ID: 918319940

View in Genome Browser
Species Human (GRCh38)
Location 1:183354802-183354824
Sequence CTGTGGTGATTGAGAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918319940 Original CRISPR CTGTGGTGATTGAGAGAAGT AGG (reversed) Intronic
900568835 1:3348475-3348497 CTGTCTTCATTGAGAGCAGTGGG + Intronic
901388009 1:8923806-8923828 CTTTGGTGAGTCAGAGAAATAGG - Intergenic
902923434 1:19680583-19680605 CTGGGGTCAGTGAGAGAAATGGG + Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906638762 1:47428302-47428324 CTGTGGAGATTGGGAGATGCTGG + Intergenic
907543793 1:55241430-55241452 CTGTGTTGAGTAAGAGTAGTAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
911820090 1:102407373-102407395 CTGAGGTGACTTAGAGCAGTTGG - Intergenic
912703263 1:111894227-111894249 CTGGCGTGTTTGAGAGAAGGAGG - Intronic
915554068 1:156651715-156651737 ATGTCTTGATTGAAAGAAGTTGG + Intronic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917321155 1:173783012-173783034 CTGTAGTGTTTAAGAGAATTTGG - Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918656862 1:187037654-187037676 TTGTGGTAATTGAGAGCAGAAGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919109343 1:193198296-193198318 CTGTGGTGATATTAAGAAGTAGG + Intronic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923462671 1:234220698-234220720 CTGTGGTGAGAGTGTGAAGTAGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1066348247 10:34610886-34610908 GTGTGGTGATGGGGAGAGGTGGG + Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069559528 10:69419744-69419766 CTGTGGTGTGTGAGAGAAGTGGG + Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071957927 10:90779345-90779367 CTGATGTGATTGTGAGAAGTGGG + Intronic
1073863476 10:107773377-107773399 CTGTGGTTTTAGAGAGCAGTTGG - Intergenic
1074927556 10:118088753-118088775 CTTTGGAGATTCAGAGAAGGGGG - Intergenic
1075509976 10:123064230-123064252 CTGGGGTGCTGGGGAGAAGTTGG - Intergenic
1076182349 10:128419922-128419944 CTGTGGTGATTGAGAATACACGG - Intergenic
1076286838 10:129307728-129307750 CTCTGGTGAGAGAGAGAAGGTGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080358906 11:31490117-31490139 TTCTGTTGATTTAGAGAAGTTGG - Intronic
1080698648 11:34625013-34625035 CTGTGGTGATTGGGGGTGGTGGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084734592 11:71096331-71096353 GTGTGGGGATTGAGACCAGTTGG + Intronic
1086123067 11:83320578-83320600 CAGTGGTGGTTGGGAGAAGTGGG - Intergenic
1086332913 11:85771812-85771834 CTGTGGTGATTCAGCAAAGAGGG - Intronic
1087386632 11:97478588-97478610 TTATGGTGATTTAAAGAAGTTGG + Intergenic
1089127857 11:116190056-116190078 CTCTTGTGAATGAGAGAAGGGGG - Intergenic
1089588104 11:119522716-119522738 CTGTGGTGATTGATGGCTGTGGG + Intergenic
1090901979 11:131040099-131040121 CTGTGGTGCTTGCCAGAAGCTGG + Intergenic
1091614524 12:2039328-2039350 ATGAGATGATTGATAGAAGTAGG + Intronic
1092725888 12:11485303-11485325 CACTGGTGTTTGAGAGAAGCCGG - Intronic
1096398594 12:51286757-51286779 CTGTGCTGATGGAGAGAGATAGG - Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097242920 12:57588542-57588564 CTGTTGTGTTTGAAAGAAGAGGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1099159140 12:79218524-79218546 CTGTGGTGATTGTGGGGAGGTGG - Intronic
1099652642 12:85447953-85447975 TTGGGGTGAATAAGAGAAGTGGG + Intergenic
1100596145 12:96073732-96073754 CCCTGGTGATTGACAGAAGAGGG - Intergenic
1101741970 12:107507676-107507698 TTGTGGGGATTGTAAGAAGTTGG - Intronic
1103815002 12:123647723-123647745 CTGTGGTGATAGACAAATGTTGG + Intronic
1104675749 12:130710852-130710874 CTGTGAGGATTGGGAGCAGTGGG - Intronic
1106763103 13:32887038-32887060 CTGTGGTCATTGAGAAATGTGGG + Intergenic
1107404553 13:40100270-40100292 CTGAGGAGATTGAGGGATGTGGG - Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1109593600 13:64520918-64520940 GTGTGGTGGTAAAGAGAAGTTGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1112206225 13:97325883-97325905 CAGTGGTGCTTGAAAGAAGAGGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1114554374 14:23553159-23553181 TTGTGTTGTTTAAGAGAAGTAGG - Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116301275 14:43187060-43187082 CCTTGGTGATTTATAGAAGTAGG + Intergenic
1118172893 14:63406570-63406592 CTGTGGCGATTTAGAGAGCTTGG - Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119394958 14:74319395-74319417 ATGTGGTGAATGAGAGAAAAAGG + Intronic
1119581498 14:75786615-75786637 CTGTGGTAATTGAGTGATTTTGG + Intronic
1119949189 14:78727188-78727210 CAGCAGTCATTGAGAGAAGTGGG + Intronic
1124897941 15:33794913-33794935 CTCTGGTTATTGGGAAAAGTGGG + Intronic
1125396720 15:39256760-39256782 CTGTGGTTAATGAGAAAATTTGG + Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126859491 15:52870293-52870315 GTATGGTGATGGAGAGAAGGGGG + Intergenic
1128505449 15:68267872-68267894 CAGTGGTGATTTAGAGAACCCGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131156676 15:90080099-90080121 CCGTGGGGAGTGGGAGAAGTGGG + Exonic
1131611021 15:93963847-93963869 CTGTCTTGATTGAAAGAACTGGG - Intergenic
1132026248 15:98406504-98406526 GTGTGGTGACGGAGACAAGTAGG - Intergenic
1132375550 15:101326099-101326121 CTGTGTTGTTAAAGAGAAGTGGG - Intronic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1137363778 16:47843177-47843199 CTGCCGTGAGTGATAGAAGTTGG - Intergenic
1137994183 16:53191430-53191452 CAGTGGTGGTTGAAAGAGGTAGG - Intronic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1140147524 16:72325531-72325553 CTTTGATGATTGACAGAAGTAGG + Intergenic
1146066511 17:29639928-29639950 CTATGGTGGGTGAGAGAAGCTGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146835429 17:36106869-36106891 CTGCGGGGACTGAGAGAAGGAGG + Intergenic
1149144965 17:53479314-53479336 CTGTAGTGACTGAGATAAATAGG - Intergenic
1149633708 17:58148908-58148930 CTGGAGTGAGTGAGAGAAGCAGG - Intergenic
1150865264 17:68842514-68842536 CTGTGGTCAATGATAGAGGTAGG + Intergenic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1153205134 18:2691140-2691162 CTGTGGTGGTTAAGACAAGATGG - Intronic
1154327676 18:13403860-13403882 CTGTGATGATTGAGAGTGGCTGG + Intronic
1155108955 18:22695090-22695112 CAGTGGTTATTAAGAAAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1156442922 18:37209725-37209747 CTGGGTTGATTGAGAGGAGTGGG + Intronic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1160009795 18:75097928-75097950 CTGTGGGGTTTGGGAGAGGTTGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1167749686 19:51372173-51372195 CTGCGGTGGTTGAGACAAGCGGG + Exonic
929327999 2:40641803-40641825 ATTTTGTGAGTGAGAGAAGTTGG - Intergenic
931893311 2:66700100-66700122 CTGTGGTGACTGAGAAAAGAGGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
934757406 2:96833612-96833634 CTATGGGGTTTTAGAGAAGTGGG + Exonic
936057914 2:109275265-109275287 CTCTTGTGATCCAGAGAAGTAGG + Intronic
936258868 2:110940323-110940345 CTGTGGTGATCAAAAGAAGCTGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937129463 2:119496787-119496809 CTGTGGTGGTTGGCAGGAGTAGG - Intronic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
937615161 2:123913435-123913457 CTGGGCTGATAGAGAGAACTTGG - Intergenic
937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
941363631 2:164582935-164582957 CTGTGGTGACTGACATAAATGGG - Intronic
941369429 2:164645967-164645989 CTGTGGTGATTAAAAGAAATAGG - Intergenic
942199655 2:173558539-173558561 ATGTGGTACTTGAGAGAAGCTGG - Intergenic
942534124 2:176945547-176945569 CTGAGGAGAGTGAGAGAAGGGGG - Intergenic
944393855 2:199247527-199247549 GAGTGGTGAGTGAGAGAGGTTGG - Intergenic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946156718 2:217811822-217811844 CTGTTTTGATTGTGGGAAGTTGG - Intronic
948169565 2:235890092-235890114 CTGTGTAGGTTGAGAGAAGGAGG + Intronic
1168850996 20:977080-977102 CTATTGTGAGTGAGTGAAGTGGG - Intronic
1168980454 20:1999061-1999083 CTGTGGAGACTGACAGAGGTGGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1170734886 20:19006054-19006076 ATGTACTGATTGAGAGAAGAGGG + Intergenic
1171322268 20:24256594-24256616 CTTAAGTGACTGAGAGAAGTTGG + Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177819929 21:26020154-26020176 CTGTGTTAAGTGAAAGAAGTCGG + Intronic
1179193805 21:39145812-39145834 CCATGGTGAGTGAAAGAAGTGGG + Intergenic
1179731911 21:43372804-43372826 CTGTGGTGAATGACAGCAGTGGG + Intergenic
1179731920 21:43372851-43372873 CTGTGGTGAATGACAGCAGTGGG + Intergenic
1182917395 22:34047714-34047736 CAGTGGTGATTGAGATGAGACGG - Intergenic
1183297588 22:37040378-37040400 CTGTGGTGCTGGACTGAAGTTGG + Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183468496 22:37992763-37992785 CTGTGGTGACTGGGAGCAGACGG - Intronic
949327022 3:2877724-2877746 CTCTAGTGATTTACAGAAGTAGG - Intronic
949345902 3:3076334-3076356 CAGAGGTGATTTACAGAAGTTGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951207513 3:19939994-19940016 AGGTGGTGTTTGAGAGATGTCGG - Intronic
951626005 3:24663589-24663611 CTGTGGTGATTGGGAGTACAAGG - Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953782431 3:45883500-45883522 GTCTGGTGATTAAGAGAAGATGG + Intronic
954138283 3:48592333-48592355 CAGTGGTGAGTGAGAGATGTGGG - Exonic
954542300 3:51401876-51401898 CTGAGGTGATTCAGTGGAGTAGG - Intronic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
955824707 3:62933604-62933626 CTGTGGTGATTTAGTTAACTTGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957705827 3:83782067-83782089 CAGTGGTGTTTTATAGAAGTTGG - Intergenic
959259596 3:104059327-104059349 ATGTGATCATTAAGAGAAGTTGG - Intergenic
961530170 3:127535855-127535877 CTGTGGTGAGAGAGAGGAGCAGG - Intergenic
962389982 3:134963062-134963084 CTGAGGTAAGTAAGAGAAGTAGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
965053915 3:163689552-163689574 ATGTGGGGATTGAGAGAAAGTGG - Intergenic
965373768 3:167896301-167896323 TTGTTGTGATGGAGAGAGGTGGG + Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967513141 3:190336020-190336042 CTTTGGCATTTGAGAGAAGTAGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970369801 4:15395254-15395276 CTGGGGTGATTTAGGGAAGAGGG + Intronic
971127102 4:23765965-23765987 CTGTGGTGGATGAGACAAGGAGG - Intronic
971194743 4:24461913-24461935 CTGTGGTCATTTGGAGAAGAGGG - Intergenic
971593734 4:28500424-28500446 TTGTGGTAGTTGAGAGAAATTGG + Intergenic
974884934 4:67806717-67806739 TGATGGTGATTGAGAGTAGTAGG + Intergenic
976134605 4:81922163-81922185 CTGTGGTGGTTAAGAACAGTAGG - Intronic
976142436 4:82006478-82006500 CTGTGGTGAGTGAGAAAGGAAGG - Intronic
977830326 4:101583275-101583297 CTCTGATGATTGAGAGATTTAGG + Intronic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978716019 4:111843256-111843278 CTGTGTTGACTGAGTGAATTTGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982139729 4:152305919-152305941 CTCTGCAGAGTGAGAGAAGTGGG + Intergenic
983220812 4:165042873-165042895 CTGTGGTGACAGGGAAAAGTAGG + Intergenic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
985139972 4:186829833-186829855 CTGTAGGGATTGAGAGGACTTGG - Intergenic
986092406 5:4523262-4523284 GGGTGGTGATGGCGAGAAGTGGG + Intergenic
986149717 5:5116343-5116365 CTGTTTTGAATAAGAGAAGTAGG + Intergenic
986229147 5:5845538-5845560 CTGTGGTGATGCAGAGGCGTGGG - Intergenic
986439469 5:7767047-7767069 CTGTAGTGGTTAAGAGAAGAAGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991661201 5:68952390-68952412 CTGTGGGGATTGAGAGAGCCTGG - Intergenic
991669416 5:69033020-69033042 CTGTGGGGATTAAGAGATGCAGG - Intergenic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
993983205 5:94567865-94567887 CTATGGGGCTTGAGTGAAGTAGG - Intronic
994458736 5:100048029-100048051 CTATGGTGCTTGAGTGGAGTAGG + Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996926382 5:128831681-128831703 TTGTGTTGATTGAGAGGACTGGG + Intronic
997570530 5:134923908-134923930 CTGTGGTGATTTGGAGGATTAGG + Intronic
997883516 5:137611457-137611479 GTGGGGTGAATGAGAGAATTAGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
1000993555 5:167935620-167935642 AGGTGGTGAAGGAGAGAAGTTGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1003472912 6:6453238-6453260 ATGTGGAAATTCAGAGAAGTAGG - Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1007881275 6:45170045-45170067 CTGTGTTGAAAGAGAGAAGTGGG - Intronic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1014078050 6:117259589-117259611 GTGGGGAGATTGAGAGATGTTGG - Intergenic
1015114956 6:129637609-129637631 ATTTGGTGATTGACACAAGTAGG - Intronic
1015173751 6:130283299-130283321 AGGTGGTGTTTGAGAGAAGAGGG + Intronic
1015375322 6:132503346-132503368 CTCTGCTGATTGAGAGAGGGAGG - Intronic
1015623258 6:135155328-135155350 CTTTGATAATTGACAGAAGTAGG - Intergenic
1016000976 6:139040866-139040888 CTGTTGTGACTGAGACAAATGGG - Intronic
1017383998 6:153861625-153861647 CTGTGGTGATAGTGACAGGTTGG - Intergenic
1021625035 7:22584688-22584710 CTGTGAAGATTCAGAGATGTGGG + Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022248822 7:28586636-28586658 GTGGTGTGATAGAGAGAAGTGGG + Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022762408 7:33369662-33369684 CTATGGTGATGGAGAGAGATAGG + Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1027484771 7:78747727-78747749 CCGTGGTGACTGAGTGAGGTTGG + Intronic
1028101785 7:86829605-86829627 CTGAGGTGATGGAGAGAGATAGG + Intronic
1030674910 7:112374440-112374462 CTGTGATGATTTGGAGAATTAGG - Intergenic
1034021743 7:147651754-147651776 CTGTGTTGTTTCAGAAAAGTTGG + Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034620393 7:152452194-152452216 GTGGGGTGAATGAGAGAAGGAGG + Intergenic
1037056375 8:14446276-14446298 CTTTGGTGAGTGACAGCAGTAGG - Intronic
1037316132 8:17601179-17601201 CTGTTGTGATAGGAAGAAGTGGG - Intronic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1044743190 8:95348355-95348377 ATGTGGTGAGAGAGAGGAGTGGG + Intergenic
1045107068 8:98902957-98902979 CAGTGGTGATTGAGAGGCTTGGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1046602997 8:116339805-116339827 CTGTGGTGTTTGGCTGAAGTAGG - Intergenic
1047157344 8:122334383-122334405 ATGTAGTTATTGAGAGAATTGGG + Intergenic
1047311531 8:123696597-123696619 AGGTGGTGATTGGGAGAAGGTGG + Intronic
1047914650 8:129569151-129569173 CCAAGGTGGTTGAGAGAAGTGGG + Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1049163914 8:141115308-141115330 CTGTGGTGACTGGGAGCAGGAGG + Intergenic
1050254697 9:3781643-3781665 GGGTGGTGACTGACAGAAGTAGG - Intergenic
1050376542 9:4980093-4980115 GTGTGGTGGTTGGGAGAAGGAGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1053195378 9:36113992-36114014 ATGTGGTCATTCAGAGACGTGGG + Intronic
1055584898 9:77748536-77748558 CTGTGGAGGATGACAGAAGTAGG + Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1059368043 9:113801813-113801835 CTGGGGTGAGGGAGAGAAGGCGG + Intergenic
1060722815 9:125989836-125989858 CTGTGGTGACTGAGAGTTGTTGG - Intergenic
1061543822 9:131292218-131292240 CTGTTGGGATTTAGAGAGGTAGG + Intronic
1061964305 9:134004499-134004521 CACTGGTGTTTGAGAGAAGCGGG - Intergenic
1203776435 EBV:75693-75715 CTGTGGTGAGGGATAGAAGGGGG + Intergenic
1186123218 X:6384925-6384947 CTGTGTTCATAAAGAGAAGTGGG + Intergenic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1191982126 X:66937501-66937523 CTTTGATGAGTGAGAGAAGAAGG - Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1192999951 X:76553001-76553023 CTCTGGTTATTAAAAGAAGTGGG + Intergenic
1193418828 X:81258595-81258617 GTGTTTTGGTTGAGAGAAGTGGG + Intronic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1194670464 X:96726259-96726281 CTGTGATGATTGACAGAATTGGG - Intronic
1195222249 X:102756427-102756449 TTGTTTTGATTGAGAGTAGTGGG - Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195576862 X:106461161-106461183 TTGTGGTAATAGTGAGAAGTGGG + Intergenic
1195669970 X:107461408-107461430 CTGTGGTGACTGACTGGAGTGGG - Intergenic
1197925810 X:131646174-131646196 CTATGGTCAATGAGAGAAGCTGG + Intergenic
1198479377 X:137027067-137027089 TTGTGGTGTCTCAGAGAAGTGGG + Intergenic
1200123698 X:153803358-153803380 CGGTGGTGACTGAGAGAAGAGGG + Exonic
1201610655 Y:15839704-15839726 CTGGAGTGATTGAAAGCAGTGGG - Intergenic