ID: 918338646

View in Genome Browser
Species Human (GRCh38)
Location 1:183548158-183548180
Sequence TAAGGGAACTTCAAGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918338646_918338652 4 Left 918338646 1:183548158-183548180 CCCTGGCACTTGAAGTTCCCTTA 0: 1
1: 0
2: 3
3: 17
4: 200
Right 918338652 1:183548185-183548207 TTTGCCTGGGTAGTAGCAGTAGG 0: 1
1: 0
2: 5
3: 27
4: 164
918338646_918338654 6 Left 918338646 1:183548158-183548180 CCCTGGCACTTGAAGTTCCCTTA 0: 1
1: 0
2: 3
3: 17
4: 200
Right 918338654 1:183548187-183548209 TGCCTGGGTAGTAGCAGTAGGGG 0: 1
1: 0
2: 21
3: 1101
4: 2753
918338646_918338649 -9 Left 918338646 1:183548158-183548180 CCCTGGCACTTGAAGTTCCCTTA 0: 1
1: 0
2: 3
3: 17
4: 200
Right 918338649 1:183548172-183548194 GTTCCCTTAAGAATTTGCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 138
918338646_918338653 5 Left 918338646 1:183548158-183548180 CCCTGGCACTTGAAGTTCCCTTA 0: 1
1: 0
2: 3
3: 17
4: 200
Right 918338653 1:183548186-183548208 TTGCCTGGGTAGTAGCAGTAGGG 0: 1
1: 0
2: 0
3: 14
4: 129
918338646_918338648 -10 Left 918338646 1:183548158-183548180 CCCTGGCACTTGAAGTTCCCTTA 0: 1
1: 0
2: 3
3: 17
4: 200
Right 918338648 1:183548171-183548193 AGTTCCCTTAAGAATTTGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918338646 Original CRISPR TAAGGGAACTTCAAGTGCCA GGG (reversed) Intronic
901793844 1:11669001-11669023 TGTGGGAATTGCAAGTGCCAAGG - Intronic
902322276 1:15676251-15676273 TAAGGAAATAGCAAGTGCCAAGG - Intergenic
902671448 1:17977227-17977249 TAAGGTAGCTTCCAATGCCAGGG - Intergenic
902679919 1:18036094-18036116 CAAGGGAACTGCTAGTGCAAAGG + Intergenic
903586425 1:24419042-24419064 AAAGGGAACATTAAGGGCCAGGG + Intronic
903790531 1:25889902-25889924 AAAGGGAACTGCTAGTGCCAAGG - Intronic
903960244 1:27052538-27052560 AAAGGGAAATTGAAGAGCCAAGG + Intergenic
904362654 1:29987088-29987110 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
904725184 1:32541367-32541389 AAAGGGAACGGCAAGTGCAAAGG - Intronic
905799789 1:40835821-40835843 AGAGGGAACAGCAAGTGCCAAGG + Intronic
906273600 1:44500288-44500310 CAAGGGAACTGCAAGAGCAAAGG - Intronic
907586397 1:55621525-55621547 AAAGGGAACTGCAGGTGCCAAGG - Intergenic
909800657 1:79803610-79803632 TAATGGCACTTCAAAGGCCACGG + Intergenic
910523414 1:88149914-88149936 TAAAGGAACAACAAGGGCCAAGG + Intergenic
916650003 1:166826017-166826039 GAAAGGAACAGCAAGTGCCAAGG + Intergenic
918338646 1:183548158-183548180 TAAGGGAACTTCAAGTGCCAGGG - Intronic
922421604 1:225464244-225464266 TGAGGGCACTTCACGTTCCAGGG + Intergenic
924308013 1:242711542-242711564 TAAAGGGATTTAAAGTGCCAGGG + Intergenic
1063584510 10:7339693-7339715 TAAGGGAAGCTCAGATGCCATGG - Intronic
1065077737 10:22098015-22098037 TAAAAGACCTTCAAGTGCTAAGG - Intergenic
1066321609 10:34308489-34308511 TAAGGGAAAATCAGGTGTCAAGG + Intronic
1070116812 10:73536749-73536771 TGAGGGAACTTCAGCTGCCTTGG + Intronic
1070836720 10:79452029-79452051 TAGGGGAACAGCAAGTGCAAAGG - Intergenic
1071118475 10:82251169-82251191 TAAGGAAGCTTTAAGTGCCAGGG - Intronic
1072214022 10:93272962-93272984 GAAGGGAGCTTCAGGGGCCATGG + Intergenic
1072547170 10:96448723-96448745 TATGGGAACAGCAAGTGCAAAGG + Intronic
1072927786 10:99631691-99631713 TAAGGGAACTTCAGCTACCCTGG - Intergenic
1074425490 10:113347645-113347667 GAAGGGAAAGCCAAGTGCCAAGG - Intergenic
1074779446 10:116790517-116790539 AAAGGGAACAGCAAGTGCAAAGG - Intergenic
1075997688 10:126891796-126891818 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1080058686 11:27934006-27934028 TAAGGGAACTTCTAGGGACAAGG + Intergenic
1080527184 11:33135059-33135081 TAAGGACACTTCAAGTGTTACGG - Intronic
1085449081 11:76621303-76621325 TAAGGGAACTGCATGTACAAAGG + Intergenic
1087883581 11:103449120-103449142 AGAGGGAACAGCAAGTGCCATGG + Intronic
1088315388 11:108501052-108501074 TCAGAGAAGTTCAAGGGCCATGG + Intergenic
1088611191 11:111578619-111578641 AAAGGGAACTTTAAGTGATAAGG - Intergenic
1089155704 11:116400641-116400663 GAAGGGAACATCAAGTGGGAAGG - Intergenic
1090244502 11:125206206-125206228 GAAGGAAACTTCAAGGGCAAGGG + Intronic
1090987363 11:131780654-131780676 AGAGGGAAAATCAAGTGCCATGG - Intronic
1092036804 12:5343254-5343276 TATGATAACTTCCAGTGCCAAGG + Intergenic
1092219284 12:6701590-6701612 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1093652259 12:21658645-21658667 TAGGGGAACTTCAGATGGCAGGG - Intronic
1094223811 12:28023987-28024009 TAAGGGAACAGCAATTACCAAGG + Intergenic
1097909863 12:64958228-64958250 TAAGGGAACAGTAAGTGCAAAGG + Intergenic
1098139562 12:67437864-67437886 TAAGGGAACATCAAGTGCAAGGG + Intergenic
1099346073 12:81501250-81501272 GAAGGGAATATCAAGTGCAAAGG - Intronic
1099729354 12:86478639-86478661 TCAGGGAATTTGAATTGCCATGG - Intronic
1100591684 12:96035689-96035711 TGAAGGAACTACAAGTTCCATGG + Intronic
1101471781 12:105003998-105004020 TATAGGAACTACAAGTACCAAGG + Intronic
1101670555 12:106868046-106868068 TAAGGTAACCTCAAGTCCCCTGG - Intronic
1102017032 12:109654953-109654975 TAAGGGACCTCCCAGAGCCATGG - Intergenic
1102531746 12:113551751-113551773 CAAGGGAACAGCAAGTGCAAAGG - Intergenic
1106657256 13:31759483-31759505 AAAGGCAACATCAAGTGCAAAGG + Intronic
1107072272 13:36284039-36284061 TATGGGTATTTCAAGTTCCAAGG - Intronic
1107087363 13:36440203-36440225 TCTAGGAACTTCCAGTGCCAAGG + Intronic
1107977128 13:45701077-45701099 CAAGGGAGCCTGAAGTGCCATGG + Intergenic
1110228171 13:73141429-73141451 CCAGGGAACTTCGAGAGCCAGGG + Intergenic
1113307081 13:109090449-109090471 CAAGGGCACGGCAAGTGCCAGGG + Intronic
1113640132 13:111951465-111951487 GAAGGGAACTTCTAGCTCCAAGG - Intergenic
1116748057 14:48846951-48846973 TGAGGAAACTTCAGGGGCCAAGG - Intergenic
1118151849 14:63198047-63198069 AAAGGGAAATCCAAGTCCCAGGG + Intergenic
1119127174 14:72138174-72138196 TATGGAATCTTCAAATGCCAAGG + Intronic
1119313176 14:73668029-73668051 CAAGAGAACTTCAAGTACAAAGG - Intronic
1119688985 14:76655796-76655818 CAAGGGGACAGCAAGTGCCAAGG - Intergenic
1120681058 14:87480990-87481012 AAAGGGAACAGCAAGTGCAAAGG + Intergenic
1120964184 14:90153043-90153065 TCAGGGAACTTCTAGTGCATAGG - Intronic
1202914764 14_GL000194v1_random:157879-157901 TAAGGGAACTTCATGGGAAATGG - Intergenic
1131116679 15:89800192-89800214 AAAGGGAATAGCAAGTGCCAGGG - Intronic
1132404976 15:101536545-101536567 CATGGGACCTTCCAGTGCCAGGG - Intergenic
1134239508 16:12495068-12495090 TAAAGGAACTGCATGTGCAAAGG - Intronic
1135665448 16:24331803-24331825 AGAGGAAACTGCAAGTGCCAAGG - Intronic
1136108784 16:28051653-28051675 TAAGGGAGCTGCACGTGCAAAGG + Intronic
1138122911 16:54414818-54414840 AAAGGGAACCGCAAGTGCAAAGG + Intergenic
1138371506 16:56530655-56530677 GGAGGGAACTGTAAGTGCCAAGG - Intergenic
1139081478 16:63527345-63527367 TATGGGAACTTAAAATGACATGG + Intergenic
1139747834 16:69088762-69088784 AATGGGAACAGCAAGTGCCAAGG + Intergenic
1144035916 17:11365984-11366006 AGAGGGAACTGCAAGTGCAAAGG + Intronic
1144291809 17:13833826-13833848 TCAGGGAACTTCAACTCTCATGG + Intergenic
1144726004 17:17503099-17503121 CAAGGGAACAGCATGTGCCACGG - Intergenic
1146467366 17:33096827-33096849 GGAGGGAACAGCAAGTGCCAAGG + Intronic
1150558870 17:66277880-66277902 AAAGGGAAGTGCAAGTGCAATGG + Intergenic
1151578080 17:74962884-74962906 CAAGGGAACTTCAACTGGCCCGG + Intronic
1152030500 17:77839271-77839293 ACAGGGAACTGCAAGTGTCAAGG - Intergenic
1153467403 18:5404192-5404214 CAAAGGAGCTTCAAGTCCCAGGG - Intronic
1153671258 18:7414668-7414690 AAAGGGAACAGCATGTGCCAAGG + Intergenic
1154041704 18:10862322-10862344 TAAGGAAACTTTAGGTGCTATGG + Intronic
1154236092 18:12607451-12607473 TAAGGGTACTTGAAGGGCAAGGG - Intronic
1160659829 19:292664-292686 TGAGGGAACTCCAAGGGCAAGGG + Intergenic
1162366756 19:10254413-10254435 AGAGGGAACAGCAAGTGCCAAGG + Intronic
1162374368 19:10296170-10296192 TAAGGCCACTCCCAGTGCCAGGG - Intronic
1164877379 19:31700947-31700969 TAGGGAAACTTCAAGGACCATGG - Intergenic
1165391965 19:35543961-35543983 TAAAGGAACAGCAAGTGCAAAGG - Intronic
1165692734 19:37876232-37876254 AAAAGGAACAGCAAGTGCCAAGG + Intergenic
1165937982 19:39401085-39401107 AGAGGGAACTGCAAGTGCCAGGG + Intergenic
1165958734 19:39517621-39517643 TGAGGGAACTGCCAGTGCAAAGG + Intronic
1165986864 19:39777108-39777130 AAAGGGAACATCAAGTGCAAAGG - Intronic
1166219595 19:41355945-41355967 AGAGGGAACAGCAAGTGCCAAGG + Intronic
1166251810 19:41576486-41576508 TAAGTGAACTGGAATTGCCAAGG + Intronic
1166673954 19:44727882-44727904 AGAGGGAACAGCAAGTGCCAAGG - Intergenic
1167242337 19:48351690-48351712 TGAGGGAACTCCACGTGCAAAGG - Intronic
924981199 2:223147-223169 AAAGGGAACATCACTTGCCATGG - Intronic
925961879 2:9025144-9025166 TCAGGGAACTTCAAGGAACAGGG + Intergenic
928062865 2:28132532-28132554 TAAGAAAACTTCAAGTGCTCAGG - Intronic
928259781 2:29756146-29756168 CAAGGGAACTGCATGTGCAAAGG - Intronic
930818605 2:55623136-55623158 TAACGTAACTTCCAGTTCCAAGG - Intergenic
931532046 2:63226490-63226512 TAAGGTAACTTAATGTGACAGGG - Intronic
932215859 2:69965651-69965673 TAAGGAAACTGCAGGTGCCTTGG - Intergenic
936685352 2:114821076-114821098 AGAGGGAACTTCAAGTGCCAAGG + Intronic
937071425 2:119066650-119066672 GAATGGAACTTCAGGTCCCAGGG - Intergenic
942643391 2:178084969-178084991 TAAGGAAAGTCCAAGAGCCATGG - Intronic
943784938 2:191867071-191867093 AAAGGGAAGTTCAAGAGCCAAGG - Intergenic
944177610 2:196850451-196850473 GAAGAAAACTTCAAGTGCCAGGG + Intronic
944852403 2:203733329-203733351 TAAGGGAGCTTGAGGTGTCAAGG + Intronic
945167119 2:206957926-206957948 TAAGTGAACTCTAAGTGCAAAGG + Intronic
946109716 2:217403884-217403906 TAAGAGAACAGCATGTGCCAAGG - Intronic
946572656 2:221041710-221041732 GAAGGCAACCTCAAGTGACATGG - Intergenic
948113079 2:235472496-235472518 AAAGGGAAGCTCAGGTGCCACGG + Intergenic
1168811251 20:706191-706213 GGAGGGAACAGCAAGTGCCAGGG + Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172027767 20:31960699-31960721 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
1174385372 20:50185665-50185687 AAAGGGAACAGCAAGTGCAAAGG - Intergenic
1174394691 20:50239711-50239733 AGAGGGAACTGCAAGTGCAAAGG + Intergenic
1175207850 20:57325568-57325590 TAAGGGAAAGGCAAGTGCAAAGG + Intergenic
1175222913 20:57427602-57427624 TGAGGGAACTGCACGTGCAAAGG - Intergenic
1177048517 21:16201915-16201937 TAAGGAAAATATAAGTGCCAAGG + Intergenic
1178015009 21:28335044-28335066 CAAGGGAATTTCAGGTGCCTTGG - Intergenic
1178715839 21:34963592-34963614 TAAGGGAACTTTGACAGCCAAGG + Intronic
1182767703 22:32770533-32770555 CAAGGGAACATCAAGTGCAAAGG - Intronic
1184025570 22:41853334-41853356 CCAGGGAACCTCAAGAGCCAAGG - Intronic
1184424608 22:44402216-44402238 TAAGGGAACGACAAGAGTCAAGG + Intergenic
1184717965 22:46292661-46292683 TGAGGGAACAGCAAGGGCCAAGG - Intronic
949954715 3:9258309-9258331 TAAGGGAACTGCATGAGCCAAGG + Intronic
950682869 3:14597098-14597120 AAAGGGAACAGCAAGTGCAAAGG + Intergenic
951678444 3:25268652-25268674 TAAGGGAACAACCAGTGCAAAGG - Intronic
952970022 3:38644895-38644917 AGAGGGAACTGCAAGTGCAAAGG - Intronic
957663928 3:83198607-83198629 GAAGGGAACTTAAAGAGACATGG + Intergenic
958707342 3:97672483-97672505 TAGGGGAACTTCAGGTGAAAAGG + Intronic
960837830 3:121925820-121925842 GAAGGGAAGATCAAGTGCCAAGG + Intronic
961941881 3:130646615-130646637 ATAGGGAACTTTAAGTGCAAAGG + Intronic
962924638 3:139980327-139980349 TCAGGGAACGGCAAGTGCAAAGG - Intronic
968277176 3:197449071-197449093 TAAAGGAACTTCAAGTTATATGG + Intergenic
969489534 4:7491204-7491226 AAAGGGAACAGCATGTGCCAAGG - Intronic
970932537 4:21529347-21529369 TGACGGAACATCAAGTACCAAGG + Intronic
972353790 4:38261505-38261527 TAAGGGAACAGCATGTGCAAAGG - Intergenic
973764654 4:54152110-54152132 TCAGGGAAATCCAGGTGCCAAGG - Intronic
973848283 4:54935211-54935233 GAAGGGAACCGCAAGTGCAAAGG - Intergenic
973855465 4:55006556-55006578 TAAGAGAACTCCAAGGACCAAGG - Intergenic
974121020 4:57639406-57639428 TAAGGAAACTTTAAGTGACAAGG - Intergenic
976745929 4:88402924-88402946 GAAGGGAACTTTAAGAGCCGTGG + Intronic
978429621 4:108620174-108620196 TAAGGGACCTTCAAGGACCAGGG - Intergenic
978480482 4:109184580-109184602 TGAAAGAACTTCAAGTTCCAGGG + Intronic
978624434 4:110668466-110668488 CCAAGGAACTTCATGTGCCATGG - Intergenic
979549812 4:121978005-121978027 AAAGGGAACTGAAAGTGCAAAGG + Intergenic
984021294 4:174487391-174487413 TCAGGGTACTACCAGTGCCAAGG - Intergenic
986023908 5:3831788-3831810 TAAGGAAACCTCACGTGCAAGGG + Intergenic
989397813 5:40977425-40977447 AAAGGAAACTACAAGTCCCATGG + Intronic
991336620 5:65555321-65555343 AGAGGGAACTGCAAGTGCAAAGG + Intronic
993820071 5:92603192-92603214 TAAGAGAAAGTCATGTGCCAAGG - Intergenic
993994830 5:94710342-94710364 TAAGGAACCTGCAAGTACCAAGG + Intronic
995332409 5:110959898-110959920 AGAGGGAACAGCAAGTGCCAAGG + Intergenic
996901465 5:128546767-128546789 TAAGGTAACTTCAAATGCCATGG + Intronic
997284065 5:132665763-132665785 AAAGGGAACTGCAGGTGCTAAGG + Intergenic
997753754 5:136375047-136375069 TAATGGAACTTAAAATGCCTAGG + Intronic
998804695 5:145907002-145907024 AAAGGGAACTTCTGTTGCCAAGG + Intergenic
999518685 5:152327698-152327720 TATGGGAATTTAAAGTGCCAAGG - Intergenic
999735097 5:154506914-154506936 AGAGGGAACTACAAGTGCAAAGG - Intergenic
1000239488 5:159396345-159396367 TAATGGAACAGCAAGTGCAAAGG + Intergenic
1001072801 5:168601374-168601396 AAAGGGAACATCAAGTGCAAAGG - Intergenic
1001108689 5:168877333-168877355 TAAGGGAGCAGCAAGTGCAAAGG + Intronic
1001667623 5:173446503-173446525 TAATGGAATTCCAAGTGCCCAGG - Intergenic
1003020797 6:2507581-2507603 CAATGGAACTTCAAGAGCCCTGG + Intergenic
1004764463 6:18709913-18709935 TCAGAGAACTTCAGCTGCCAGGG + Intergenic
1005770480 6:29065735-29065757 AAGGGGAACATCACGTGCCAGGG - Intronic
1006792691 6:36714239-36714261 TAAGGGAATTCCATGGGCCAGGG + Intronic
1007918727 6:45586696-45586718 GAAGGGATCTTCGGGTGCCAGGG - Intronic
1008138174 6:47800981-47801003 TAAGAGAAATTCAGGTGCCCAGG - Intronic
1008448816 6:51625284-51625306 AAAGGGAAACTAAAGTGCCATGG + Intronic
1009901184 6:69809438-69809460 TAAGGCAACAACAAGTGCAAAGG + Intergenic
1009938605 6:70262382-70262404 TAAGGGAATTTAAAGTGTAAGGG - Intronic
1010991721 6:82486662-82486684 TAAGATAACTTCTAATGCCATGG + Intergenic
1012276532 6:97282083-97282105 TAAGGGAACATCAGTTACCAAGG + Intronic
1014311337 6:119805743-119805765 TATGGGAAGTTCAGGTGACAGGG - Intergenic
1015023936 6:128510190-128510212 TAATGGACCTTCAATGGCCAGGG - Intronic
1016448998 6:144161698-144161720 TGCTGGAACTTCAAGTGCTATGG + Intronic
1016621736 6:146118612-146118634 AAAGGGAACATCACATGCCAGGG - Intronic
1017697318 6:157029977-157029999 TAAAGGAACTCTAGGTGCCATGG - Intronic
1018306964 6:162467886-162467908 AAAGGGAACAACAAGTACCAAGG - Intronic
1019665633 7:2250930-2250952 CACGGGTACTTCAAGTTCCAGGG + Exonic
1021137015 7:16977530-16977552 TAAGGGCAGATCAAGTGCTAAGG - Intergenic
1021576692 7:22111834-22111856 AGAGGGAACATCAAGTGCAAAGG - Intergenic
1022957626 7:35396080-35396102 AAAGGGAAATTCTAGTGCCTGGG - Intergenic
1023107196 7:36774192-36774214 GAAGGGTACTTCCAGTTCCAAGG + Intergenic
1024656673 7:51456752-51456774 AGAGGGAACTTCAATTGCCAAGG - Intergenic
1030166690 7:106562560-106562582 AGAGGGAAATTCAAGTGCCCTGG + Intergenic
1035104160 7:156428308-156428330 CCAGGGAACCACAAGTGCCAGGG + Intergenic
1037667253 8:20980746-20980768 TTAGGGAAGTGGAAGTGCCAAGG - Intergenic
1041076002 8:54170637-54170659 AAAGGGAACTCCAATTCCCAAGG - Intergenic
1043811563 8:84748923-84748945 TAGGGGAACTTTAGTTGCCAAGG - Intronic
1044492950 8:92842348-92842370 TAATGGAAGTTCAGGTGACAAGG - Intergenic
1047183883 8:122614616-122614638 TGAGGGAACAGCAAGTGCAAAGG - Intergenic
1048147786 8:131862489-131862511 CAAGGGAACAGCAAGTGCAAAGG - Intergenic
1049495020 8:142925966-142925988 AAAGGAAACATCAAATGCCAAGG + Intergenic
1055574697 9:77648894-77648916 TAAGAGAACTGCAAGAGCCCAGG + Intergenic
1056956276 9:91084172-91084194 TAAGGGGGTTTCAAGAGCCAAGG + Intergenic
1058137581 9:101323868-101323890 TAAGGGAAATTCAGGGGCCTTGG + Intronic
1058662586 9:107280636-107280658 TGAAGGAACCTCAAGTGCAAAGG + Intergenic
1060487103 9:124054644-124054666 CAAGGGAAATACCAGTGCCAGGG + Intergenic
1061205134 9:129158589-129158611 CAAGGAAACAGCAAGTGCCAAGG - Intergenic
1061606986 9:131718178-131718200 TAAGAGAACGGCAAGTGCAAAGG + Intronic
1186116176 X:6307186-6307208 TAAGGGAACTTCAGGTTCCTCGG - Intergenic
1187574313 X:20538305-20538327 TAAGGGAACTTCACCTCCTATGG - Intergenic
1188149744 X:26657179-26657201 TAAAGGAACATCAACTGACACGG - Intergenic
1189222685 X:39385690-39385712 AAAGGGAACTGCATGTGCAAAGG - Intergenic
1189248985 X:39585429-39585451 TGAGTGAATGTCAAGTGCCAGGG - Intergenic
1195767956 X:108316769-108316791 AAAGGGAACAGCAAGTGCAAAGG + Intronic
1195920277 X:109976742-109976764 TCAGGGAACTTAAATTGCAATGG - Intergenic
1197127603 X:122965874-122965896 CAAAGGGATTTCAAGTGCCAAGG - Intergenic
1197611355 X:128642760-128642782 CAGGGTAACTTCAAATGCCAGGG - Intergenic
1199259863 X:145759858-145759880 AGAGGGAACACCAAGTGCCAAGG + Intergenic
1200252113 X:154559303-154559325 CAAGGGAACTTCACCAGCCAAGG + Intronic
1200265655 X:154645113-154645135 CAAGGGAACTTCACCAGCCAAGG - Intergenic