ID: 918325520

View in Genome Browser
Species Human (GRCh38)
Location 1:183406386-183406408
Sequence GGATCTCGAGGAAAAGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918325516_918325520 23 Left 918325516 1:183406340-183406362 CCTATTTGAATGTCTCACAGTGG 0: 1
1: 0
2: 3
3: 14
4: 151
Right 918325520 1:183406386-183406408 GGATCTCGAGGAAAAGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 142
918325515_918325520 26 Left 918325515 1:183406337-183406359 CCACCTATTTGAATGTCTCACAG 0: 1
1: 0
2: 2
3: 13
4: 143
Right 918325520 1:183406386-183406408 GGATCTCGAGGAAAAGAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918325520 Original CRISPR GGATCTCGAGGAAAAGAACT AGG Intronic