ID: 918326675

View in Genome Browser
Species Human (GRCh38)
Location 1:183417500-183417522
Sequence CCTAGGACGGGGAGGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 470}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918326675_918326690 7 Left 918326675 1:183417500-183417522 CCCGGCCCCCTCCCCGTCCTAGG 0: 1
1: 0
2: 2
3: 41
4: 470
Right 918326690 1:183417530-183417552 TCCCTGAGGCCGAACCTAGGCGG 0: 1
1: 0
2: 1
3: 5
4: 70
918326675_918326693 13 Left 918326675 1:183417500-183417522 CCCGGCCCCCTCCCCGTCCTAGG 0: 1
1: 0
2: 2
3: 41
4: 470
Right 918326693 1:183417536-183417558 AGGCCGAACCTAGGCGGAAAAGG 0: 1
1: 0
2: 0
3: 0
4: 48
918326675_918326689 4 Left 918326675 1:183417500-183417522 CCCGGCCCCCTCCCCGTCCTAGG 0: 1
1: 0
2: 2
3: 41
4: 470
Right 918326689 1:183417527-183417549 GGGTCCCTGAGGCCGAACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 171
918326675_918326694 14 Left 918326675 1:183417500-183417522 CCCGGCCCCCTCCCCGTCCTAGG 0: 1
1: 0
2: 2
3: 41
4: 470
Right 918326694 1:183417537-183417559 GGCCGAACCTAGGCGGAAAAGGG 0: 1
1: 0
2: 0
3: 2
4: 31
918326675_918326687 -7 Left 918326675 1:183417500-183417522 CCCGGCCCCCTCCCCGTCCTAGG 0: 1
1: 0
2: 2
3: 41
4: 470
Right 918326687 1:183417516-183417538 TCCTAGGCAGCGGGTCCCTGAGG 0: 1
1: 0
2: 2
3: 14
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918326675 Original CRISPR CCTAGGACGGGGAGGGGGCC GGG (reversed) Intronic
900099133 1:953617-953639 CCCAGGTGGGGGTGGGGGCCAGG + Intronic
900178638 1:1301916-1301938 CCTTGGAGGGGAAGGGGGTCTGG - Intronic
900184116 1:1325011-1325033 CCCAGGAAGGGGCGGAGGCCCGG - Exonic
900297666 1:1960120-1960142 CCCGGGATGGGGAGGAGGCCAGG - Intronic
900301203 1:1978354-1978376 GCTAGGCCTGGGAGGGAGCCGGG + Intronic
900317935 1:2068767-2068789 CCTCTCACGGGGCGGGGGCCTGG - Intronic
900342637 1:2195956-2195978 CCGGGCAGGGGGAGGGGGCCTGG + Intronic
900394016 1:2445691-2445713 CCTAGGTGGTGGTGGGGGCCTGG + Intronic
900614012 1:3556218-3556240 CCCAGGATGGGGAGTGGGGCAGG + Intronic
901433924 1:9234816-9234838 CCTGGGGCGGGGTGGCGGCCGGG + Exonic
901472326 1:9466240-9466262 CCTGGGACTGGGAGGGTTCCAGG - Intergenic
901664990 1:10820772-10820794 CCTGGGCTGGGGACGGGGCCTGG + Intergenic
901694605 1:10997498-10997520 CCTAGGAGGGGGAGGGGAGAGGG + Intergenic
901781777 1:11599000-11599022 CCTGGGAGAGGGAGGGGTCCTGG + Intergenic
901988708 1:13095218-13095240 CACAGGACGGGCAGGGGGCGGGG + Intergenic
901993105 1:13131549-13131571 CACAGGACGGGCAGGGGGCGGGG - Intergenic
902348360 1:15835558-15835580 CCCAGCACGGGGAGAGGGCAGGG - Intergenic
902440866 1:16429064-16429086 CCTGGGGCAGGGAGAGGGCCTGG - Intronic
902612089 1:17603306-17603328 CCTTGGAGGGGGTGGGGGGCGGG + Intronic
902754878 1:18542372-18542394 CCTAGGAGGGGGATGGGGAGCGG + Intergenic
903020596 1:20391136-20391158 CCTGGGGCAGTGAGGGGGCCAGG - Intergenic
903263535 1:22143418-22143440 CCTAGGCCCGGGCGGCGGCCGGG - Intronic
903767938 1:25746797-25746819 CCTCGGCGGGGGAGGGGGGCGGG + Intronic
904418756 1:30378185-30378207 CCAGGGCCTGGGAGGGGGCCTGG + Intergenic
904495786 1:30885909-30885931 CCTGGGTTGAGGAGGGGGCCTGG - Intronic
904613871 1:31739434-31739456 CCTGGCAGGGGGAGGGGCCCAGG - Exonic
904618895 1:31763955-31763977 CCTAAGTCGGGGACCGGGCCGGG + Exonic
905075654 1:35268808-35268830 CCGGGGACGGGGTGGGGGCCGGG - Intergenic
905769998 1:40631227-40631249 CCTAAGAGAGGGAGGGGGCAGGG + Intronic
905797347 1:40823190-40823212 CCTAGGGCTGGGAGGGCGCAGGG - Intronic
906687059 1:47769598-47769620 CCTAGGAAGGGGTGGGGATCTGG - Intronic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
907884127 1:58577347-58577369 CGTGGGACGGGGAGGGGGGCGGG - Exonic
908102431 1:60805292-60805314 CCAAGGGTGGGGAGGGGGCATGG + Intergenic
912430296 1:109625227-109625249 CCTAGGCAGGGCAGGGGCCCAGG + Intronic
912485218 1:110021568-110021590 CCCAGGCTGGGGAGGGGCCCTGG + Intronic
912568626 1:110606465-110606487 CCCAGGGCGGGGAGGGGTCTGGG + Intronic
912844000 1:113063529-113063551 TCCTGGACGGGGAGGCGGCCGGG + Intergenic
913209359 1:116570496-116570518 CCCGGGACGGGGAGCGGGCGCGG - Intronic
914425012 1:147567771-147567793 CCTAGCAGGGGGAGGGGGAAGGG - Intronic
915118942 1:153616616-153616638 CCTAGGAAGTGGAAGGGCCCTGG + Intronic
915147998 1:153806753-153806775 CCTAGGACGGGGGTGGGGGTAGG + Exonic
915279557 1:154813403-154813425 CCCAGGAAGAGGAGGCGGCCCGG - Intronic
915339312 1:155167564-155167586 CCTAGGGCGGGGAGGGGGGAAGG - Intergenic
915557320 1:156667933-156667955 TGTAGGACAGGGAGGGGACCAGG - Intergenic
916482052 1:165222956-165222978 CCTAGGACTGGGAGGAGGTTTGG + Intronic
916651728 1:166839774-166839796 GCTGGGGCCGGGAGGGGGCCAGG + Intronic
918073141 1:181148616-181148638 TCTGGGAAGGGGAGGAGGCCTGG - Intergenic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
919900752 1:202042689-202042711 CCTTGGCTGGGGTGGGGGCCTGG - Intergenic
919935654 1:202248908-202248930 CCCAGGATAGGGAGGGGGCCAGG - Intronic
920279128 1:204829693-204829715 ACTAGGATGGGGAAGGGGCAGGG + Intronic
920333345 1:205228018-205228040 CGCGGGCCGGGGAGGGGGCCGGG + Intergenic
922418211 1:225441322-225441344 GCTGGGACGGAGAGGAGGCCAGG - Intergenic
922718040 1:227887154-227887176 CCTGGGCCGGGCAGGGGGCGGGG + Intergenic
922925278 1:229342625-229342647 GCGAGGGCGGGGAGGGGGCGGGG + Intronic
923037158 1:230292266-230292288 GCGAGGTCGGAGAGGGGGCCGGG + Intergenic
923684039 1:236142140-236142162 CCGGGGATGGGGAAGGGGCCGGG + Intergenic
923684090 1:236142257-236142279 CCGGGGATGGGGAGGGGGCCGGG + Intergenic
1062843683 10:689395-689417 CCTGCGGCGGGGCGGGGGCCGGG - Intronic
1062874013 10:931286-931308 CCTGGGCCGGGGCCGGGGCCGGG - Intronic
1063429560 10:5977247-5977269 CCCAGGCCGGGGAGGGGACGCGG - Intronic
1063508243 10:6621408-6621430 AGTAGGAAGGAGAGGGGGCCAGG + Intergenic
1063701455 10:8388680-8388702 CAAAGGATGGGGAGGGGGCTGGG + Intergenic
1064052315 10:12069183-12069205 CCCAGGTCGGGGATGGGGCCCGG + Exonic
1064176606 10:13080782-13080804 CCTGTGTCAGGGAGGGGGCCAGG + Intronic
1064553025 10:16521325-16521347 CCGAGCCCGGGGTGGGGGCCGGG + Exonic
1064960141 10:20954684-20954706 CACAGGAAGAGGAGGGGGCCTGG + Intronic
1067294190 10:44965355-44965377 TCTGGAAAGGGGAGGGGGCCTGG + Intronic
1067883570 10:50068000-50068022 GCTAGGATGGTGAGGGCGCCGGG + Exonic
1068744441 10:60514274-60514296 CCTTGAACAGAGAGGGGGCCGGG - Intronic
1068953737 10:62804229-62804251 CCTAGGAGGGGAGGGGGTCCAGG - Intergenic
1070842865 10:79499914-79499936 CCTAGAACTGGGACTGGGCCTGG + Intergenic
1071600665 10:86957364-86957386 CGTAGGACGGTAAGAGGGCCTGG - Exonic
1072242008 10:93505410-93505432 CCTAGGAGGGGTCTGGGGCCAGG + Intronic
1073008054 10:100339689-100339711 CCCAGGAAAGGGATGGGGCCTGG - Intergenic
1074815000 10:117136694-117136716 CCAAGGAGGTGGAGGGGGACGGG - Intronic
1074843003 10:117374327-117374349 TGGAGGTCGGGGAGGGGGCCTGG - Intronic
1075444091 10:122501696-122501718 CCTACGAGGAGGAGGGTGCCAGG + Intronic
1075645563 10:124093729-124093751 ACTCGGAGGGGGAGGGGGCAGGG - Intergenic
1076048378 10:127313000-127313022 CCCAGGACTGGGAGGGGCCAGGG - Intronic
1076255691 10:129022754-129022776 CCTAGAGGGGGGAGGGGGCGGGG - Intergenic
1076369154 10:129940742-129940764 CCCTGGGTGGGGAGGGGGCCTGG - Intronic
1076426388 10:130370243-130370265 CCCTGGCAGGGGAGGGGGCCTGG + Intergenic
1076798479 10:132810017-132810039 CCTTGCTTGGGGAGGGGGCCAGG + Intronic
1076992858 11:284688-284710 CCGGGGAGGGGGAGGGTGCCTGG + Intronic
1077060149 11:614326-614348 GCTGGGGCAGGGAGGGGGCCTGG + Exonic
1077080234 11:721751-721773 ACAGGGACGGGGACGGGGCCAGG + Intronic
1077219936 11:1411362-1411384 CCTAGTTTGGGGAGGGAGCCTGG + Exonic
1077495483 11:2884847-2884869 CCGGGGCCGGGGCGGGGGCCGGG + Exonic
1077593354 11:3510060-3510082 AGTAGGATGGGGAGGGGGTCTGG + Intergenic
1079018304 11:16888035-16888057 CCCAGAACGGGGTGGCGGCCAGG - Intronic
1079030428 11:16982376-16982398 CCTGGGTTGGGGTGGGGGCCAGG - Intronic
1080663198 11:34313968-34313990 CCTAGGACCGTGTGGGAGCCAGG - Intronic
1081063732 11:38512881-38512903 CTTGGGAGGGGTAGGGGGCCGGG - Intergenic
1081118207 11:39231952-39231974 CCTAGGAAGTGCAAGGGGCCAGG + Intergenic
1082261024 11:50076381-50076403 CCTAGGACTGGAACTGGGCCTGG + Intergenic
1082794618 11:57370207-57370229 CCTAGGAAGCAGATGGGGCCAGG - Exonic
1082824288 11:57566944-57566966 TCTAGGAGGGGGGGGGGGGCGGG - Intronic
1083638977 11:64135297-64135319 GCCAGGACCGGGAGGGGGCCTGG - Intronic
1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG + Intergenic
1084249181 11:67882775-67882797 ACTAGGATGGGGAGGGGGTCTGG + Intergenic
1084397128 11:68919190-68919212 CACAGGACGGGGACGGGGACGGG - Intronic
1084437417 11:69152093-69152115 CCTAAGACAAGGAGGAGGCCCGG + Intergenic
1084438404 11:69157221-69157243 CCCGGGATGGGGCGGGGGCCGGG - Intergenic
1084497586 11:69513893-69513915 CCATGGACGGGAAGGGGACCCGG - Intergenic
1084656370 11:70522068-70522090 CCTAGGAGGTGGAGGTAGCCTGG - Intronic
1084823629 11:71712694-71712716 ACTAGGATGGGGAGGGGTTCTGG - Intergenic
1084978384 11:72815508-72815530 CCTGGGTCGGGGCGGGGGGCAGG - Intronic
1086112719 11:83217178-83217200 CCTAGAAAGGGGAGGAGCCCAGG + Intronic
1086341526 11:85853057-85853079 TCCCGGACGGGGAGGCGGCCGGG - Intergenic
1086341734 11:85854703-85854725 CGGGGGACGGGGACGGGGCCTGG - Intergenic
1086443381 11:86850079-86850101 CCTAGAAAGGGGAGGAGCCCAGG - Intronic
1087553253 11:99679610-99679632 CCAAGGACAGGGAGAGGGACAGG - Intronic
1088401404 11:109424634-109424656 CAAAGGGAGGGGAGGGGGCCCGG + Exonic
1089200867 11:116724064-116724086 CCTATTGTGGGGAGGGGGCCGGG - Intergenic
1089215708 11:116833455-116833477 CCTAAGAGGGCTAGGGGGCCTGG - Intergenic
1089321965 11:117632495-117632517 CCTAGGATGAGCGGGGGGCCAGG - Intronic
1089528832 11:119113615-119113637 CCTTGGACGGGGAGCGGGAGGGG - Exonic
1090237948 11:125163577-125163599 CCCAGGCCAGGCAGGGGGCCTGG - Intergenic
1090265065 11:125348460-125348482 CCAAGGAGGGGGAGGGGCCAGGG + Intronic
1091274534 11:134341772-134341794 CCAGAGACGGGGAGGGGGCAGGG - Intronic
1095900687 12:47325239-47325261 CCTACAACGGGGAGGGGGTGGGG - Intergenic
1095965435 12:47864098-47864120 CCTAGGGCCGGGTGGGGGTCTGG + Intronic
1096041330 12:48520327-48520349 CCCCAGACGGGGAGGCGGCCAGG + Intronic
1096116801 12:49059930-49059952 CCTAGGACTGAGAGGCCGCCCGG - Intergenic
1096389423 12:51217586-51217608 GCACGGAGGGGGAGGGGGCCGGG - Intronic
1096459516 12:51814512-51814534 CCCAGGACAGGGACGCGGCCTGG + Intergenic
1096651638 12:53064798-53064820 ACTGTTACGGGGAGGGGGCCAGG + Exonic
1096673827 12:53215724-53215746 CCGAGGAGGCGGAGGGGGCGAGG + Exonic
1096841041 12:54379259-54379281 CCGAGGACGGGGGCGGGGACAGG + Intronic
1097157490 12:57023497-57023519 TCAAGGCCGGGGAGGGGGCAGGG - Intronic
1099756038 12:86850143-86850165 GCTAGGAAGGGTAGGGGGACAGG - Intergenic
1101502367 12:105316041-105316063 CATGGGACGGGTAGGTGGCCAGG - Intronic
1102277992 12:111598203-111598225 CCCAGGACTCGGAGGGGGCGGGG + Intronic
1103010722 12:117456294-117456316 GCTAGGAGGGAAAGGGGGCCGGG + Exonic
1103302276 12:119937208-119937230 GCTAGGATGGGGAGGGGACCAGG - Intergenic
1104748277 12:131223248-131223270 GCGAGGACTGGTAGGGGGCCTGG - Intergenic
1104816159 12:131646673-131646695 CCCAGGACGATGAGGGGACCAGG - Intergenic
1104892840 12:132148666-132148688 GCCAGGCCGGGGAGGGGGCGGGG + Intronic
1104904974 12:132208286-132208308 GCCAGGAAGGGGAGGGGCCCGGG - Intronic
1104928035 12:132323804-132323826 CCTCGGCCGGGGCGGGGGCCCGG + Intronic
1104943085 12:132403951-132403973 CCTGGGGAGGCGAGGGGGCCTGG + Intergenic
1108586080 13:51871040-51871062 CCTATGGTGGGGAGGGGGCCAGG - Intergenic
1113486087 13:110653173-110653195 CCTGGGGTGGGGAGGGGGGCTGG + Intronic
1113949970 13:114066395-114066417 CCGAGGAGCGGGAGGCGGCCGGG + Intronic
1114270718 14:21098444-21098466 CCGGGGAGGGGGCGGGGGCCGGG - Exonic
1114483175 14:23047856-23047878 ACAAGGACAGGGAGGAGGCCTGG + Exonic
1114525677 14:23365873-23365895 CCGAGGACTGGAAGGGGGCTGGG - Intergenic
1117086647 14:52208362-52208384 CCTAGGAAGTGCAGGGGGTCAGG + Intergenic
1118404829 14:65412847-65412869 GGTGGGATGGGGAGGGGGCCTGG - Intronic
1119612910 14:76078830-76078852 CCAAGGAGGAGGAGGTGGCCAGG - Intronic
1121267540 14:92614103-92614125 CCTCGGAGGGGCAGGGTGCCAGG - Intronic
1121269902 14:92631174-92631196 TCTGGGAAGGGGAAGGGGCCTGG - Intronic
1121741672 14:96257187-96257209 CCCAGGACGGGGAGGTGGCTGGG - Intronic
1122114623 14:99521596-99521618 CCTAGGAGGGCAAGTGGGCCTGG + Intronic
1122232524 14:100313834-100313856 CCTGGGACGCTGCGGGGGCCTGG + Intergenic
1122363255 14:101179951-101179973 GCTAGGGCAGGGAGGGGGCGTGG - Intergenic
1122635820 14:103129171-103129193 CCTGGGATTGGGAGGTGGCCGGG + Intronic
1122855241 14:104556885-104556907 CCTGGGTGGGTGAGGGGGCCTGG - Intronic
1122978491 14:105180926-105180948 CCCAGGCCGGGGAGGGGCCGCGG - Intronic
1123032390 14:105458164-105458186 GCTGGGACGGGGAGGGGGAAGGG - Intronic
1123735654 15:23180215-23180237 CCTGGGCAGGGGAGGAGGCCTGG + Intergenic
1124286369 15:28403198-28403220 CCTCGGCAGGGGAGGAGGCCTGG + Intergenic
1124296334 15:28508438-28508460 CCTCGGCAGGGGAGGAGGCCTGG - Intergenic
1125519666 15:40340753-40340775 CTTGGGACTGGGAGGGGGCTGGG - Intronic
1127384443 15:58455975-58455997 CCAAGGAAGGGAAGGGGGTCAGG + Intronic
1127606344 15:60591951-60591973 CCTAGGTCGGGGAGGCGCCGCGG - Intronic
1128544158 15:68556096-68556118 GACAGGACGGGGAGCGGGCCAGG + Intergenic
1128762760 15:70229073-70229095 CCTAGGAAGGGCATGGGGCTGGG - Intergenic
1129674853 15:77627012-77627034 TCTGGGAGGGGGTGGGGGCCTGG - Intronic
1129983532 15:79896664-79896686 ACTATGGCGGGGAGAGGGCCCGG - Intronic
1131265215 15:90911576-90911598 CCCACGACGGGCAGAGGGCCAGG - Intronic
1132145345 15:99426032-99426054 CCTGAGGCGGGGATGGGGCCAGG - Intergenic
1132307066 15:100823828-100823850 CCCAGGAAGGGGAGGGGGCAAGG + Intergenic
1132597644 16:760636-760658 CCTTGGACAGGCAGCGGGCCAGG - Intronic
1132698676 16:1213045-1213067 CCTCGTACGTGGAGGGGCCCTGG + Intronic
1132839927 16:1973985-1974007 CCTAGCACAGGGCGGGGCCCTGG + Intronic
1132977858 16:2719537-2719559 CCCAGGACTGGGAGAGGGCACGG + Intronic
1133268756 16:4600344-4600366 CCTCGGACGTGGAGGGGACTTGG - Exonic
1133268814 16:4600506-4600528 CCTCGGACGTGGAGGGGACTTGG - Exonic
1135047843 16:19168945-19168967 CCAAGGAGAGGGAGGGGGCAGGG - Intronic
1135631035 16:24035655-24035677 CCAGGGACGGGGAGGGGGTGTGG + Intronic
1136172188 16:28496006-28496028 CCTCAGGCGGGGAGGAGGCCGGG + Exonic
1136172199 16:28496033-28496055 CCTCGGGAGGGGAGGAGGCCGGG + Exonic
1136398488 16:30005476-30005498 GCTGGCACGGGGAGGGCGCCGGG - Exonic
1136630368 16:31486289-31486311 CTTAGGAAAGGGAGTGGGCCTGG + Intronic
1137531619 16:49281916-49281938 CCTCGGCCGGGGCGGGGGCAGGG - Intergenic
1137559244 16:49492469-49492491 CCGAGGCCGGGGCCGGGGCCGGG + Intronic
1138327953 16:56191298-56191320 CCCGGGACGGGGAGGGCGCGGGG - Intergenic
1142078132 16:88132187-88132209 CCTGGGTAGGGGTGGGGGCCTGG - Intergenic
1142194757 16:88734289-88734311 CCTGGGCCAGGGAGGGAGCCAGG - Intronic
1142262579 16:89049799-89049821 CCTAGGAAGGAGTGGGCGCCCGG - Intergenic
1142514424 17:417840-417862 CCTAGAACGTGGAGCGGGGCAGG + Intronic
1142514435 17:417908-417930 CCTAGAACGTGGAGCGGGGCAGG + Intronic
1142594009 17:1020880-1020902 CCGAGCACGGGGAGCTGGCCGGG - Intronic
1142685531 17:1575140-1575162 CCGGGGAGGGGGTGGGGGCCAGG + Exonic
1142808697 17:2385325-2385347 CCTGGGCCGGCGAGGGGGCCGGG - Exonic
1142876249 17:2853528-2853550 CCGGGGCCGGGGAGGGCGCCTGG + Intronic
1143175087 17:4950742-4950764 GCAAGGCTGGGGAGGGGGCCTGG - Intronic
1143554770 17:7653153-7653175 CCTAGGACCAGGAGGGGGCTGGG + Intronic
1143568170 17:7737771-7737793 CCTAGGACAAGGAGTGGGCATGG + Intronic
1143582506 17:7835176-7835198 CAGAAGACGGGGAGGGGGCTGGG + Intergenic
1143868778 17:9943092-9943114 CCCAGGGCTGGGAGGGGCCCAGG + Intronic
1146201322 17:30861195-30861217 CCAAGGGCGGGGAGGGGGGTGGG - Intronic
1147954392 17:44124036-44124058 CCGCGGTCGGGGAGGGGACCTGG + Intergenic
1147994505 17:44353613-44353635 CCCAGGCCGGAGAGGGGCCCAGG - Exonic
1148860177 17:50600524-50600546 TCAGGGATGGGGAGGGGGCCTGG + Intronic
1149546846 17:57510220-57510242 CCTTGGGTGGGGAGGGTGCCTGG + Intronic
1149580714 17:57748685-57748707 CATAGGATGGGGTGGGGTCCTGG - Intergenic
1149992123 17:61389101-61389123 CATGGGACGATGAGGGGGCCTGG + Intronic
1150483439 17:65528102-65528124 CCCAGAATGGGGAGGGTGCCTGG + Intergenic
1151161658 17:72171101-72171123 TATAGGACTGGCAGGGGGCCAGG - Intergenic
1151448314 17:74181602-74181624 CCCAGGGTGGGGAGGGGGCTTGG - Intergenic
1151972548 17:77466332-77466354 GCTGGGAGGGGGAAGGGGCCTGG - Intronic
1152288154 17:79424268-79424290 CCTGGGACGGGCGGGAGGCCCGG - Intronic
1152601397 17:81264020-81264042 CCGAGGACAGGGTGGGTGCCAGG + Intronic
1157220663 18:45826600-45826622 CCTAGGATGGGGATGGGGTAAGG - Intronic
1157609662 18:48948743-48948765 CCGAGGACGGGGAGGGGGCATGG - Intronic
1158106891 18:53895542-53895564 CCTAGACCTGGGAGGGGGTCCGG - Intergenic
1158137617 18:54224289-54224311 CCGGGGACGGGGACGGGGCCGGG - Exonic
1158434755 18:57428054-57428076 CCTAGCACGGAGAGAGGCCCTGG + Intergenic
1159851984 18:73535367-73535389 CCTAGGCTGGGGAGGGCGGCTGG - Intergenic
1160163204 18:76491263-76491285 CCGGGGCCGGGGAGGGGGGCGGG - Intronic
1160164151 18:76495395-76495417 CGCGGCACGGGGAGGGGGCCGGG + Intergenic
1160395326 18:78566720-78566742 CCTATGACAGGGAGAAGGCCGGG + Intergenic
1160500843 18:79400537-79400559 ACGAGGACGCGGAGGGGGCCTGG - Intronic
1160718455 19:587024-587046 CTCAGGGTGGGGAGGGGGCCAGG - Intergenic
1160724906 19:613661-613683 CCGGGGATGGGGATGGGGCCGGG + Intronic
1160880128 19:1315902-1315924 CAGAGGCCGGGGAGCGGGCCTGG + Intergenic
1160915441 19:1494315-1494337 CCTGGGGCGGGGTGGGGGGCAGG - Intronic
1161220366 19:3115602-3115624 TCCAGGACGGGCCGGGGGCCTGG + Intronic
1161230365 19:3171989-3172011 TCTAGGACGGGGGCTGGGCCTGG + Intergenic
1161265029 19:3359992-3360014 CCGGGGAGGGGGCGGGGGCCCGG - Intronic
1161395650 19:4043693-4043715 CCCAGGGGGTGGAGGGGGCCAGG - Intergenic
1162823582 19:13237633-13237655 TCTAGGATGGGGAAGGGGGCTGG + Intronic
1163159537 19:15456646-15456668 CCTAGGAAGGGCAGGAGGTCAGG + Exonic
1163281131 19:16318503-16318525 CTTGGCACTGGGAGGGGGCCTGG - Intergenic
1163551303 19:17967531-17967553 CCTGGGAGGGGGAGGGTGCAGGG + Intronic
1163633735 19:18429228-18429250 CCGAGGCGGGGGAGGGGGGCGGG + Intronic
1163664101 19:18595035-18595057 CATGGGACAGGGAGTGGGCCAGG + Intronic
1163715609 19:18870509-18870531 CCAAGGACGGGGAGCGTGGCCGG + Exonic
1164145539 19:22510460-22510482 CCTTGCATGGGGAGGGGTCCTGG - Intronic
1164643447 19:29842716-29842738 CATAGGCCTGGGTGGGGGCCTGG - Intergenic
1165376948 19:35449605-35449627 CCTGGGAAGGGGACGGTGCCGGG + Intronic
1165395859 19:35563309-35563331 CAGTGGGCGGGGAGGGGGCCAGG - Intronic
1165420144 19:35718294-35718316 CCGGGGACGGGGTCGGGGCCGGG + Exonic
1165739840 19:38198557-38198579 CAGAGGACGGGGTGGGGGCCTGG - Intronic
1165774237 19:38395530-38395552 CCTGGCAGGGGCAGGGGGCCTGG + Exonic
1165861662 19:38912254-38912276 CCGCGGGCGGGGAGGGGGCGGGG - Intergenic
1166101809 19:40575932-40575954 CCTAGGGCAGAGAGGGGGGCAGG - Exonic
1166103633 19:40586740-40586762 CCAAGGATGAGGAGAGGGCCTGG - Intronic
1166746030 19:45142280-45142302 CTGGGGACGGGGAGGGGGCACGG - Intronic
1166930064 19:46297018-46297040 GCAAGGCCGGGGAGGGGGCTAGG + Intergenic
1167268029 19:48493185-48493207 CCTAGAGCGGGGGCGGGGCCTGG - Intronic
1167595845 19:50427804-50427826 CACAGAACGCGGAGGGGGCCTGG + Intronic
1167716415 19:51145077-51145099 CTAAGGATGGGGAGGAGGCCTGG - Intronic
1167748880 19:51368216-51368238 ACCAGGACGGGGAGGGGGTCGGG + Intronic
1168076468 19:53982990-53983012 CTTCGGAGGGGGAGGGGGGCGGG - Exonic
927142287 2:20138722-20138744 CCCAGGACGGGGAAGGCGCCCGG + Intergenic
927818917 2:26245075-26245097 CCCAGGGAGGGGAGGGGGCCGGG - Intronic
927843139 2:26457796-26457818 CCTTGGATGGGGTGGGGACCTGG - Exonic
929454860 2:42058324-42058346 CCTGGGGCGGGGGTGGGGCCGGG + Exonic
930096444 2:47570293-47570315 GCTACGGCGGGGCGGGGGCCGGG + Exonic
931259547 2:60605249-60605271 CATAGGAGGAGGAGGGGGCTGGG - Intergenic
931682921 2:64768013-64768035 CCTAGGAGGGAGAGGGGCGCGGG - Intergenic
931728226 2:65130599-65130621 GCGGGGGCGGGGAGGGGGCCGGG + Intergenic
932247679 2:70209207-70209229 CCTAGGAGGGGGAGGTTGCAGGG + Intronic
932586318 2:73031914-73031936 CGTAGGACAGGAAGGGGCCCTGG - Intronic
932780047 2:74554121-74554143 CCAGGGAGGGGGAGGGGGCGCGG - Exonic
933778371 2:85785483-85785505 CCAAGGAGGGCGAGGGAGCCGGG - Intronic
934853604 2:97716050-97716072 CCCAGGCTGGGGAGGGGGCAGGG + Intronic
934954051 2:98601909-98601931 CCACGGACGGGGAAGGGGGCAGG - Intronic
935593797 2:104864105-104864127 CCTCGGGCGGAGACGGGGCCTGG - Intergenic
936713717 2:115161773-115161795 CCTACGACGGGGAGCCCGCCCGG + Exonic
937043063 2:118835901-118835923 CCTGGCGCGGGGAGGCGGCCGGG + Intergenic
937283779 2:120737177-120737199 CCCCGGACGGGGCGGGGGCGGGG + Intronic
937439150 2:121902342-121902364 CCTGGGCCGGTGAGGGGTCCTGG + Intergenic
937471689 2:122179217-122179239 CCTGGGAGGAGAAGGGGGCCTGG + Intergenic
938100279 2:128493491-128493513 CCGCGGGCGGGGAGGGGGCGGGG - Intergenic
938141654 2:128799451-128799473 CCAAGGAAGGAGAGGGGCCCTGG - Intergenic
941477975 2:165971678-165971700 CCTGGGAAGGGCAAGGGGCCGGG + Intergenic
942471899 2:176269378-176269400 CGTAGGACGGCGCGGGGGCGGGG + Intronic
942744081 2:179212203-179212225 CCTAGGAAGCGCAAGGGGCCGGG + Intronic
943587719 2:189760354-189760376 CCTAAGACGGGGCGGCTGCCGGG + Intronic
946127438 2:217575783-217575805 GCTAGGAAGGGGAGGGGGAAGGG + Intronic
946235577 2:218322924-218322946 CCCTGGACGGGGAGGCGGGCGGG + Intronic
946369866 2:219274288-219274310 CCTAGGAGGTGGTGAGGGCCTGG + Intronic
946431735 2:219629991-219630013 CACGGGATGGGGAGGGGGCCTGG + Intronic
947712444 2:232323845-232323867 CCTGGGTCGGGGAGGGGGATGGG - Intronic
947731403 2:232433525-232433547 CCTGGGTCGGGGAGGGGGATGGG - Intergenic
947816412 2:233040369-233040391 CCAAGGCTGGGGAGGGGGCATGG + Intergenic
948697295 2:239738180-239738202 CCGGGGCCGGGGATGGGGCCGGG - Intergenic
948697306 2:239738198-239738220 CCGGGGCCGGGGATGGGGCCGGG - Intergenic
948697369 2:239738319-239738341 CCTGGGCCGGGGCTGGGGCCGGG - Intergenic
948804293 2:240446837-240446859 CAGAGGACGGAGAGGGGACCAGG + Intronic
948861730 2:240755837-240755859 CCCAGGAGGTGCAGGGGGCCTGG + Intronic
948953899 2:241272639-241272661 CCGCGGAGGGGGAGGGGCCCGGG - Intronic
1168869734 20:1118357-1118379 GCTAGGCCGGGGAAGGGGCTGGG - Intronic
1171109119 20:22464315-22464337 CCCAGGAAGGGGAGGGAGGCTGG + Intergenic
1171208277 20:23297982-23298004 CCTAGGAAGGGGAGGCTCCCTGG + Intergenic
1171811377 20:29746105-29746127 CCTACGGCGGGGAGGGGGGTTGG + Intergenic
1172034841 20:32003257-32003279 CCCAGGAGGGGGAGGGGGAGGGG + Exonic
1172596569 20:36154624-36154646 CCGAGGCCGGGGCGGGGGCGGGG + Intronic
1172755552 20:37281357-37281379 CCTGGGCCGGGGTGGGGGGCGGG + Intergenic
1172998815 20:39091000-39091022 ACAAGGAAGGGGAGGGGGACTGG - Intergenic
1174110529 20:48194965-48194987 TCAAGGGAGGGGAGGGGGCCTGG + Intergenic
1174690800 20:52502516-52502538 CATAGGAAAGGGAGGGGGCAGGG + Intergenic
1175994775 20:62807175-62807197 CCTAGGAGGAGGAGAGGGTCAGG + Intronic
1176005580 20:62860958-62860980 CCGAGGCCGGGGCCGGGGCCGGG - Intronic
1176207216 20:63895493-63895515 CCTGGGCCGGGGCGGGGGCGCGG + Intronic
1176275431 20:64263701-64263723 TCTAGGAGGAGGAGGGGGCATGG - Intronic
1178826074 21:36017958-36017980 CCTCAGACAGGGAGGGGCCCAGG - Intergenic
1179921101 21:44508097-44508119 CCTAGGACCGGGAGGGCTGCAGG - Intronic
1179988320 21:44932957-44932979 CAGAGGACGGGGCCGGGGCCGGG + Intronic
1180005524 21:45018914-45018936 CCAAGGGCGGGGCCGGGGCCGGG - Intergenic
1180184482 21:46132705-46132727 CCTGGGGCTGGGCGGGGGCCGGG - Exonic
1180836947 22:18934707-18934729 GCTGGGATGGGGAGGGGGCTAGG - Intronic
1181029036 22:20141201-20141223 CCTTGGACTGGGAGGGAGCGGGG - Exonic
1181167034 22:20989422-20989444 TCTGGGCCGGGCAGGGGGCCTGG + Intronic
1181439109 22:22926723-22926745 CCTAGTACCTGGATGGGGCCGGG - Intergenic
1181514218 22:23402149-23402171 CCTTGGACTGGGAGGGGGCGGGG + Intergenic
1181519582 22:23437381-23437403 CCTGGGGCGGGGAGGAGGCTGGG - Intergenic
1181667409 22:24407651-24407673 CCTTGCAGGGAGAGGGGGCCAGG - Intronic
1181668632 22:24415106-24415128 ACTAGGACGGTGAAGGGCCCAGG - Exonic
1181801500 22:25350682-25350704 CCCAAGACTGGGAGGGTGCCTGG + Intergenic
1182435248 22:30326142-30326164 CCTGGGAAGGGGTGGGGGCGGGG + Intronic
1182551043 22:31100863-31100885 CCTGGGGAGGGTAGGGGGCCGGG - Exonic
1183265027 22:36819573-36819595 CACCGGAAGGGGAGGGGGCCGGG - Intergenic
1183604232 22:38859369-38859391 ACAAGGAAGGGGTGGGGGCCAGG + Intergenic
1183675691 22:39297686-39297708 CCCAGGAAGGGGAGGGGGCAGGG - Intergenic
1183694489 22:39413982-39414004 TTTAGGCCGGGGATGGGGCCAGG + Intronic
1183740179 22:39664717-39664739 CCTGGGGCGGGGGTGGGGCCGGG - Exonic
1183788394 22:40045161-40045183 CGTGGGGCGGGGAGCGGGCCGGG + Intronic
1184034039 22:41910226-41910248 ACTGGGACGGGGACCGGGCCGGG + Intronic
1184477370 22:44728936-44728958 CCTAGGAAGGGGAGGAAGACTGG + Intronic
1184760530 22:46541352-46541374 CTCAGGGCGGGGAGGGGGCTTGG + Intergenic
1185315771 22:50178492-50178514 GCTAGGGAAGGGAGGGGGCCTGG + Intronic
1203287040 22_KI270734v1_random:160006-160028 GCTGGGATGGGGAGGGGGCTAGG - Intergenic
950265306 3:11568894-11568916 CCTAGGATGGGGATGAGGCCCGG - Intronic
950413941 3:12857447-12857469 TCAAGGATGGGGAGGAGGCCTGG + Intronic
950676132 3:14555373-14555395 CCTGGGAAGGGGTGGGGGCGGGG + Intergenic
951024508 3:17815461-17815483 CCAAGGACGGGCATGGGGCTGGG + Intronic
953980115 3:47409394-47409416 CTGAGGAAGGGGTGGGGGCCAGG - Intronic
954304906 3:49720489-49720511 CCTAGGTAGGGGAGGGTGCAAGG - Exonic
957063451 3:75500957-75500979 AGTAGGATGGGGAGGGGGTCTGG + Intergenic
961289944 3:125838619-125838641 AGTAGGACGGGGAGGGGGTCTGG - Intergenic
961658943 3:128458186-128458208 AGTAGGAAGGGGAGGAGGCCGGG + Intergenic
961862146 3:129925739-129925761 CATGGGGCGGGGAGGGGGCAAGG + Intergenic
961897158 3:130177396-130177418 AGTAGGATGGGGAGGGGGTCTGG + Intergenic
962201269 3:133403092-133403114 CCTGGAAAGGGGTGGGGGCCTGG - Intronic
966236256 3:177704947-177704969 CCTAGGACAGGAAGGTGACCAGG + Intergenic
966885988 3:184378370-184378392 CCTGGGACCTGGAGGGGGACAGG + Intronic
968464389 4:743209-743231 CCTAGGACAGGCACGGGGCCTGG - Intronic
968514261 4:1009798-1009820 GCGGGGACGGGGAGGGGGCGGGG - Intergenic
968743039 4:2340859-2340881 CCTAGAAAGGGGAGGCGGGCAGG + Intronic
968925219 4:3543478-3543500 CCGAGGAGGGGCAGGGGGCAGGG - Intergenic
969648805 4:8450744-8450766 CCTAGGACGGGGAGGAAGATGGG - Intronic
969674771 4:8608495-8608517 CCCAGGACAGGGAGGGGCCCAGG - Intronic
969746276 4:9075104-9075126 AGTAGGATGGGGAGGGGGTCTGG - Intergenic
969805632 4:9606513-9606535 AGTAGGATGGGGAGGGGGTCCGG - Intergenic
970248109 4:14084856-14084878 CCCAGAAAGGGGAGGGGGCATGG + Intergenic
970596660 4:17606412-17606434 CCCAGGACGGGGAGGTTGCAGGG - Intronic
972726748 4:41751688-41751710 GCTTGGCCGGGGAGGGTGCCCGG + Intergenic
974000459 4:56506323-56506345 GCTAGGGTGGGCAGGGGGCCCGG - Intronic
976199011 4:82561540-82561562 CAAAGGACGGGGCCGGGGCCGGG + Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
980528199 4:134016839-134016861 GGTAGGAAAGGGAGGGGGCCTGG - Intergenic
982173069 4:152680241-152680263 TCTGGGACTGGGAGGGGTCCTGG + Intergenic
982199853 4:152949780-152949802 GCTAGGATGCGAAGGGGGCCTGG - Intronic
985680622 5:1253892-1253914 CCTAGGACGTGTGGGTGGCCGGG + Intronic
987364780 5:17139218-17139240 CCTTGGATGGGGAGAGGGCAGGG - Intronic
988577942 5:32444569-32444591 CCGGGGCCAGGGAGGGGGCCGGG + Intronic
988825337 5:34929766-34929788 CCCGGGACGGGGTCGGGGCCCGG - Exonic
994072963 5:95621417-95621439 CGGAGGACGAGGAGGGGCCCCGG + Exonic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996943862 5:129043293-129043315 CTTAAGAGGGGGAGAGGGCCGGG - Intergenic
997643669 5:135466307-135466329 TCCAGGGCGTGGAGGGGGCCGGG - Intergenic
998059985 5:139112255-139112277 TCTCGGACGGGGTGGCGGCCGGG - Intronic
999111925 5:149128873-149128895 CCAAGGACAGGGTGGGGGTCAGG - Intergenic
999140541 5:149358359-149358381 CCTAGGACGGAAAAGAGGCCTGG + Intronic
999184991 5:149700619-149700641 ACTAGGACGGGATGGGGGGCAGG + Intergenic
1001568059 5:172713262-172713284 CCCAGCAAGGGGAAGGGGCCGGG + Intergenic
1002180172 5:177427085-177427107 CCCAGGAAGGGGCGGGGGTCAGG + Intronic
1002521525 5:179795441-179795463 CCTCGGGCGGGGAGGGGGCGGGG + Intronic
1002710488 5:181192034-181192056 CCTTGGGCGGGGCGGGGGCCAGG + Intergenic
1002927779 6:1614757-1614779 CCGGGGACGGGGACGGGGCGGGG + Intergenic
1003206640 6:4018763-4018785 CCTTGGAGGGGGCGGGGCCCTGG - Intergenic
1003292265 6:4789483-4789505 CCTAGGGCGGGGAGGCTGCCAGG - Intronic
1004218469 6:13724246-13724268 ACTAGCACGGGGAGGAAGCCAGG + Intergenic
1006081791 6:31572195-31572217 TCTAGGTCGGGGCTGGGGCCCGG - Exonic
1006132737 6:31878757-31878779 CCTGGGAGGAGGATGGGGCCCGG - Intronic
1006171950 6:32098067-32098089 CCCTGGCTGGGGAGGGGGCCGGG + Intronic
1006184837 6:32175813-32175835 CCTCAGAGGGGTAGGGGGCCTGG + Intronic
1006606331 6:35259980-35260002 CCTGGGTGGGGGAGGGGGCCCGG - Intronic
1007085699 6:39143278-39143300 CCTAGGAAGGGCAGGGGAGCTGG - Intergenic
1007627358 6:43253992-43254014 CCTAGGAAGGTGAAGGGGCTGGG + Intronic
1007665416 6:43510397-43510419 CCTTGGCCGGGCAGGGGGCGGGG - Exonic
1007783198 6:44265631-44265653 CCGGGGGCGGGGAGGGGGCGGGG - Exonic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1009844776 6:69121770-69121792 CCCAAGACGGGGTGGCGGCCGGG + Intronic
1011807433 6:91088041-91088063 CCTAGGAATGGCAGGGGTCCAGG - Intergenic
1016396768 6:143632066-143632088 CCAGGGAGGGGCAGGGGGCCAGG - Intronic
1017632242 6:156407788-156407810 CCTAGAATGAGGAGGTGGCCTGG + Intergenic
1018997004 6:168717560-168717582 CCTGGGAAGGGCTGGGGGCCTGG - Intergenic
1019287366 7:230360-230382 CCCAGGACGGGGTGGGGGGGGGG + Intronic
1019347848 7:539350-539372 AGTAGAACCGGGAGGGGGCCGGG + Intergenic
1019591679 7:1838897-1838919 CCTGGGGCGGGGAGGAGGCTGGG + Intronic
1019659937 7:2218572-2218594 CCTTGGAGGTGGAGGGGGCGTGG - Intronic
1019878229 7:3834864-3834886 CCAGGGACGGAGAGGGGACCAGG - Intronic
1020278087 7:6636909-6636931 CCTGTGGTGGGGAGGGGGCCAGG - Intergenic
1020327840 7:6989076-6989098 ACTAGGATGGGGAGGGGGTCTGG + Intergenic
1021909958 7:25375580-25375602 CCTTGCACAGGGAGGGAGCCGGG + Intergenic
1021969611 7:25952678-25952700 CCGAGGAGGGGGTGGGGGGCTGG - Intergenic
1022979782 7:35593736-35593758 TGTAGAAAGGGGAGGGGGCCGGG - Intergenic
1023067170 7:36389692-36389714 GCGAGGGCTGGGAGGGGGCCGGG + Intronic
1023939201 7:44759361-44759383 GGTAGGAAGGGGAGGGGGCAGGG - Exonic
1024244722 7:47460531-47460553 CCCAGGATGGGCAGGTGGCCTGG + Intronic
1025040106 7:55634501-55634523 CCTGTCACGGGGTGGGGGCCAGG + Intergenic
1025206376 7:56995688-56995710 GCCAGGCCGGGGAGGGGGCTGGG + Intergenic
1026846074 7:73699845-73699867 CCTAGGCAGGGGAGGGAGCCTGG + Exonic
1029115340 7:98233640-98233662 GCTCGGCCGGGGTGGGGGCCGGG + Exonic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1029655259 7:101919821-101919843 GCTGTGACGGGGAGGTGGCCAGG + Intronic
1030105176 7:105981349-105981371 CCTGGGACTGGGAGGGGACCAGG - Intronic
1030714322 7:112790448-112790470 GTTTGGGCGGGGAGGGGGCCGGG - Exonic
1032053715 7:128667722-128667744 CTTAGGACGGGGAGGGGGCAGGG - Intergenic
1032217834 7:129971041-129971063 CCAAGGCTGGGGAGGTGGCCTGG + Intergenic
1032240323 7:130154537-130154559 CCGAGGAGGGGCAGGGAGCCTGG - Intergenic
1032457753 7:132086757-132086779 CCGAGGGCAGGGAGGGGTCCAGG - Intergenic
1032488798 7:132308394-132308416 CCTAGGAGTGGGAGTGGCCCAGG - Intronic
1034344847 7:150379628-150379650 CCGAGGGTGGGGAGGGCGCCAGG + Intronic
1034480210 7:151314079-151314101 CCAAGAACTGGGAGGCGGCCGGG - Intergenic
1035754962 8:2023957-2023979 GCCAGGAGGGGGAGGCGGCCGGG + Intergenic
1036368777 8:8145022-8145044 AGTAGGATGGGGAGGGGGTCTGG - Intergenic
1036566070 8:9939038-9939060 CCTTGGACGGGGCAGGGGCAGGG - Intergenic
1036882112 8:12520620-12520642 AGTAGGATGGGGAGGGGGTCTGG + Intergenic
1037583596 8:20261451-20261473 ACCAGGACGGGGAGGGGCCCGGG + Intronic
1037829675 8:22180080-22180102 CCTAGGAGAGGGAGGTGGCACGG + Intronic
1037834536 8:22208388-22208410 CCTAGTATGGGGTGGGGGGCAGG - Intronic
1039443787 8:37614008-37614030 CCTAAGACAGAAAGGGGGCCAGG + Intergenic
1039835169 8:41250105-41250127 CCTTGGAGGGGGAGGCTGCCTGG + Intergenic
1041167333 8:55102619-55102641 CCGAGGACGAGGAGGCGGCCGGG + Exonic
1042828472 8:73001980-73002002 CATAGAAAGGGGAGGGGGCATGG - Intergenic
1043910024 8:85853478-85853500 ACTAGGTCTGGGATGGGGCCTGG + Intergenic
1043946856 8:86263168-86263190 TCTAGGAAGGGGAGAGGGACTGG + Intronic
1044142479 8:88672556-88672578 CCACGGGCGGGGAGGGGGGCGGG + Intergenic
1044988536 8:97775773-97775795 GCGGGGACGGGGAGGGGGCGGGG - Exonic
1045231256 8:100309630-100309652 CCTGGGCCGGGTAGGGGACCCGG + Intronic
1045323716 8:101101361-101101383 ACTCAGAGGGGGAGGGGGCCAGG - Intergenic
1045842532 8:106596757-106596779 ACTAGTACGTGGATGGGGCCGGG + Intronic
1048010143 8:130448833-130448855 GCTAGGCTGGGGAGGGGGCTGGG + Intergenic
1048171166 8:132107950-132107972 TCTAGGACAGGGAGAGAGCCTGG + Intronic
1048989912 8:139755168-139755190 CCGAGGACCTGGAGGGTGCCAGG - Intronic
1049016527 8:139924017-139924039 CCGAGCACGGGGAGGGGGCATGG + Intronic
1049216341 8:141410034-141410056 CCTGGGTCGGGGAGGTGACCAGG + Intronic
1049237446 8:141519167-141519189 AGCAGGATGGGGAGGGGGCCGGG + Intergenic
1049684446 8:143933722-143933744 CCGCTGTCGGGGAGGGGGCCTGG + Intronic
1049791752 8:144475492-144475514 GCTAGGAAGGGGTGGGGGTCAGG + Intronic
1052841506 9:33295134-33295156 CCTGGGAAGTGGAGGGGGCCAGG + Exonic
1052860821 9:33436834-33436856 CCTAGGCTGTGGAGGGTGCCAGG - Intergenic
1052928770 9:34039247-34039269 TCTCGGACGGGGCGGCGGCCAGG - Intronic
1053163602 9:35829590-35829612 CCGAGGCCGGGATGGGGGCCAGG - Exonic
1053511614 9:38692860-38692882 CATAGGAGGGGGAGGGGTGCAGG - Intergenic
1053800109 9:41758660-41758682 CCGAGGAGGGGCAGGGGGCAGGG - Intergenic
1054188537 9:61970812-61970834 CCGAGGAGGGGCAGGGGGCAGGG - Intergenic
1054464779 9:65487132-65487154 CCGAGGAGGGGCAGGGGGCAGGG + Intergenic
1054649984 9:67617805-67617827 CCGAGGAGGGGCAGGGGGCAGGG + Intergenic
1057354989 9:94325368-94325390 CCTTGGCCTGGGAGGGAGCCAGG + Exonic
1057630456 9:96715636-96715658 CCTCGGACGGGGCGGCTGCCAGG + Intergenic
1057652763 9:96932266-96932288 CCTTGGCCTGGGAGGGAGCCAGG - Exonic
1057801276 9:98192688-98192710 CGGAGGGCGGGGCGGGGGCCTGG + Intergenic
1059451404 9:114373278-114373300 CCGAAGACGGGGTGGGGGCTGGG + Intronic
1059869895 9:118561403-118561425 CCTATGAAGTGAAGGGGGCCTGG - Intergenic
1060117291 9:120952155-120952177 CAATGGACGGGGAGGGGGCAGGG + Intergenic
1060479888 9:124011869-124011891 CCCAGGGAGGGGAGGGGTCCAGG + Exonic
1060550520 9:124482734-124482756 CCTGGGCCGGGGGCGGGGCCGGG - Exonic
1060602811 9:124889303-124889325 CCTAGGTCGGGGAGGAGGGGAGG + Exonic
1061264500 9:129497351-129497373 CCTAGGCCCGGGCGGGGGCGGGG + Intergenic
1061275925 9:129569265-129569287 CCGAGGAGGGGGCGGGGGCGCGG + Intergenic
1061716585 9:132522094-132522116 CCTATGAGGAGCAGGGGGCCAGG + Intronic
1061766371 9:132884100-132884122 CCTCGGCCGGGGTGGGGGTCGGG - Intronic
1062098906 9:134717847-134717869 GGTTGGACGAGGAGGGGGCCTGG + Intronic
1062160276 9:135075930-135075952 CCGGGGTTGGGGAGGGGGCCAGG + Intronic
1062275544 9:135728655-135728677 GCTGGGAAGGGGAGAGGGCCGGG + Intronic
1062306172 9:135908008-135908030 CCTCGGCCGGCCAGGGGGCCGGG - Intergenic
1062332796 9:136051846-136051868 CCTGGGGCGGGGAGGGCGCAGGG + Intronic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1062423492 9:136495258-136495280 TCAAGAACGGGCAGGGGGCCGGG + Exonic
1062484943 9:136770042-136770064 CCAGGGAAGGGGAGGGGGCTCGG - Intergenic
1062630809 9:137462364-137462386 GCTGGGACGGGGTAGGGGCCGGG - Intronic
1185621485 X:1453406-1453428 CCGGGGGCGGGGACGGGGCCCGG - Intronic
1186922565 X:14298271-14298293 CCCAGGACTGAGAGGGGTCCTGG - Intergenic
1187464567 X:19515535-19515557 CGAGGGGCGGGGAGGGGGCCGGG + Intergenic
1188650593 X:32627145-32627167 CCTGGGGCGGGGGGGGGGGCGGG - Intronic
1189072437 X:37878011-37878033 CCAAGGACGGGGAGAGAGACAGG - Intronic
1189332944 X:40154249-40154271 CCTGGGGAGGGGAGGGGGCGAGG - Intronic
1190385626 X:49879949-49879971 CCGGGGCCGGGGCGGGGGCCGGG - Exonic
1190897612 X:54636514-54636536 GGTGGGAGGGGGAGGGGGCCAGG - Intergenic
1191954812 X:66632692-66632714 ACTGGGACGTGGAGGAGGCCAGG + Intronic
1194010268 X:88553454-88553476 TCTAGGACGGAGAGAGGGCATGG - Intergenic
1195026435 X:100882228-100882250 CCTAGGCCTGGAAAGGGGCCTGG + Intergenic
1196784085 X:119407184-119407206 CCCAGGACTTGGAGGGGTCCTGG - Intronic
1198282529 X:135155894-135155916 CCGAGGACGGTGGGGGTGCCGGG + Intergenic
1198288430 X:135216628-135216650 CCGAGGACGGTGGGGGTGCCGGG - Intergenic
1198854874 X:141005368-141005390 CCTAGGATAGGGAAGGGGCGGGG - Intergenic
1198877138 X:141239775-141239797 CCTAGGATAGGGAAGGGGCGGGG + Intergenic
1200056715 X:153465433-153465455 GCGAGGCCGGGGAGGGTGCCAGG - Intronic
1200126045 X:153815637-153815659 TCCAGGTCGGGGAGGGGACCTGG + Intronic
1200154841 X:153969963-153969985 CCTAGGACGGGCCGGCGGCAGGG - Intronic
1200218576 X:154379593-154379615 CGGAGCACGAGGAGGGGGCCCGG - Intronic
1200256729 X:154586298-154586320 ACCAGGACAGGGATGGGGCCTGG + Intronic
1200261040 X:154618105-154618127 ACCAGGACAGGGATGGGGCCTGG - Intronic
1202605389 Y:26635446-26635468 CCTAGGGTGGGTAGGGTGCCAGG + Intergenic