ID: 918316124

View in Genome Browser
Species Human (GRCh38)
Location 1:183324007-183324029
Sequence CTGGGGGATCACCATAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918316115_918316124 20 Left 918316115 1:183323964-183323986 CCAAAGTCAGGTAACAGCTGAAA 0: 1
1: 0
2: 0
3: 11
4: 191
Right 918316124 1:183324007-183324029 CTGGGGGATCACCATAAAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918316124 Original CRISPR CTGGGGGATCACCATAAAGT GGG Intronic
901456537 1:9366257-9366279 CTGGGGGATCAGCTGAAACTGGG + Intronic
902441202 1:16431278-16431300 CCTGAGGATCACCATAAAGAGGG - Intronic
903451172 1:23454760-23454782 CTGAGCGCTTACCATAAAGTAGG + Intronic
908657534 1:66403889-66403911 CAGAGGGAACCCCATAAAGTAGG + Intergenic
918316124 1:183324007-183324029 CTGGGGGATCACCATAAAGTGGG + Intronic
921394730 1:214656409-214656431 TTGGGGGAACACTATAAAGGTGG - Intronic
1065701584 10:28431057-28431079 CTGGGTGTCCACCATAAAGTCGG + Intergenic
1066662397 10:37749252-37749274 CTGAAGGATGACCATAAAGATGG - Intergenic
1070100641 10:73382714-73382736 CTGGGGAATCAAAATAAAGAAGG + Intronic
1083212354 11:61195955-61195977 CTGGGGCATGACCAGGAAGTTGG - Intergenic
1084736907 11:71111301-71111323 CATGGGGTTCACCACAAAGTGGG - Intronic
1091786185 12:3244643-3244665 CTGGGGGATCGCCATCTGGTGGG - Intronic
1092534964 12:9379002-9379024 CTGTGGGATCCCCGGAAAGTGGG + Intergenic
1095823439 12:46506660-46506682 CTTATGGATCACCATCAAGTGGG - Intergenic
1096750276 12:53754303-53754325 CTGGGAGATCTCGATCAAGTTGG - Intergenic
1098991880 12:77072648-77072670 CTGGGGGTTAACTTTAAAGTAGG + Intergenic
1104056535 12:125235054-125235076 CTGGGGGATCACAGTTAAGAAGG - Intronic
1106569038 13:30910289-30910311 CTAGGGGAGCACCAAAAAGAAGG - Intronic
1106897349 13:34318089-34318111 ATGGGTGATCACATTAAAGTTGG + Intergenic
1126286582 15:47019358-47019380 CTGTGGGATCACGATAAATTAGG - Intergenic
1128044654 15:64606914-64606936 CTGGCGGATCACCCTGAGGTTGG + Intronic
1128713726 15:69891721-69891743 CTGGGTGATCACATGAAAGTAGG - Intergenic
1132134211 15:99317357-99317379 CTGGTGAATCACAATTAAGTGGG + Intronic
1133593811 16:7271710-7271732 CATGGGGGTCAGCATAAAGTCGG + Intronic
1137410381 16:48223153-48223175 CTGGTGGAGCACCATGAAGCTGG + Intronic
1140270098 16:73457815-73457837 CTGAGTCATCACCATGAAGTAGG - Intergenic
1142479653 17:211237-211259 CTGGGGGTTCCCCAAACAGTGGG - Intergenic
1146839257 17:36138478-36138500 CTGAGGGAGCACCAAAAAGTGGG + Intergenic
1152962631 18:88906-88928 CTGGGGGAGCACTGGAAAGTTGG + Intergenic
1154446253 18:14438102-14438124 CTTTGGGATCTCCATCAAGTGGG - Intergenic
1155192454 18:23442335-23442357 CTGGGGTATCACCAAGAACTAGG + Intergenic
1156455080 18:37288527-37288549 CTTGGGGATCCCCAGCAAGTTGG - Intronic
925579957 2:5400344-5400366 CTGAGGGATGCCCAGAAAGTTGG - Intergenic
929767723 2:44862308-44862330 CTGGAAAATCACCATATAGTTGG + Intergenic
933629179 2:84636670-84636692 CTTGGGGAATACCAGAAAGTGGG + Intronic
937876078 2:126826489-126826511 CTGGGGGCTCACCATGATGTTGG + Intergenic
939574507 2:143880015-143880037 CTGTGAGATCACTATAGAGTCGG - Intergenic
939765631 2:146245517-146245539 TTGGAGAATTACCATAAAGTTGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1171232346 20:23497497-23497519 CTGTGGGATCTCTATAAATTGGG + Intergenic
1176449728 21:6851744-6851766 CTTTGGGATCTCCATCAAGTGGG + Intergenic
1176827900 21:13716768-13716790 CTTTGGGATCTCCATCAAGTGGG + Intergenic
1178285588 21:31322869-31322891 CTGTGGGAAAACCATGAAGTGGG - Intronic
1179512707 21:41884482-41884504 CTGGAGCATCAGCACAAAGTGGG + Intergenic
1182009611 22:26989602-26989624 CTGGGCCAGCACCATAAAGTGGG - Intergenic
1183649595 22:39146135-39146157 CTGGGGCCTCATCCTAAAGTGGG + Intronic
955774966 3:62423149-62423171 ATGGGGTATCACCCTGAAGTGGG + Intronic
964205841 3:154174164-154174186 TAGTGGGATCACCATAAACTGGG + Intronic
968800197 4:2738234-2738256 CTGACCCATCACCATAAAGTAGG + Intergenic
984378793 4:178964367-178964389 CTGGCAGCTTACCATAAAGTTGG + Intergenic
984869564 4:184314293-184314315 CTGGAGGCTCACCACAAAGCAGG + Intergenic
986005318 5:3662678-3662700 CTGTGGGATCTCTATAAACTAGG - Intergenic
988525664 5:31984984-31985006 CTGGGTGATCTTCATAAAGTTGG + Intronic
990788458 5:59449788-59449810 ATGGGGGTGGACCATAAAGTAGG - Intronic
991090065 5:62685674-62685696 CTGGGGGAAAAGCAGAAAGTGGG + Intergenic
997057802 5:130465731-130465753 CTCAGGGCTCACTATAAAGTAGG + Intergenic
1000705793 5:164510457-164510479 CTGGGTGATCATTAAAAAGTCGG + Intergenic
1006899584 6:37491280-37491302 CTGTGGGAACACCATTCAGTAGG - Intronic
1010511551 6:76726793-76726815 CTAGGTGAACACCAAAAAGTAGG - Intergenic
1011668407 6:89658406-89658428 CTGGGGGAACAGCATAAGGTGGG + Intronic
1013218758 6:108056859-108056881 CTGAGGGATCACTACAAATTAGG + Intronic
1014384285 6:120781311-120781333 CTTGGGGAGCACAATGAAGTAGG - Intergenic
1020037528 7:4973916-4973938 CGGGGGGCTCACCATAGAGAGGG - Intergenic
1020162308 7:5781753-5781775 CGGGGGGCTCACCATAGAGAGGG + Intergenic
1035039855 7:155919726-155919748 CTGGGGTATCACCTTAGAGGGGG + Intergenic
1045420624 8:102011182-102011204 GTAGGGGTTGACCATAAAGTTGG - Intronic
1049224983 8:141446097-141446119 CTGGGGGCTCCCCATACAGCGGG - Intergenic
1049224992 8:141446137-141446159 CTGGGGGCTCCCCATACAGCGGG - Intergenic
1049225001 8:141446177-141446199 CTGGGGGCTCCCCATACAGCGGG - Intergenic
1050782362 9:9353762-9353784 CTGGTAGATTACCACAAAGTTGG + Intronic
1055422420 9:76158541-76158563 CTTGGGGATTAGCATAAAGGGGG - Intronic
1059604600 9:115820623-115820645 CTGAGACATCATCATAAAGTAGG - Intergenic
1060805082 9:126570294-126570316 ATGTGGTATCACCAGAAAGTAGG - Intergenic
1061397530 9:130351567-130351589 GTGGGGGCTCACCATGAACTCGG - Intronic
1062735508 9:138135210-138135232 CTGGGGGAGCACTGGAAAGTTGG - Intergenic
1203519456 Un_GL000213v1:32773-32795 CTTTGGGATCTCCATCAAGTGGG - Intergenic
1186048031 X:5557302-5557324 TTGGGTGATTACCATAATGTAGG + Intergenic
1187203798 X:17161786-17161808 CTGGGTGGACACCATAATGTTGG - Intergenic
1190292514 X:49001952-49001974 CTGGGAGAGCGCCATTAAGTAGG - Intronic
1195956440 X:110335952-110335974 ATGGGGGATTACCTTAGAGTAGG + Intronic
1196733210 X:118962253-118962275 CAGGGGGATCACCATCTATTTGG + Intergenic
1199603639 X:149559149-149559171 GTGTGGGATCACCATCAAATGGG - Intergenic
1199646748 X:149920325-149920347 GTGTGGGATCACCATCAAATGGG + Intergenic