ID: 918311317

View in Genome Browser
Species Human (GRCh38)
Location 1:183287606-183287628
Sequence ATCCCACTGGGCCAAGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918311311_918311317 -1 Left 918311311 1:183287584-183287606 CCTCACAGCTGACCCAGAAGCAA No data
Right 918311317 1:183287606-183287628 ATCCCACTGGGCCAAGGTGATGG 0: 1
1: 0
2: 0
3: 21
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918311317 Original CRISPR ATCCCACTGGGCCAAGGTGA TGG Intronic
900301276 1:1978680-1978702 GTCCCACTGGGCTAAAGTCAAGG - Intronic
900384176 1:2401835-2401857 ATGCCACAGTGACAAGGTGAAGG + Intronic
900793255 1:4693089-4693111 ACCTCCCTGGGCCATGGTGAGGG - Intronic
901919095 1:12523554-12523576 ACACCACTGGTCCAAGGTAAGGG + Intergenic
902335532 1:15752217-15752239 ATCACACAGGGCCAGGGTGAGGG + Intergenic
903161368 1:21491407-21491429 AGCCCAGCGGGCCAAGTTGACGG + Intergenic
906324008 1:44833038-44833060 ATCAAAGTGGGCCAAGGGGAGGG + Intronic
906713720 1:47951724-47951746 AAGCCTCTGGACCAAGGTGAGGG - Intronic
907401262 1:54226266-54226288 ATGCCACCGGGTCACGGTGACGG + Intronic
908646074 1:66279305-66279327 ATCTCACTGAGCCAAGAGGAAGG + Intronic
909072860 1:71017400-71017422 ATCTCACTGGGCTAAAGTAAAGG - Intronic
909179901 1:72410310-72410332 GTCACACTGGGCTAAGGTCAAGG + Intergenic
911024282 1:93420725-93420747 ATCTCACTGGGCTAAGATCAAGG + Intergenic
912975350 1:114324372-114324394 CTCCCACTGGGCATAGGGGAGGG + Intergenic
914050138 1:144124577-144124599 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
914129044 1:144840874-144840896 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
915501819 1:156324310-156324332 ACCCACCTGGGCCAAAGTGATGG + Intronic
916281839 1:163060560-163060582 ATCCCAGGGGGTCAAGGTTATGG + Intergenic
918311317 1:183287606-183287628 ATCCCACTGGGCCAAGGTGATGG + Intronic
918755291 1:188333116-188333138 ATCCCACTTGGTCAAGATGAAGG + Intergenic
919173800 1:193992876-193992898 ATCCCACTTGATCATGGTGAAGG - Intergenic
919401881 1:197128581-197128603 ATCCCAATAAGCCAAGGTGACGG + Exonic
920039311 1:203085453-203085475 ATCCCCCTGCCCCAAGGGGACGG - Intronic
920497632 1:206466870-206466892 ATGCCAATGGGGTAAGGTGAGGG + Intergenic
921295791 1:213701400-213701422 ATCCCACTTGGTCATGATGAAGG + Intergenic
921417500 1:214907213-214907235 ATCCCACTGGGCTGAGTTAATGG + Intergenic
922403090 1:225281157-225281179 AACCCACTGGGCCAAAATTAAGG + Intronic
922570583 1:226632407-226632429 ATCCCACTGAGACAAAGGGAAGG + Exonic
1063163434 10:3438127-3438149 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
1063508462 10:6623452-6623474 ATCCTCATGGGCCAAGGTTAAGG - Intergenic
1064220591 10:13437289-13437311 ATCCCACTGGGGCAAGGCACGGG + Intergenic
1064488030 10:15817825-15817847 ATTCCACAGGGCCAGGGTGGTGG - Intronic
1069735621 10:70652192-70652214 GTCCCACAGGGCCAATGTGGAGG - Intergenic
1070638613 10:78149325-78149347 ACACCACTTGGCCAAGCTGAGGG + Intergenic
1074147343 10:110728509-110728531 ATGCCTCAGGGTCAAGGTGAGGG + Intronic
1074550163 10:114435415-114435437 ATGCCACTGGGCCAATCTGGGGG + Intronic
1074973999 10:118565912-118565934 GTCCCATTGGACAAAGGTGAAGG - Intergenic
1075682767 10:124344212-124344234 ATCTCACTGGGCCAAGATCAAGG + Intergenic
1075957765 10:126538711-126538733 ATCCCACAGCTCCAAAGTGAAGG + Intronic
1076347263 10:129787978-129788000 TTCCCTCTGGGCCAAGGCGGAGG + Intergenic
1077469787 11:2751816-2751838 CTCCCACTGGCTCAGGGTGAGGG + Intronic
1077893864 11:6439517-6439539 ATTCCTCAGAGCCAAGGTGATGG + Intronic
1078734406 11:14006951-14006973 ATCTCACTGGGCCAAAATTAAGG + Intronic
1078899227 11:15626043-15626065 ATCTCACTGGGATAAGATGAAGG + Intergenic
1080295065 11:30717236-30717258 ACCGCCCTGGGACAAGGTGAAGG - Intergenic
1081155019 11:39679884-39679906 AGCCCAGTGGGCCAAGTAGATGG - Intergenic
1081911224 11:46701125-46701147 ATCCACCTGGGCCAAGGTTGAGG - Intronic
1081933139 11:46886340-46886362 ATCCCACTTGGCCCTGCTGATGG + Exonic
1082901989 11:58265269-58265291 ATCCCCCTTGGACAAGGTAAGGG - Intergenic
1083707308 11:64525422-64525444 GTCTCACTGGGCTAAGATGAAGG + Intergenic
1085502908 11:77039283-77039305 AGTCCACTGGGCCTATGTGACGG + Intronic
1087133694 11:94693278-94693300 ATCTCTCTGAGACAAGGTGAGGG - Intergenic
1087469802 11:98558069-98558091 ATTCCACTGGGCCAAGAGGTAGG - Intergenic
1087873467 11:103327005-103327027 ATTCCATAGGTCCAAGGTGAGGG + Intronic
1089550075 11:119267784-119267806 ATCCCTCTGGGCCAAGCGAACGG - Intronic
1090482038 11:127077523-127077545 ATCCCACAGAGCCATGGTGCTGG - Intergenic
1092730362 12:11527147-11527169 ATCCCACTGGGTAAAGTTGTTGG + Intergenic
1093588442 12:20871032-20871054 ATCCCACTTGGTCATGATGAAGG + Intronic
1097952669 12:65449579-65449601 ATCCCACTGGGTTTGGGTGATGG - Intronic
1098976645 12:76908930-76908952 ATCCCACTGGGCTGAGATCAAGG - Intergenic
1102195376 12:111021590-111021612 AGCCCACTGGTCCCAGGAGAAGG - Intergenic
1102347301 12:112168296-112168318 GTCCCTCTGGGCCAGGCTGAGGG + Intronic
1103926006 12:124423639-124423661 ATGTCACTGGGACAAGGAGAGGG - Intronic
1106842856 13:33704318-33704340 ATCCCACTTGATCATGGTGAAGG + Intergenic
1107754068 13:43600189-43600211 ATCCCACTGTGCCACTGTGACGG - Intronic
1112005035 13:95246347-95246369 CTCCCAGTGGGCCCAGGTGCTGG - Intronic
1112407327 13:99132730-99132752 CTCCCACTGGTCAAAGGTCAGGG + Intergenic
1112521826 13:100102921-100102943 ATCCCACTGAACCAAGATTACGG - Exonic
1115333248 14:32220419-32220441 TTCCCACTGGGGTATGGTGAAGG + Intergenic
1116810011 14:49530326-49530348 ATCCCACTAGGTCATGATGAGGG - Intergenic
1116991156 14:51278193-51278215 ATCCCATTGTGCTAAAGTGAGGG + Intergenic
1118255803 14:64204849-64204871 ATCTCACTGGGCTAAGATCAGGG + Intronic
1118675015 14:68174622-68174644 ATCCAATGGGGCCAAGATGAGGG + Intronic
1118892167 14:69919627-69919649 GTCCCACTGGGCCAAGCTTGAGG - Intronic
1119398866 14:74348745-74348767 ACCCTACTGGGCCCAGGTCAAGG + Intronic
1121015332 14:90545600-90545622 ATCCCACTGGGCCAAGGCCCTGG - Intronic
1121792652 14:96710712-96710734 ACCCCACCTGGCCCAGGTGAGGG + Intergenic
1122826646 14:104373971-104373993 ATCCCACCGGGTGAAGGTCAAGG + Intergenic
1122979448 14:105185087-105185109 ATCCCACCGGGTGAAGGTCAAGG + Intergenic
1123405898 15:20019261-20019283 ATCCTACAGGGCCAAGGTCTAGG + Intergenic
1123420000 15:20123840-20123862 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
1123445861 15:20329692-20329714 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
1123515228 15:21025909-21025931 ATCCTACAGGGCCAAGGTCTAGG + Intergenic
1123529221 15:21130376-21130398 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
1124516029 15:30368022-30368044 TTCCACCTGGGCCCAGGTGAGGG + Intronic
1124726891 15:32162709-32162731 TTCCACCTGGGCCCAGGTGAGGG - Intronic
1125732880 15:41903987-41904009 ATCTCAATGGGCCAAGGAGATGG + Intronic
1125883169 15:43210449-43210471 ATCACACAGGGCCATGATGAAGG + Intronic
1126102317 15:45126486-45126508 ATGCCACTGGGCCAATGTAGAGG + Intronic
1127763104 15:62160059-62160081 ATCCCACTGTATCATGGTGAAGG - Intergenic
1129909289 15:79212828-79212850 ATCACACAGGGTCAAGGAGAGGG + Intergenic
1132568735 16:634975-634997 AGCCCACTGGACCAAGGTCGGGG + Intronic
1134627804 16:15735312-15735334 ATCCCACTGCACCAATGGGATGG - Intronic
1137685697 16:50385328-50385350 ATCCCACTGGGGAACTGTGAGGG - Intergenic
1138248571 16:55485171-55485193 ACCCCACTGGGACAAGGGAAGGG + Intronic
1141469527 16:84228937-84228959 ATCCAACCCGCCCAAGGTGAAGG - Intronic
1141608221 16:85167680-85167702 ATTCCTCTGGGCCAGGGTGAAGG + Intergenic
1141862339 16:86726424-86726446 AACCCACTGGCCCAAGGCCAGGG - Intergenic
1141903107 16:87005708-87005730 ATCTCACTGGTCCAAGCTCACGG - Intergenic
1142146717 16:88495863-88495885 ATGCAACTGGGCCATGGGGAGGG + Intronic
1143224261 17:5287254-5287276 ATCACTCTGGGCCAAAGTGCTGG + Intronic
1146259936 17:31414666-31414688 ATGTCACTGGGCCATGGTGCTGG + Intronic
1146462386 17:33056450-33056472 ATCCTACTGGGCCAGGGAGGGGG - Intronic
1148123430 17:45225075-45225097 ATCCCTCTGCCCCAAGGTTATGG - Intronic
1148955889 17:51353362-51353384 ACCCCCATGGGCCAAGGTGGGGG - Intergenic
1150718039 17:67588670-67588692 ATCCCCCTCGGCCAAGGTCGGGG + Intronic
1153841877 18:9015021-9015043 ATCCCAGAGCACCAAGGTGAGGG - Intergenic
1154079659 18:11243514-11243536 ACCCCAAAGGGCCATGGTGAAGG + Intergenic
1159805467 18:72952470-72952492 ATCCCTCAGGGCCATGCTGAGGG + Intergenic
1160036008 18:75302388-75302410 ACCTTACTTGGCCAAGGTGAAGG - Intergenic
1160474613 18:79171729-79171751 AGCCCACTGGGCTAGTGTGAGGG - Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1163768466 19:19176661-19176683 ACCCCACAGTGCCAAGCTGAGGG + Intronic
1166568005 19:43776806-43776828 ACCGCACTGGGCCCAGATGATGG - Intronic
1167161030 19:47767141-47767163 AACCCAGTGGGCCAGGGAGAGGG - Intergenic
1167229373 19:48271980-48272002 TTCTCCCTGGGCCAAGGTGAAGG - Intronic
1167850030 19:52194398-52194420 AGGCCTGTGGGCCAAGGTGAAGG + Intronic
1202689527 1_KI270712v1_random:77140-77162 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
925023179 2:587833-587855 ATGGCACTAGGCAAAGGTGATGG - Intergenic
925235754 2:2275947-2275969 AACCCGCTGGGGCAAGGTGGAGG - Intronic
925851238 2:8084259-8084281 ATGCAACTGATCCAAGGTGAAGG + Intergenic
925915176 2:8599854-8599876 AGTCCACTGGGGCAAGGGGAGGG + Intergenic
926764409 2:16311675-16311697 ATCCCACTGCACCACGGTGAGGG + Intergenic
927125638 2:20010728-20010750 GTCTCACTGGGCTAAGATGAAGG - Intronic
928229275 2:29482387-29482409 ATCCCACTTCTTCAAGGTGAAGG + Intronic
928243099 2:29603613-29603635 AGCCCCCTTGGCCAAGGGGAGGG + Intronic
929432262 2:41897239-41897261 ATCACAATGGGCCCAGGAGAGGG - Intergenic
929889703 2:45908745-45908767 GTCCCACTGGGGCAATGTGGAGG + Intronic
932263688 2:70347912-70347934 ATCTCACTGGGCTAATGTCAAGG + Intergenic
933956907 2:87378952-87378974 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
934241028 2:90270842-90270864 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
934272150 2:91545843-91545865 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
937314454 2:120922089-120922111 CTCTCACTGGGCCATGGTGTGGG + Intronic
941125863 2:161582163-161582185 CTCTCTCAGGGCCAAGGTGATGG + Intronic
943557529 2:189423994-189424016 ATCCCACTTGATCATGGTGAAGG - Intergenic
944156588 2:196613492-196613514 TTCCCACTAGGGGAAGGTGAAGG - Intergenic
944217183 2:197268117-197268139 ATGCCCTTGGGCCATGGTGAAGG - Intronic
945230940 2:207589190-207589212 ATCTCACTGGGCTAAAATGAAGG + Intronic
945370918 2:209016621-209016643 ATACAACTGGGTCAAGATGAAGG + Intergenic
948459858 2:238123863-238123885 ACCCCACTGGGCCACGGGGAAGG - Intronic
1170895163 20:20406298-20406320 ATCCCACTGGGTCTTGGTGATGG + Intronic
1172897307 20:38309482-38309504 AACCCACTGGTCCAAGGAGGAGG - Intronic
1172969561 20:38863410-38863432 ACTCCACTAGGCCAAAGTGAGGG + Intronic
1173813103 20:45968284-45968306 ATCCTACAGGGCCCAGATGATGG - Exonic
1175306743 20:57981467-57981489 GTCCCACAAGGCCAAGGTCAGGG + Intergenic
1177732583 21:25047185-25047207 ATCCCAGTGGGAGAAGCTGAAGG - Intergenic
1178286223 21:31327736-31327758 ATCCTACTGGTGCAGGGTGATGG - Intronic
1178470105 21:32884857-32884879 GTCCCTCTGTGACAAGGTGATGG - Intergenic
1179096564 21:38321238-38321260 CTCCCACTTGGTCAAGGAGATGG - Intergenic
1179154861 21:38840927-38840949 GTCCCACTGGGCTAACGTCAAGG + Intergenic
1179251239 21:39673393-39673415 ATCCCCCTGTGGCAAGGTGGGGG + Intergenic
1179936167 21:44604931-44604953 ATCCCACTGGATCATAGTGAAGG + Intronic
1180551893 22:16547441-16547463 ATCTCACTGGGCTAAAGTCAAGG + Intergenic
1181352134 22:22266602-22266624 ATCTCACTGGGCTAAAGTCAAGG - Intergenic
1183060252 22:35332182-35332204 ATTCCACTGGGCCAACGAGCAGG - Intronic
1183611136 22:38907153-38907175 ATCCCTCTTGGCCAAGATGGGGG - Intergenic
1183955097 22:41375099-41375121 ATCACACAGGGCAGAGGTGAGGG + Intronic
1183980550 22:41537363-41537385 ATTCCTCTGAGCAAAGGTGAAGG + Intronic
1184485644 22:44777193-44777215 CTCCAACTGTGCCAAGGGGAAGG - Intronic
1184923622 22:47622854-47622876 ATCCCACTGGGCTAAGACCAAGG - Intergenic
952932274 3:38369509-38369531 CCTCCACTGGGCCAAGGTGGAGG - Intronic
955004096 3:54953447-54953469 ATAGCACTGGGCCAAGATCATGG + Intronic
957223675 3:77415593-77415615 AGCCCACTGGGCCAAGTGGGTGG - Intronic
958813682 3:98892465-98892487 ATCACACTGGGTCAATGTGAGGG + Intronic
960143446 3:114173368-114173390 CTCCCACAGTGCCAAGGAGAAGG + Intronic
962011531 3:131396323-131396345 AGCCCACTGGTCCCAGGAGAAGG - Intergenic
962308731 3:134311266-134311288 TTCCCACTGGGCCCAGGTAGGGG - Intergenic
962819913 3:139038532-139038554 AACCCATTAGGCCAAGGTAAGGG - Intronic
965450963 3:168837266-168837288 CTCCCTCTGGGCCCAGGAGATGG - Intergenic
967335251 3:188337094-188337116 TTCCCCATGGGCCCAGGTGAAGG - Intronic
970018095 4:11535178-11535200 ATCTCACTGGGCTAAAATGAAGG - Intergenic
974597192 4:64029827-64029849 CTCCCCATGGGCTAAGGTGAAGG - Intergenic
977952066 4:102983236-102983258 ATCCCACTTGGTCATGGTCATGG + Intronic
978963143 4:114708791-114708813 ATCCCACTGGGCTAAAATCAAGG + Intergenic
979391446 4:120132734-120132756 ATCCCACTGGGCAAACGTGCTGG - Intergenic
980599258 4:134998160-134998182 TTCTCACTGGGCTAAGATGAAGG - Intergenic
982130223 4:152222701-152222723 AGCCCACTGTGCCAGGGTGAAGG + Intergenic
983737315 4:171078083-171078105 ATCCCAGTGTGCCCAGGTCAAGG - Intergenic
983737390 4:171078940-171078962 ACCCCACTGGGCCTGGGTGGAGG - Intergenic
987385492 5:17325170-17325192 GTCTCACTGGGCTAAAGTGAAGG - Intergenic
990154094 5:52855069-52855091 AACCCACAGGGTCAAGGTGAAGG - Intronic
990515615 5:56528535-56528557 GTTCCACTGGGCCAAAGTCAAGG + Intronic
990719706 5:58680583-58680605 GTCCCACTGGACCAAAGTCAGGG + Intronic
994144980 5:96384597-96384619 TTTCCACTGGGGCAAGGAGAAGG + Intergenic
995003864 5:107167192-107167214 TTCCCACTGAGCACAGGTGAAGG - Intergenic
996367851 5:122721849-122721871 ACCCCACTGTTCCAAGCTGAAGG - Intergenic
996553177 5:124751078-124751100 ACCCTACTGGCCCAAGATGAAGG + Intergenic
997173522 5:131750123-131750145 ATCAGACTGTGCCAAGGTAAGGG + Intronic
997473357 5:134128918-134128940 CTCCCCCTGGCCCTAGGTGAGGG - Intronic
998548293 5:143050899-143050921 ATCCCAACAGGCAAAGGTGATGG - Intronic
1000915857 5:167080498-167080520 ACCACACAGTGCCAAGGTGAAGG - Intergenic
1002442003 5:179269237-179269259 ATCTCACTGAGCCAAGATCAAGG - Intronic
1003790523 6:9541754-9541776 ATCCCCCTGGGTCATGGTGGCGG + Intergenic
1006662855 6:35663277-35663299 ATCCCACTTGGCTAAAGTGAAGG + Intronic
1007371696 6:41430439-41430461 CTCCTACTGGGCCCAGTTGAGGG - Intergenic
1013420311 6:109961104-109961126 GTCTCACTGGGCTAAGGTCAAGG - Intergenic
1022209646 7:28195912-28195934 TTAGCACTGGGACAAGGTGAAGG - Intergenic
1026804873 7:73423585-73423607 ACATCACTGGGGCAAGGTGAGGG + Intergenic
1026820607 7:73545509-73545531 ATCGCACTCGGCCAAGGAAAGGG + Intronic
1028674682 7:93445049-93445071 AGCCCTCTGGGCCCAGGAGAAGG + Intronic
1029549943 7:101232360-101232382 TTCCCACTGCCCCAAGGAGAGGG - Exonic
1030355555 7:108538529-108538551 TTCCCACTGGGCAGTGGTGAAGG + Intronic
1033174670 7:139113166-139113188 ATCCCACTGGACTACTGTGATGG - Intergenic
1033641700 7:143268104-143268126 ATCCACATGGGCCACGGTGATGG - Exonic
1033819684 7:145119544-145119566 ATCCCACTTGACCATGTTGAAGG + Intergenic
1034395494 7:150821271-150821293 ATCTCACTGGGCCAGGGTTGGGG - Intergenic
1034969600 7:155410823-155410845 GTCTCACTGGGCTAAGGTCAAGG + Intergenic
1035016829 7:155774058-155774080 ATCTGGCTGGGCCATGGTGAGGG - Intronic
1035117510 7:156537088-156537110 CTCCCAATGGGCCAAGAGGAGGG + Intergenic
1035464200 7:159064293-159064315 AGCCCACGGGGCCCAGGTGCAGG - Intronic
1035627012 8:1078048-1078070 ATCCCACCGGGACCCGGTGAGGG + Intergenic
1036846950 8:12176668-12176690 ATCACACTGGGCCTTGCTGATGG - Intergenic
1036868316 8:12418987-12419009 ATCACACTGGGCCTTGCTGATGG - Intergenic
1037887504 8:22602545-22602567 CTCCCACTGGGACAAGGTCAAGG + Exonic
1041257369 8:55990813-55990835 AATCCCCTGGGCCAAGGGGAGGG + Intronic
1045346790 8:101300627-101300649 ATTCCAGTGGGCCTAGGAGAGGG + Intergenic
1045400459 8:101811431-101811453 GTCTCACTGGGCTAAGGTGTAGG - Intronic
1046555965 8:115773884-115773906 ATCCCAGTGGGACAAGAAGAAGG + Intronic
1047083310 8:121488842-121488864 ATCCCACTTGGTCATGATGAAGG - Intergenic
1047518831 8:125578743-125578765 ATCCCAGTGGCTCAAGGTGCGGG + Intergenic
1047607578 8:126490301-126490323 ATCCCACTGGGAGAAGGTCTGGG + Intergenic
1047833181 8:128658303-128658325 GTCCAGCTGGGCCCAGGTGAAGG - Intergenic
1048751788 8:137685306-137685328 GTTCCACTGGGCTAAGGTCAAGG + Intergenic
1048832922 8:138494134-138494156 AACCCACTGAGGCAAAGTGAAGG - Intronic
1049035557 8:140073041-140073063 ATCCCACTGTACCATGGTGAAGG + Intronic
1050415190 9:5409139-5409161 ATTCCACTGGGGCACTGTGATGG + Intronic
1051703997 9:19857079-19857101 ATCTCACTGGGCTAATGTTAAGG + Intergenic
1051761927 9:20477080-20477102 ATCCCACTGGGCCCCAGAGAAGG - Intronic
1052026019 9:23573861-23573883 CTCCCACTGGGCCCAGAAGATGG - Intergenic
1052995963 9:34551805-34551827 AGCCCAAGGGGCCAGGGTGAGGG + Exonic
1053424213 9:38000483-38000505 ACCACATTGGGTCAAGGTGAAGG - Intronic
1053449552 9:38181577-38181599 CTCCCAGTGGGCGAAGGTGAGGG + Intergenic
1058562564 9:106245499-106245521 GTCCCACTGGGTTAAGGTCAGGG + Intergenic
1059682325 9:116598055-116598077 ACCCCAGTGGGAAAAGGTGAGGG - Intronic
1060218895 9:121754230-121754252 CTCCCTCTGGGCCCAGATGAGGG + Intronic
1060343117 9:122793999-122794021 ATCCTGTAGGGCCAAGGTGATGG - Intergenic
1060926522 9:127459196-127459218 ACCCCAAAGGGCCAAGGGGAGGG - Intronic
1062138217 9:134940847-134940869 CTCCCCCTGGGTCAAGGAGAGGG + Intergenic
1062252582 9:135605713-135605735 ATCCCACGGGGACAGGGGGAGGG - Intergenic
1186002351 X:5026850-5026872 ATCTCACTGGGCCACAGTCAAGG - Intergenic
1186698907 X:12068238-12068260 GTTTCACTGGGCCAAGGTCAAGG - Intergenic
1189230808 X:39451110-39451132 ATCCCTCCAGGTCAAGGTGAGGG + Intergenic
1190807866 X:53855966-53855988 ATCCCACTTGGTCATGATGAAGG + Intergenic
1191057368 X:56255733-56255755 ATCCCACTTGGTCAGGATGAAGG + Intronic
1192088418 X:68126032-68126054 ATCCCACTTGGTCATGATGAAGG - Intronic
1194991155 X:100548668-100548690 ATCCCACTTGGTCATGATGAAGG - Intergenic
1196315130 X:114213381-114213403 ATCCTACTGCTCCAAGGTGATGG - Intergenic
1198684045 X:139209006-139209028 AGCCCACTGGGCCAAGATCTGGG + Intronic