTCCCCTCGGAGGAAGG - Intergenic
1002650360 5:180687206-180687228 CAGGGTCTCCTCACAGAAAGAGG + Intergenic
1006401857 6:33822370-33822392 CTGGGGCTCCTCCCCGAAGAGGG + Intergenic
1007243335 6:40442603-40442625 CTGGGTCTCCTCTCAGACTAGGG + Intronic
1007413061 6:41675907-41675929 GAGGGCCTCCTGTAGGAAGAGGG - Intergenic
1014662798 6:124193966-124193988 CAGGGTCTTCTCTCTGCTGAGGG - Intronic
1015150506 6:130031682-130031704 CAGGGTATCCTCTGGAAAGAGGG + Intronic
1016935302 6:149445386-149445408 CACGGTCTCCTGTGGGAGGAAGG - Intergenic
1017949931 6:159128009-159128031 CAGGGTGTGCTCTCGGATGCTGG - Intergenic
1019705624 7:2495949-2495971 CAGGGCCTCCTCTCTGCAGTGGG - Intergenic
1022857660 7:34331391-34331413 CAGGGTCTCCTCTGCAAGGATGG - Intergenic
1024794841 7:53008245-53008267 CTGGGTCTCCTCTCTGCTGAGGG + Intergenic
1030243836 7:107359799-107359821 CTGGGTCTCCTCTCTGCTGAGGG + Intronic
1033358214 7:140618138-140618160 CAGGGTCACCTCTCTGATCAAGG + Intronic
1034936910 7:155205763-155205785 CAGAGTCAGCTCACGGAAGATGG - Intergenic
1035565211 8:636527-636549 CAGAGTCTCCTCACGGACGGAGG + Intronic
1037755931 8:21710047-21710069 GAGGGACTCCTCAGGGAAGAGGG + Intronic
1037768636 8:21786594-21786616 GAGGGGCTCCTCTAGGAAGCTGG - Intronic
1040552977 8:48453103-48453125 GAGGGTCTCATCCCGGAATATGG - Intergenic
1043195554 8:77287729-77287751 CAGGGTCTCCTTTCTGCTGAGGG + Intergenic
1047570836 8:126097316-126097338 CAGAGTCTCCCCTTGGAAGGTGG - Intergenic
1049563799 8:143326933-143326955 CAGGGCATCCTCTCAGAAGCAGG - Intronic
1050024498 9:1319973-1319995 CAGGGCCCCCTCTGGGATGATGG - Intergenic
1050353620 9:4763033-4763055 CAGGTTTTCCTCACTGAAGATGG - Intergenic
1051668096 9:19484228-19484250 CAGGGTCTTCTTTCTGTAGAAGG + Intergenic
1058619741 9:106870440-106870462 CAGGGTCTACTCTTTGAATAAGG - Intronic
1059290621 9:113221078-113221100 AAGGGTCTCCCCCCGGAAGTTGG + Intronic
1059519577 9:114927914-114927936 AAGGGTTTCCTATAGGAAGATGG - Intronic
1060199913 9:121646352-121646374 CAGGATCTTCACTAGGAAGATGG - Intronic
1061037668 9:128122538-128122560 GAGGGTCTCCTCTGGGGAGAGGG + Intronic
1062083124 9:134634906-134634928 CAGGTTCTCCTCTGGAAAGTGGG - Intergenic
1186963458 X:14762104-14762126 CAAGGTGCCCTCTTGGAAGAAGG - Intergenic
1187551665 X:20312150-20312172 CAGGTTATCCTGTTGGAAGATGG + Intergenic
1192386491 X:70677291-70677313 AAGGGTCTTGTCTCAGAAGAGGG - Intronic
1194212231 X:91082777-91082799 CTGGGTCTCCTCTTTGATGAGGG + Intergenic
1197035682 X:121870629-121870651 CAAGGTCTCCTCTCCAATGAGGG + Intergenic
1197718942 X:129731622-129731644 CAGTGTCTCCTCTAGCAACAGGG - Intergenic