ID: 918333279

View in Genome Browser
Species Human (GRCh38)
Location 1:183480836-183480858
Sequence CAAGAAGGAAGCATTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918333273_918333279 15 Left 918333273 1:183480798-183480820 CCTACTGTTACCTTACCTGCATT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 918333279 1:183480836-183480858 CAAGAAGGAAGCATTGATCTGGG 0: 1
1: 0
2: 2
3: 19
4: 263
918333274_918333279 5 Left 918333274 1:183480808-183480830 CCTTACCTGCATTTCTTCCTGCA 0: 1
1: 0
2: 4
3: 44
4: 453
Right 918333279 1:183480836-183480858 CAAGAAGGAAGCATTGATCTGGG 0: 1
1: 0
2: 2
3: 19
4: 263
918333275_918333279 0 Left 918333275 1:183480813-183480835 CCTGCATTTCTTCCTGCAAGCAT 0: 1
1: 0
2: 3
3: 26
4: 303
Right 918333279 1:183480836-183480858 CAAGAAGGAAGCATTGATCTGGG 0: 1
1: 0
2: 2
3: 19
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918333279 Original CRISPR CAAGAAGGAAGCATTGATCT GGG Intronic
903020717 1:20391922-20391944 CAAGAAGAAAGAAGAGATCTGGG - Intergenic
904318164 1:29679499-29679521 CAAGAATGCAGCCTTGCTCTGGG - Intergenic
904752826 1:32751620-32751642 CATTAAGGAAGCACTGAGCTGGG + Intronic
905408771 1:37754142-37754164 CAAGAAGGAAGGCCTGATCCAGG - Intronic
905466438 1:38157635-38157657 AAAGAAGGAGGCATAGTTCTTGG + Intergenic
908105097 1:60833283-60833305 CAAGAATGATGCATTGAACCTGG - Intergenic
910731061 1:90397298-90397320 AAAGAATGAACCATTGATTTAGG - Intergenic
911071170 1:93832893-93832915 CATGAAGGAGGCTTTGAACTGGG - Intronic
911360345 1:96868068-96868090 CAGGAAGGTAGCATTTATCATGG - Intergenic
912589574 1:110802570-110802592 CAAAAAGGAGGCAGTGACCTAGG + Intergenic
918333279 1:183480836-183480858 CAAGAAGGAAGCATTGATCTGGG + Intronic
918360624 1:183753587-183753609 CAGGAAGGGAACATTGACCTTGG + Intronic
920664892 1:207956090-207956112 CTAGAAGGAAACAGTGCTCTTGG - Intergenic
920755225 1:208723771-208723793 CAAGCAAGAAACATTGATATAGG - Intergenic
921155879 1:212438348-212438370 CAATAAGGAAGAATTGCCCTAGG + Intronic
922252258 1:223860223-223860245 CAAGAAGGCAGCAGCCATCTGGG + Intergenic
924855834 1:247874292-247874314 CAAGAGGGAAGCAGTGAAGTGGG + Intronic
1064748931 10:18506084-18506106 CAAGAAGGAAATATTAATCTTGG + Intronic
1066435043 10:35389809-35389831 CAAGCATGAAGAATTGAACTTGG - Intronic
1066594223 10:37031402-37031424 TCAGAAAGAAGCAATGATCTTGG - Intergenic
1066982651 10:42432908-42432930 AAAGAAGTACGCATTGATTTAGG + Intergenic
1067958371 10:50819100-50819122 AAAGAAAGAAGCAGTGATTTTGG - Intronic
1069666134 10:70161139-70161161 CAAGATGAAAGCATTGATATTGG - Intronic
1070247928 10:74749308-74749330 CAAGGAGGAAGGAGTGATCAGGG + Intergenic
1071214937 10:83390269-83390291 CAAGGATGAAGCCTTGATCATGG - Intergenic
1072091965 10:92137559-92137581 CAAGAAGGAAGAGTTGACCCTGG + Intronic
1072821365 10:98561057-98561079 CCAGAAGAAAGCATTGGTATAGG + Intronic
1074799532 10:116985541-116985563 GAAGAAGGAAGAATGGATCTAGG + Intronic
1076235705 10:128862396-128862418 CAAGCAAGAAGCAGTGATCCAGG + Intergenic
1076502139 10:130945603-130945625 AAAGAAAGCAGCACTGATCTGGG + Intergenic
1085056788 11:73409289-73409311 CAAGAAGGACGTATCGAGCTAGG - Intronic
1086148768 11:83585274-83585296 CAGGATGGAGACATTGATCTGGG + Intronic
1086195101 11:84128509-84128531 CTAGAAGGAAGAATTGTTTTTGG - Intronic
1087346223 11:96974392-96974414 AAAGAAGGAAGCAGGGATTTGGG - Intergenic
1087396736 11:97609904-97609926 GAAGAAGGAGGCATAGATGTGGG - Intergenic
1088621991 11:111694426-111694448 CAGAAAGGAAGCATTCCTCTTGG - Intronic
1090090973 11:123697479-123697501 TAAGAAGAAAGCAATGATCAAGG - Intergenic
1090723170 11:129495473-129495495 CATGAAGGAAGCATTAAACACGG + Intergenic
1092151451 12:6251706-6251728 GAGGAAGGAAGAAATGATCTTGG + Intergenic
1092298679 12:7223976-7223998 GAAGAAGGAAGCCTGGATCCAGG + Intergenic
1092929165 12:13299042-13299064 CAAGGAGCAAGCCTGGATCTAGG + Intergenic
1093647236 12:21600980-21601002 TAAGAGGGAAGCATTTATTTAGG + Intronic
1093901423 12:24638754-24638776 CCAGGAGGAAGCATTGTTCTAGG - Intergenic
1096303788 12:50456423-50456445 CAAGAAGGAAACAAGGATTTGGG - Intronic
1096664471 12:53153978-53154000 CACGAAGGAAGTGTTGACCTTGG + Intergenic
1096759249 12:53826174-53826196 AAAGATGGAAGCATTGGGCTGGG - Intergenic
1096798923 12:54096575-54096597 CAAGTAGTAAACAGTGATCTAGG - Intergenic
1097003244 12:55896309-55896331 CTAGAAGGAGGCATTGTTATAGG - Intergenic
1097646203 12:62237724-62237746 CAAAAAGGAAGCAGCAATCTAGG - Intronic
1098164101 12:67675310-67675332 CCAGAAAGAAACATTGATATAGG + Intergenic
1100393363 12:94163529-94163551 GAAGAAGGAAGGATGAATCTTGG + Intronic
1100516946 12:95337406-95337428 CAAGCTGAAAGCATTCATCTGGG + Intergenic
1100580501 12:95935244-95935266 GAAGAAGGAAGAATGGATATTGG - Intronic
1100582785 12:95950876-95950898 AAAAAAGGGAACATTGATCTTGG + Intronic
1100806991 12:98296012-98296034 CAAAAGGAAAGCATTGAACTTGG - Intergenic
1100822413 12:98443882-98443904 CAACAAGAAAGCATGTATCTCGG - Intergenic
1101379379 12:104201360-104201382 CAAAAAGGAGGCAGTGATCTAGG - Intergenic
1101650221 12:106670752-106670774 TAAGATGGAAGCATTGAGATAGG + Intronic
1104314629 12:127685665-127685687 CAAAGAGGAAGCATCCATCTGGG + Intergenic
1106313917 13:28577242-28577264 CAAAAAGGAGGCATTGGGCTTGG + Intergenic
1106316567 13:28599539-28599561 CAAGAAGGAAGAGTTGACCCTGG + Intergenic
1108183768 13:47868043-47868065 GTAGAAGGAAGCATAGAACTTGG - Intergenic
1109632335 13:65066292-65066314 CTTGAAGTAAGCATTGATCCTGG + Intergenic
1110754895 13:79161414-79161436 AAAGAAGTAAGCAGGGATCTGGG + Intergenic
1111263820 13:85779910-85779932 AAAGAAGCAAGAATAGATCTGGG - Intergenic
1111979924 13:95004516-95004538 CATTAAAGAAGCAATGATCTAGG + Intergenic
1114415984 14:22544692-22544714 CAAGAAAGAAGGCATGATCTTGG + Intergenic
1115689170 14:35826154-35826176 CCAGAAGGAAGAAGTGATCAGGG + Intergenic
1118020806 14:61712129-61712151 CAAGATGGAGGCAGTGATCAGGG + Intronic
1119665867 14:76484581-76484603 GAAGAAGGAAGCATTGACCCAGG - Intronic
1120046981 14:79818993-79819015 TAAGATGGAAGCACTGCTCTAGG - Intronic
1121120549 14:91373158-91373180 CAAGGAGGAAGAACTGAGCTGGG + Intronic
1126478676 15:49093912-49093934 CAAGAAGGAAGCATTCATTCAGG - Intergenic
1127209520 15:56758816-56758838 CAAGAAGGAGAGATTGAACTTGG - Intronic
1127874412 15:63099431-63099453 CAAGAAAGAAGAATTTTTCTTGG - Intergenic
1127943561 15:63726280-63726302 CAATAAAAAAGCATGGATCTGGG - Intronic
1128681930 15:69658710-69658732 CAAGAAGGATGCATGGATCTGGG + Intergenic
1130547952 15:84870029-84870051 CAGGAAGGAAGCACAGAGCTGGG + Exonic
1130679843 15:85986952-85986974 CATGAAAGAAGCATTGGACTAGG + Intergenic
1131692047 15:94837705-94837727 CAAGAAGAAAGGATTGCTCGAGG + Intergenic
1133397442 16:5459445-5459467 CTAAACGGAAGCATGGATCTGGG - Intergenic
1135027381 16:19009100-19009122 CAAGCAGGAAACTTGGATCTTGG - Intronic
1136000269 16:27287133-27287155 CTAGAAAGAAGCATTTAACTGGG + Intronic
1136537660 16:30910049-30910071 GATGAAGGAAGCCTTGATGTAGG + Intergenic
1136864988 16:33741191-33741213 CATGAAGGAAGATTTGATTTTGG - Intergenic
1136865117 16:33743067-33743089 CATGAAGGAAGATTTGATTTTGG - Intergenic
1138399452 16:56733546-56733568 CGAGAAGGAAGCATTGGTGGTGG + Intronic
1138440019 16:57028569-57028591 GATGAAGGAAGCCTTGCTCTGGG - Intronic
1139827521 16:69768936-69768958 CAAGAAAGAAGCATTAGTGTTGG + Intronic
1142425227 16:89999034-89999056 CAAGAAGGCAGCATGGAGCTGGG + Intergenic
1203126486 16_KI270728v1_random:1589334-1589356 CATGAAGGAAGATTTGATTTTGG - Intergenic
1143542398 17:7577427-7577449 CAAGAAGGAAGAGTTGACCCTGG + Exonic
1143836728 17:9698984-9699006 AAAGAAAGAAGCTTAGATCTAGG + Intronic
1144030125 17:11312544-11312566 AACTAAGGAATCATTGATCTAGG - Intronic
1144114168 17:12070030-12070052 AAAGAAGGAAGAAATGATTTGGG + Intronic
1148471219 17:47894930-47894952 CAAGTAGTAAGCATTGTTTTCGG + Intergenic
1152002705 17:77656309-77656331 CAAGAAGGAAGGATTAGCCTGGG + Intergenic
1154013284 18:10593918-10593940 CCGGAAGGAAGGATTGCTCTAGG - Intergenic
1154152456 18:11917180-11917202 CCGGAAGGAAGGATTGCTCTAGG - Intergenic
1155475316 18:26231723-26231745 CAAGAATGAAGCCGTGACCTTGG + Intronic
1156175591 18:34541929-34541951 CAAGAAGGAGGCATTAATTAGGG - Intronic
1156274983 18:35575810-35575832 CAAGAAGGAAACAGGGAACTTGG - Intergenic
1156277959 18:35603036-35603058 CAAAAAGGAGGCAGTGATCTAGG - Intronic
1156838094 18:41579541-41579563 CCAGCAGGAAGCAATGATTTAGG - Intergenic
1157336655 18:46744054-46744076 CCTGAAGGAAGCATTGAACATGG + Intronic
1157578945 18:48762284-48762306 CATGGAGGAAGCAATGATCAGGG - Intronic
1157711241 18:49851148-49851170 CAAGAAGGAAAGATTAATCCAGG + Intronic
1159266958 18:66093381-66093403 GAAGAAGGAGGCACAGATCTGGG + Intergenic
1159673429 18:71251699-71251721 CAAGAATGAAACATTGTTATTGG - Intergenic
1159936968 18:74376689-74376711 CAAAAAGGAAGGAATGAACTGGG - Intergenic
1163482382 19:17565033-17565055 AAGGAAGGAAGCACTGATCCAGG - Intronic
1165970193 19:39622545-39622567 CATGAAAGAAGCATTAAGCTTGG - Intergenic
1167104476 19:47422021-47422043 GGAGAAGGAAACATTTATCTTGG + Intergenic
925140507 2:1547032-1547054 CAAGGAGGGAGCACTGTTCTTGG + Intergenic
927051209 2:19331105-19331127 CCAGAAGGCAACCTTGATCTTGG + Intergenic
928855257 2:35795756-35795778 GAAGAAGGAAATATTGATTTTGG + Intergenic
932159347 2:69446523-69446545 CACGAAGGAGGCTTTGAACTGGG + Intergenic
932779907 2:74553592-74553614 CAACAAGGCAGCTTTGTTCTGGG + Intronic
933773402 2:85757569-85757591 CATGAAAGAAGCACTGATCTGGG + Intronic
934618974 2:95792571-95792593 CAAGCAGGAAGCTTGGTTCTGGG + Intergenic
934641917 2:96031986-96032008 CAAGCAGGAAGCTTGGTTCTGGG - Intronic
935284388 2:101551106-101551128 AAAGAAGGAAGCATTTCTCCTGG + Intergenic
935552940 2:104478052-104478074 CCAGAAGGAGACAGTGATCTGGG + Intergenic
936480505 2:112880640-112880662 CAAGCAGGAACCATGGATGTTGG + Intergenic
937051341 2:118893580-118893602 CACCAAGACAGCATTGATCTGGG + Intergenic
939905882 2:147914121-147914143 CAGAGAGGATGCATTGATCTGGG + Intronic
944998707 2:205324589-205324611 CAAGAAGGAGGAAGTGATCTAGG - Intronic
948149229 2:235731853-235731875 CAAAAAGGAAGATTTGAGCTGGG + Intronic
948149468 2:235733412-235733434 CAAAAAGGAAGATTTGAGCTGGG - Intronic
1170469070 20:16650176-16650198 CAACATGGAGGCATTGCTCTAGG + Intergenic
1170711462 20:18794829-18794851 CAGGAAGGAAGGACGGATCTGGG + Intergenic
1171797499 20:29577775-29577797 CAAGTAGTAAACAGTGATCTAGG + Intergenic
1171850753 20:30306386-30306408 CAAGTAGTAAACAGTGATCTAGG - Intergenic
1171961343 20:31497088-31497110 CAAGGAGGAAGCAGGGAGCTCGG - Intergenic
1174065823 20:47865258-47865280 AATGAAGGAGGCATTGATTTGGG + Intergenic
1174923348 20:54729064-54729086 AAAGAAGGAAATGTTGATCTAGG - Intergenic
1176945473 21:14975142-14975164 AAGGAAGGAAACATTCATCTAGG + Intronic
1177290474 21:19104398-19104420 TAAGAAGGCATCATTGCTCTAGG - Intergenic
1177937443 21:27367230-27367252 CAAGAAGGAAGAGTTGATCCTGG - Intergenic
1178639097 21:34331606-34331628 GAAGAAAGAAGCAGTGATCCAGG - Intergenic
1182568388 22:31216779-31216801 CAAGAAGGCAGCCCTGTTCTGGG - Intronic
1183754813 22:39750770-39750792 GGAGAAGAAAGCATTGAACTTGG - Intronic
1184491791 22:44814125-44814147 CAAGAAGGAAGCATGGAGACTGG + Intronic
1184898363 22:47425651-47425673 CGAGAAGGAAGCCTTCATCAGGG + Intergenic
949193409 3:1277133-1277155 GGAGAAGGAAGAATAGATCTTGG + Intronic
950155807 3:10720870-10720892 CAGGAAGGAAGCACTGGACTGGG - Intergenic
951076196 3:18395770-18395792 CAAGGAAGAAGCATTCATCCTGG - Intronic
952136594 3:30429451-30429473 CCAGAAGGAAGCACTAAACTTGG + Intergenic
953072424 3:39534649-39534671 CAAGATGGAATCAAAGATCTGGG - Intergenic
953654436 3:44838385-44838407 CAAGAAGGAAGCCCTGATTCAGG + Exonic
953823779 3:46232699-46232721 CAAGAGTCTAGCATTGATCTGGG - Intronic
956045384 3:65190555-65190577 CAAGAAGGAAGCAGTGAGACAGG - Intergenic
956399904 3:68866373-68866395 CAAAAAGGAAGCAGCAATCTAGG + Intronic
956587594 3:70881069-70881091 CAAGAAGGTGAAATTGATCTTGG + Intergenic
957458102 3:80480006-80480028 CCTGAAGGAAGCATTGAACATGG - Intergenic
959055421 3:101562699-101562721 AATGAAGGAAGCATCGATCTAGG + Intronic
959268994 3:104180740-104180762 TCAGAACGAAGCATTGAACTTGG + Intergenic
964262985 3:154861300-154861322 CAGGATGGAATCATAGATCTAGG - Intergenic
966052026 3:175630100-175630122 CATGTTGGAAGCATTGATCAAGG + Intronic
967092326 3:186145630-186145652 CAAGCAAGAATCAATGATCTAGG - Intronic
967399136 3:189041172-189041194 CAAGAAGGAAGCAAAGAATTGGG - Intronic
967834951 3:193954073-193954095 CAACAAAGAAACATTGAACTTGG - Intergenic
970299196 4:14664451-14664473 CCTGAAGGAAGCATTGAACATGG - Intergenic
970775628 4:19670581-19670603 CTTGAAGGAAGCATTGAACATGG + Intergenic
972127250 4:35784074-35784096 AAATAGGGAAGTATTGATCTGGG - Intergenic
973950384 4:56007271-56007293 CAAAAAGGAGGCAGTGACCTAGG - Intronic
976154228 4:82125450-82125472 CAAGTAGCAAGCATTTCTCTTGG - Intergenic
977700856 4:100021096-100021118 AAAGAATGAAACAATGATCTGGG + Intergenic
981517372 4:145624580-145624602 CTAGAAGGAACCATTGACTTTGG + Intronic
983596100 4:169470279-169470301 CATGAAGGAAGCACTAAACTTGG - Intronic
984127698 4:175832593-175832615 CAGGAAGGAAGCATTAACTTGGG + Intronic
985494161 5:195261-195283 CAAGAAACAAGCAATGAGCTTGG + Exonic
986078039 5:4358133-4358155 TAACAGGGAAGCATTGGTCTTGG - Intergenic
986368881 5:7061186-7061208 CACGAAGGAGGCTTTGAACTGGG + Intergenic
992670903 5:79060295-79060317 TAAGAAGGAAGTTTTGAGCTTGG - Intronic
992921670 5:81529713-81529735 CACAAAGGAAGCAATGATTTTGG + Intronic
993194367 5:84722093-84722115 CAAGCAGGAACCACTGAACTTGG + Intergenic
993490906 5:88547629-88547651 CAAGAAGCATGTATTGATATGGG + Intergenic
995716646 5:115087267-115087289 CATGTTGGAAGCAATGATCTAGG - Intergenic
995987944 5:118203103-118203125 CAAGAAAGAAGAACTGATTTGGG + Intergenic
996113489 5:119592520-119592542 CATAAAGGAAGCAGTGGTCTAGG + Intronic
996626192 5:125572948-125572970 CAAGAAGGCATCATTGTCCTGGG - Intergenic
1003157694 6:3610061-3610083 AAAAAGGGAAGCATTGTTCTGGG + Intergenic
1003654815 6:7996789-7996811 CATGATGAAAGCATTGCTCTAGG - Intronic
1004322812 6:14646089-14646111 CAAGAGGGAAGAGTTGATATGGG + Intergenic
1004444991 6:15689763-15689785 CAAGAATGAAGTACTGATTTGGG - Intergenic
1004720701 6:18265340-18265362 AAAGAAGGCAGCATTGAGCAGGG - Intergenic
1005391899 6:25342441-25342463 CTAGGAGGCAGCATTGATTTTGG + Intronic
1005673426 6:28130190-28130212 CATCCAGGAACCATTGATCTTGG - Intergenic
1006763021 6:36480271-36480293 CAAGAGGGAAGCAGTCAGCTTGG - Intronic
1007234584 6:40381253-40381275 CAAAAAGGCAGCAGTGATCTGGG + Intergenic
1007715716 6:43854968-43854990 CAACAAGGTAGAATTGAACTGGG - Intergenic
1007996292 6:46311669-46311691 AAACAAGGAAGCTTTGATCTGGG - Intronic
1009806841 6:68610086-68610108 CAATAAGCAAGCATTTATTTAGG + Intergenic
1010205193 6:73316044-73316066 CATGAAGCTAGCATGGATCTCGG - Intergenic
1012636837 6:101553654-101553676 AAAGAAGGAAACTTTGACCTTGG - Intronic
1013111473 6:107068516-107068538 CAAGAAAGAAGCCTTGAGTTTGG - Exonic
1013738494 6:113255788-113255810 CAAGAATAAACAATTGATCTTGG + Intergenic
1013853130 6:114540143-114540165 GAAGAAGGAAGCACAGAACTTGG + Intergenic
1013932180 6:115546995-115547017 CATGGAGGAAGCATTAATATGGG + Intergenic
1014166557 6:118231625-118231647 CAATATGGAAGCATTTATTTAGG + Intronic
1015016557 6:128419914-128419936 CAAGAAGAAAGAGTTGATCTTGG - Intronic
1015530461 6:134216735-134216757 AAAGAAGGAAGCAATAATATGGG + Intronic
1015610092 6:135007882-135007904 AAAGAAGGAAGCTTTGATTCTGG + Intronic
1017218458 6:151937497-151937519 CAAGAAGGAACCTATGAACTAGG + Intronic
1018756542 6:166854145-166854167 CAAGAAGGCAGTAGTGATGTGGG - Intronic
1018784879 6:167100280-167100302 CAAGAAGGAATCTTTGATGTGGG + Intergenic
1018895732 6:168015657-168015679 CAAGAAGGATTCATTTCTCTTGG - Intronic
1019543532 7:1561831-1561853 CAAGAAAGAAGCACACATCTGGG - Intergenic
1019802937 7:3101665-3101687 CTAAATGGAAGCATGGATCTCGG - Intergenic
1022208818 7:28188388-28188410 GAAGAAAGAATCATTTATCTTGG - Intergenic
1023356837 7:39375601-39375623 CAAGGAGGAAGCATTGGTCTTGG - Intronic
1025716257 7:63959424-63959446 CAAGAAAGAAGCATTGAGACTGG + Intergenic
1026519999 7:71108681-71108703 CAATAAGGACGCATTTATATTGG - Intergenic
1026580427 7:71611585-71611607 CATCAAGGAAACATTTATCTTGG - Intronic
1027375951 7:77549811-77549833 CAAGATGGAAGGATTGCTTTAGG - Intronic
1028669534 7:93385770-93385792 CATGAATGATGGATTGATCTAGG - Intergenic
1029376893 7:100183406-100183428 CAGGAAGGAAGCTTGGATGTGGG + Intronic
1031646506 7:124232405-124232427 CAAGAAGGTAGCACTGTACTGGG + Intergenic
1032095360 7:128935463-128935485 CAAGCCGGCAGCATTGATATGGG - Intergenic
1032567658 7:132964199-132964221 TAATAAAGAAGCATTAATCTGGG - Intronic
1035013993 7:155747947-155747969 CAAAAAGGAAGCATTTATTTTGG + Intronic
1035605991 8:929783-929805 TTAGAAGGAAATATTGATCTTGG + Intergenic
1035724194 8:1814321-1814343 GGAGAAGGAAGCATTGTTCCAGG - Intergenic
1039105102 8:33981781-33981803 CAAGAAGAAAGGATTTATCAGGG - Intergenic
1039117583 8:34109541-34109563 CAAGGAGGAAGCCCTGAGCTAGG + Intergenic
1039248553 8:35635982-35636004 GAAGAAGGAAGCAGAAATCTCGG + Intronic
1039513205 8:38108234-38108256 CAGGAAGAAATAATTGATCTTGG + Intronic
1039819992 8:41126654-41126676 GAGGAAGGAAGCCTGGATCTGGG - Intergenic
1041397537 8:57406875-57406897 CAAGTAGGAAGCAAGGACCTGGG + Intergenic
1041575977 8:59396002-59396024 TAAGAAGCCAGCATTTATCTAGG + Intergenic
1041601810 8:59727023-59727045 AAAGATGGAACCATTGAACTAGG - Intergenic
1042583790 8:70312378-70312400 CAAGAAAGATACATTGATTTAGG - Intronic
1044351643 8:91173340-91173362 GAGGAAGGAAGCATTGACCCAGG - Intronic
1046815141 8:118575037-118575059 TAAGCAGGAACCATTAATCTGGG - Intronic
1047183287 8:122609683-122609705 GTAGAAGAAAGCATTGACCTTGG + Intergenic
1047644307 8:126853589-126853611 CAAGAAGGAAGCAATGAAACTGG - Intergenic
1048871407 8:138802520-138802542 GGAGAAGGAAGCATTATTCTTGG + Intronic
1051581702 9:18683150-18683172 CAATAAGGAAGCATTCAGTTTGG - Intronic
1051916590 9:22216452-22216474 TAAGATGTAAGCATTAATCTAGG - Intergenic
1053788531 9:41669678-41669700 CAAGTAGTAAACAGTGATCTAGG - Intergenic
1054156608 9:61645090-61645112 CAAGTAGTAAACAGTGATCTAGG + Intergenic
1054176816 9:61881017-61881039 CAAGTAGTAAACAGTGATCTAGG - Intergenic
1054476378 9:65576099-65576121 CAAGTAGTAAACAGTGATCTAGG + Intergenic
1054660719 9:67699789-67699811 CAAGTAGTAAACAGTGATCTAGG + Intergenic
1056063104 9:82905070-82905092 CAAGTGGGCAGCATTGAGCTGGG + Intergenic
1058112032 9:101041218-101041240 CAAGAAGAAAGCTTTAATGTTGG - Intronic
1058297777 9:103330205-103330227 CAACTAGGAAGCTTTTATCTGGG - Intergenic
1058741098 9:107943334-107943356 CAAGCAGGTAGCATTGATGGGGG + Intergenic
1059591939 9:115671299-115671321 TGAGAAGGAGGCAATGATCTGGG + Intergenic
1059726766 9:117016092-117016114 AAAGAAGTAAAAATTGATCTTGG - Intronic
1060167046 9:121425938-121425960 TAAAAAGGAGGCAATGATCTGGG + Intergenic
1061845994 9:133388743-133388765 AAAGCAGGTAGCATTCATCTGGG - Intronic
1187439775 X:19307505-19307527 GGAGAAGGAAGAATGGATCTGGG + Intergenic
1188947922 X:36330903-36330925 AAAGAGGGAAACATTGATATAGG - Intronic
1189125271 X:38438808-38438830 AAGAAAGAAAGCATTGATCTGGG - Intronic
1189257190 X:39649703-39649725 CAAGGAAGAAGCAGTGATGTTGG + Intergenic
1189925054 X:45944472-45944494 CAATAAGGAAACAGAGATCTCGG - Intergenic
1190342113 X:49305068-49305090 CATGAAGGAAACATTGATTCTGG + Intronic
1190344360 X:49323405-49323427 CATGAAGGAAACATTGATTCTGG + Intronic
1190345451 X:49332949-49332971 CATGAAGGAAACATTGATTCTGG + Intronic
1190346552 X:49342515-49342537 CATGAAGGAAACATTGATTCTGG + Intronic
1190347798 X:49533543-49533565 CATGAAGGAAACATTGATTCTGG + Intronic
1190348899 X:49543099-49543121 CATGAAGGAAACATTGATTCTGG + Intronic
1190350001 X:49552655-49552677 CATGAAGGAAACATTGATTCTGG + Intronic
1190351104 X:49562208-49562230 CATGAAGGAAACATTGATTCTGG + Intronic
1190352205 X:49571766-49571788 CATGAAGGAAACATTGATTCTGG + Intronic
1190353306 X:49581315-49581337 CATGAAGGAAACATTGATTCTGG + Intronic
1190354412 X:49590859-49590881 CATGAAGGAAACATTGATTCTGG + Intronic
1190355511 X:49600386-49600408 CATGAAGGAAACATTGATTCTGG + Intronic
1192760798 X:74094350-74094372 CGAAAAGGAGGCAATGATCTAGG + Intergenic
1194294705 X:92113732-92113754 CAAGAAGGAAGAGTTGACCCTGG - Intronic
1195962151 X:110397310-110397332 AAAGAAGGAATCATTGCTGTTGG + Intronic
1198328190 X:135595539-135595561 CCACAAGGAAGCATTCACCTAGG + Intergenic
1198787435 X:140304137-140304159 CAAGGAGTGTGCATTGATCTTGG - Intergenic
1199565693 X:149213370-149213392 CAAGCAGGAAGCAGTGGTTTAGG - Intergenic
1200612201 Y:5338235-5338257 CAAGAAGGAAGAGTTGACCCTGG - Intronic
1200829654 Y:7678518-7678540 CAAGGAGGAAGCATGGAACTCGG - Intergenic
1200951595 Y:8903651-8903673 CAGGGAGGAAGCATGGAACTTGG + Intergenic
1201063667 Y:10069697-10069719 CAAGGAGGAAGCATGGTACTCGG - Intergenic
1201501594 Y:14649185-14649207 CATGAAGTAAGCATTCTTCTGGG + Intronic
1202109378 Y:21405302-21405324 CAGGGAGGAAGCATGGAACTCGG - Intergenic
1202343276 Y:23891465-23891487 CATGAAGGAAGCACTAAACTTGG + Intergenic
1202527492 Y:25778620-25778642 CATGAAGGAAGCACTAAACTTGG - Intergenic
1202586871 Y:26439570-26439592 CATGAAGGAAGATTTGATTTTGG + Intergenic