ID: 918322341

View in Genome Browser
Species Human (GRCh38)
Location 1:183376230-183376252
Sequence TTAGTTGAGAACCTATTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918322341 Original CRISPR TTAGTTGAGAACCTATTAAG TGG Intronic
901721147 1:11198977-11198999 TTAGTTGAGAAGCAATTCTGTGG - Intronic
901914640 1:12488972-12488994 ATAGTAGACAACCTATAAAGTGG - Intronic
903399970 1:23035802-23035824 TTAGTAGAGAAAGTATTAAAAGG + Intronic
907738980 1:57145095-57145117 TTTGTTGAGCACCTACTATGTGG - Intronic
910676772 1:89822553-89822575 TTTATTGAGCACCTATTACGTGG + Intronic
911245889 1:95516853-95516875 TTCATTGAGAACCTACTATGTGG + Intergenic
913244661 1:116861045-116861067 TTTGTGAAGAACCTCTTAAGTGG + Intergenic
916334829 1:163659092-163659114 TTAGTTGAGAAAGGATCAAGTGG - Intergenic
918322341 1:183376230-183376252 TTAGTTGAGAACCTATTAAGTGG + Intronic
918399612 1:184150787-184150809 GTATTTGAGAACCTACTATGTGG - Intergenic
918458142 1:184747451-184747473 TTAGTTGAGAACTTGAAAAGAGG + Intronic
918556912 1:185813135-185813157 TTAATTGAGCAACTATTATGGGG - Intronic
919137580 1:193530197-193530219 TTTGTTGAGAACATACTATGTGG + Intergenic
922054984 1:222033271-222033293 TTATTTGAGAACAGATAAAGTGG - Intergenic
923594268 1:235348533-235348555 TTATTAGAAAATCTATTAAGAGG - Intergenic
923814755 1:237364917-237364939 TTAGTTGAGAAATGAATAAGGGG - Intronic
1063850039 10:10177620-10177642 TTAATCGAGAATCTATTAAGTGG - Intergenic
1067669129 10:48303643-48303665 TTCCTTGTTAACCTATTAAGGGG - Intergenic
1069556216 10:69400265-69400287 TTGGTTGGGGACCTATTAGGTGG - Intronic
1071274359 10:84039312-84039334 TTTGTTGAATATCTATTAAGTGG + Intergenic
1071694573 10:87858222-87858244 ATATTTGGGAGCCTATTAAGTGG - Intergenic
1074584893 10:114758230-114758252 TGAGTTGAACACCTACTAAGTGG - Intergenic
1075627853 10:123975759-123975781 TTAGTTGAGATCATATTATATGG - Intergenic
1077844439 11:6009968-6009990 TTAGTTGAGAACTGATAAAATGG - Intergenic
1078981746 11:16543092-16543114 TTAATTGAGCACCTACTAACAGG + Intronic
1078987352 11:16608534-16608556 TTTGCTGAGATCCTACTAAGTGG - Intronic
1081871898 11:46386743-46386765 TTAATTGAGCACCTACTATGTGG + Intergenic
1087751115 11:102007884-102007906 TTATTTGAGGACCTATTACATGG - Intergenic
1087986030 11:104681030-104681052 TTAGTTGACATCCTATTATAAGG + Intergenic
1090007364 11:123014811-123014833 TTTGTTGAGCACCTATTATGTGG + Intergenic
1092601192 12:10066863-10066885 TTTATTGAGAACCTACTATGTGG - Intergenic
1095476560 12:42591783-42591805 TTTGTTGAGCATCTATTATGTGG + Intergenic
1098265984 12:68719698-68719720 TTAATTGAAAGCCTATTCAGGGG + Intronic
1100698570 12:97121625-97121647 TTTATTGAGCACCTATTATGTGG - Intergenic
1101461615 12:104902457-104902479 TTAGTTTAGAATGTATTGAGTGG + Intronic
1104371837 12:128230364-128230386 TTTGTTTAGAAACTACTAAGGGG + Intergenic
1104615705 12:130266798-130266820 TTTATTGAGCACCTATTAAAAGG + Intergenic
1105731136 13:23217705-23217727 TTTGTTGAGTACCTATTACATGG - Intronic
1107177853 13:37420624-37420646 TTAGTTGAGAAAATTTAAAGGGG - Intergenic
1108648373 13:52452067-52452089 TTAGTTAAGACCCCAATAAGTGG - Intergenic
1114519439 14:23324017-23324039 TTAGATGAGTCCCTATTTAGAGG + Exonic
1116345277 14:43785647-43785669 TTAGTTGAGAATGTAGTAAATGG - Intergenic
1117127877 14:52650857-52650879 TGAGGTCAGACCCTATTAAGAGG + Intronic
1120237104 14:81904354-81904376 TTATTTAAGAACGTATTAAGGGG - Intergenic
1120496999 14:85250067-85250089 TTACGTGAGAACCAAATAAGTGG + Intergenic
1120497700 14:85257110-85257132 CTAGTTGAGAATACATTAAGAGG - Intergenic
1126541463 15:49829151-49829173 TTTACTGAGTACCTATTAAGTGG + Intergenic
1127429717 15:58891936-58891958 TTAGTTGACAACAGATTGAGAGG - Intronic
1129225684 15:74169126-74169148 TTTGTTAAGCACCTACTAAGTGG + Intergenic
1131799673 15:96056056-96056078 TTAAATGAGTACCAATTAAGGGG + Intergenic
1136075495 16:27814411-27814433 TGAGTTGAAAATGTATTAAGGGG - Intronic
1137426211 16:48383916-48383938 TTTGTTGAGAACTTAGTATGGGG + Intronic
1140598188 16:76441044-76441066 TTAGTTGAGACCCTTCTTAGAGG + Intronic
1143261538 17:5602750-5602772 TTTATTGTGAACCTACTAAGTGG - Intronic
1145197249 17:20905110-20905132 TTATTTGACAAGCTATTCAGTGG - Intergenic
1153843867 18:9031207-9031229 TTAGTTGTCAACCTTTTAAGTGG + Intergenic
1155653394 18:28168131-28168153 TTGGTTGGGAAACTATTAAGTGG - Intronic
1157021571 18:43789019-43789041 TTAGTTGAGAAGCTAAGTAGAGG + Intergenic
1160616683 18:80136162-80136184 TGATTTCAGAACATATTAAGAGG + Exonic
1162057605 19:8074033-8074055 TCTGTTGAGAACCTAGTTAGGGG + Intronic
1164562662 19:29303605-29303627 TCAGCTGAGAACCTCTGAAGAGG + Intergenic
1167055551 19:47109657-47109679 GCAGTTGTGAACATATTAAGAGG + Intronic
927443685 2:23139173-23139195 TTTATTGAGGACCTATTATGAGG - Intergenic
929073943 2:38061793-38061815 TTAATTGAGCACCTATTAGTAGG - Intronic
929601065 2:43204961-43204983 CTACCTGAGAAACTATTAAGCGG - Intergenic
929902841 2:46020852-46020874 TTTATTGAGCACCTATTATGTGG + Intronic
930848810 2:55935674-55935696 TTTGTTGAGAACCTATTTCATGG - Intergenic
930959627 2:57244548-57244570 TCATTTGAGAAAATATTAAGAGG + Intergenic
931075072 2:58701796-58701818 TTAGTTGTGTACCTATTATAAGG + Intergenic
934955714 2:98616557-98616579 TTGGTTGAGAACATAGCAAGAGG + Intronic
935185073 2:100724374-100724396 TTAGTTCAGAATCTATAAAAGGG + Intergenic
935445229 2:103149279-103149301 TTAGTCAAGAAACTATAAAGGGG + Intergenic
941433325 2:165437195-165437217 CTAGTTGAGAAGCTATTTAAAGG - Intergenic
942110851 2:172681539-172681561 TTCATTGAGCACCTATTATGGGG + Intergenic
942966182 2:181894616-181894638 CTATTTGAGAACTTATCAAGTGG - Intronic
944137892 2:196419668-196419690 TTTGTTGAGAACCTACTGTGTGG - Intronic
1170025591 20:11885948-11885970 TAAGTTGAAAACATAATAAGTGG + Intergenic
1170300929 20:14883826-14883848 TTACTAGAGTACCTATTAAAGGG + Intronic
1170482536 20:16781025-16781047 TTATTAGAGAAGCTATTAACAGG - Intergenic
1170681615 20:18531042-18531064 TTGGTTGAGATCCTTTTAATTGG - Intronic
1173429290 20:42971846-42971868 TTAATTGAGCACCTACTATGAGG + Intronic
1178324258 21:31630860-31630882 ATACTTGAAAACGTATTAAGAGG - Intergenic
1178980629 21:37261029-37261051 GTTTTTGAGCACCTATTAAGTGG + Intronic
1182251897 22:29007301-29007323 GTACTTGGGAACCTAATAAGTGG + Intronic
1182754279 22:32666291-32666313 TAAGATGAGAAACTATTGAGAGG - Intronic
952727306 3:36600154-36600176 TTTATTGAGCACCTATTATGAGG - Intergenic
953130356 3:40132316-40132338 TTATTTGAGAACTTCTTAGGAGG - Intronic
953266466 3:41393960-41393982 TTAGTTTATAACCTATAAAATGG + Intronic
955915166 3:63900450-63900472 TTAGTCCAGAACATTTTAAGAGG - Intronic
957155736 3:76541705-76541727 GTAGTTGGGAAGGTATTAAGAGG + Intronic
960264828 3:115608781-115608803 TTAATTGTGAAATTATTAAGTGG - Intergenic
960384212 3:117001387-117001409 TTAATTGAGCACCTATTATACGG + Intronic
961866416 3:129956639-129956661 TTACTTCAGCATCTATTAAGTGG + Intergenic
962727773 3:138250262-138250284 TTTATTGAGCACCTATTATGTGG - Intronic
962960661 3:140308392-140308414 TTTATTGAGAGCCTACTAAGTGG - Intronic
962964109 3:140337715-140337737 TTAGTTGAGAACCTAATCTGGGG - Intronic
963163720 3:142179733-142179755 TTATTTGACAACAGATTAAGTGG - Intronic
963833239 3:150031221-150031243 TTAAATGAGAGCTTATTAAGAGG - Intronic
964395484 3:156241298-156241320 TGTGTTGAGAAACTATTAGGAGG - Intronic
964868725 3:161290102-161290124 TTTATTGAGAACCTACTAACAGG + Intergenic
965043828 3:163549384-163549406 TGTGTTGAGTTCCTATTAAGTGG + Intergenic
965346907 3:167562301-167562323 TTAGTTGAGAATCTCTTACCTGG - Intronic
970351804 4:15208868-15208890 TTAATTGAGAACTTACTATGTGG - Intergenic
972981387 4:44707346-44707368 TTAATTTAGAACCTAATCAGTGG - Intronic
974574139 4:63695372-63695394 TGAGTTGAGAAGTTATTTAGGGG - Intergenic
974574213 4:63696901-63696923 TTTATTGAGCACCTATTATGTGG + Intergenic
977423366 4:96832157-96832179 TTCATTGAGCACATATTAAGAGG - Intergenic
978951959 4:114571628-114571650 GTAGGTGACAGCCTATTAAGAGG - Intergenic
983081330 4:163388524-163388546 TTTGTTGAGTACCTATTACGTGG + Intergenic
989140953 5:38200805-38200827 TTTGTTCAGAATCTATCAAGAGG - Intergenic
989512137 5:42300462-42300484 TTTATTGAGAACTTATTTAGAGG - Intergenic
991218403 5:64183285-64183307 TTAGTGTAGTACTTATTAAGTGG - Intronic
994652570 5:102546995-102547017 TTTGTTGATATCCTATTATGTGG - Intergenic
996107925 5:119528076-119528098 TTTATTGAGAACCTATAAACTGG + Intronic
997039698 5:130237004-130237026 TTAGCAGAGAACCAATAAAGAGG - Intergenic
998508010 5:142687474-142687496 TTTCTTGAGACCCTATTAATTGG + Intronic
999948211 5:156620369-156620391 TTATTTGAGAACTTTTAAAGAGG - Intronic
1001569473 5:172720813-172720835 TGACTTGGGAACCTATGAAGAGG - Intergenic
1010229540 6:73522408-73522430 GTATTTGAGAACCTACTATGTGG + Intronic
1010637381 6:78277698-78277720 TTAATTTAGAACCTAAAAAGAGG - Intergenic
1012526129 6:100179842-100179864 TTAGTATGGAACCTATTAAAGGG - Intergenic
1012605177 6:101149410-101149432 TTTATTGAGCACCTATTATGTGG - Intergenic
1015765348 6:136710460-136710482 TTGGTTGATAACCAATTAAGGGG + Intronic
1015840458 6:137471465-137471487 TTTGCTGAGAACCAATTATGGGG - Intergenic
1023593096 7:41799609-41799631 TAATTTGAAAACCTTTTAAGAGG + Intergenic
1027795336 7:82685958-82685980 CTAGGTTAGAATCTATTAAGAGG + Intergenic
1028016135 7:85715325-85715347 TTATTTGGAAACCTATTAATAGG - Intergenic
1028695064 7:93699687-93699709 GTATTTGAGGTCCTATTAAGTGG - Intronic
1030490190 7:110223003-110223025 TTAGTTGAGTACTTACTAATGGG + Intergenic
1031516610 7:122708238-122708260 TTTATTGAGAACCTATGATGTGG - Intronic
1032493257 7:132340977-132340999 TGAGTTAAGAACCTAGGAAGAGG - Intronic
1033708677 7:143915430-143915452 TCAGATGAGAACGTTTTAAGTGG - Intergenic
1044862512 8:96536611-96536633 TGAGTTGAGTACCTTTTAGGTGG + Intronic
1045136373 8:99223520-99223542 TTAGTTATGAATCTAGTAAGTGG + Intronic
1045243613 8:100423786-100423808 ATTATTGAGAACCTACTAAGAGG - Intergenic
1046292239 8:112178455-112178477 TTAGTTGAAAAACTTTTATGTGG + Intergenic
1046665967 8:117003296-117003318 TTTATTGAGTACCTACTAAGTGG + Intronic
1046914783 8:119668255-119668277 TTATTTGAGCACCTAATATGTGG - Intronic
1047300573 8:123610223-123610245 TTTATTGAGGGCCTATTAAGGGG - Intergenic
1057734160 9:97638199-97638221 ATAGTTGAGAGACTATAAAGGGG - Intronic
1058271563 9:102978002-102978024 ATATTTGAGAAGCTATGAAGAGG - Intergenic
1059625094 9:116055029-116055051 TTTGTTGAGAAGATATTAAAAGG - Intergenic
1186100204 X:6147797-6147819 TTATTTGAGCACCTATCAAAAGG + Intronic
1186444018 X:9610481-9610503 TTAATTGAGTATCTATTATGTGG + Intronic
1188480078 X:30628438-30628460 TTTGCTGAGAGCCTATTATGAGG + Intergenic
1188987137 X:36778065-36778087 TTAGATGAGGACCCAGTAAGAGG - Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189263733 X:39697640-39697662 TTTGTTGAGCATCTATTATGTGG - Intergenic
1193868758 X:86770335-86770357 TTAGTTCAGAACATATTTTGAGG + Intronic
1194592870 X:95821514-95821536 TCATGTGAGAACATATTAAGAGG - Intergenic
1195952357 X:110288407-110288429 ATTGCTGAGAACCTATTATGTGG - Intronic
1196345561 X:114652702-114652724 TTATTTGAGCACCTGTTATGTGG + Intronic
1196777202 X:119349978-119350000 TTAGTTTAAAATATATTAAGAGG + Intergenic
1197536997 X:127702517-127702539 TTAGTTTAGGAACTATAAAGCGG - Intergenic
1198205109 X:134458573-134458595 TTTCTTGAGCACCTATTATGTGG + Intergenic