ID: 918339158

View in Genome Browser
Species Human (GRCh38)
Location 1:183552972-183552994
Sequence GACCCCATGCTGTTGCTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 9, 3: 41, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918339158_918339163 11 Left 918339158 1:183552972-183552994 CCAAGAAGCAACAGCATGGGGTC 0: 1
1: 0
2: 9
3: 41
4: 197
Right 918339163 1:183553006-183553028 GCCCAAAAGACAGTCTGAAGAGG 0: 1
1: 0
2: 0
3: 34
4: 195
918339158_918339166 15 Left 918339158 1:183552972-183552994 CCAAGAAGCAACAGCATGGGGTC 0: 1
1: 0
2: 9
3: 41
4: 197
Right 918339166 1:183553010-183553032 AAAAGACAGTCTGAAGAGGAAGG 0: 1
1: 0
2: 3
3: 46
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918339158 Original CRISPR GACCCCATGCTGTTGCTTCT TGG (reversed) Exonic
901012125 1:6207894-6207916 GACAGCATGCTGTTCCCTCTGGG + Intronic
901079577 1:6576339-6576361 GGCCCCAGGCCCTTGCTTCTGGG + Intronic
903701545 1:25252436-25252458 GAGCCTAGGCTGTTGCTTCCCGG - Intronic
904613633 1:31738431-31738453 GACTCCCTGCTGTTGCCTCGTGG - Intronic
904919732 1:33997593-33997615 TGACCCATGCTGTTGCTTTTAGG + Intronic
907845692 1:58204474-58204496 TACCCCCTACTGGTGCTTCTGGG - Intronic
910138656 1:84001092-84001114 GACCCAATGCTCCTGCTCCTCGG - Intergenic
913330650 1:117664334-117664356 GACCTCATCATGTTGCTTCTGGG + Intergenic
915664649 1:157433473-157433495 GAGCCCAGGCTGCTGCTTTTTGG + Intergenic
917147246 1:171905485-171905507 CACACCATGCTTTTGCTACTTGG - Intronic
918339158 1:183552972-183552994 GACCCCATGCTGTTGCTTCTTGG - Exonic
920915825 1:210257418-210257440 GGCACCATGTTCTTGCTTCTTGG + Intergenic
921266283 1:213423421-213423443 GATCCGATGCTGCTGCCTCTGGG - Intergenic
923703453 1:236322293-236322315 GAGCCCAGGCTGTTGCTTCCTGG - Intergenic
1062779786 10:191988-192010 AACCCCATGCTGTTGTTTTGAGG - Intronic
1062952142 10:1512492-1512514 GACCTCATTCTGTTGCTTTGAGG - Intronic
1067827469 10:49588235-49588257 GAACCCAGGCTGTTGCTTTGCGG + Intergenic
1070632284 10:78095293-78095315 GAACCCATTCAGTAGCTTCTGGG - Intergenic
1071534380 10:86415803-86415825 GACCCCATGCTGTCCTTCCTGGG - Intergenic
1072043337 10:91630547-91630569 GATCCCACGCTGGTTCTTCTGGG + Exonic
1075349788 10:121713490-121713512 AAGCCGATGCTGTTGGTTCTTGG - Intergenic
1075823767 10:125336261-125336283 GCACCTATACTGTTGCTTCTGGG - Intergenic
1075850932 10:125586296-125586318 GACCCAATGATTTTACTTCTAGG - Intronic
1076673864 10:132137663-132137685 GAACCCATGCTGTGGTTTCATGG - Intronic
1076841195 10:133046438-133046460 GCCCCCATGCTGGTGGTCCTGGG + Intergenic
1076996152 11:298438-298460 GACCCCAGGCTGCTGCCCCTGGG - Exonic
1077018257 11:406411-406433 GACCCCATGCTGATTCTTCGAGG - Exonic
1077422210 11:2457983-2458005 GACCCCAGACTGTGGCCTCTAGG + Intronic
1077751097 11:4970908-4970930 GGCCGCATGCTGTTGCATCATGG - Intronic
1082907301 11:58323345-58323367 GACCCGATGATTTTGCTTCTAGG - Intergenic
1082960169 11:58912377-58912399 GACTTCCTGCTTTTGCTTCTGGG + Intronic
1083187756 11:61027300-61027322 GACCCAGTGCTGTTGTTTCTAGG - Intergenic
1083535155 11:63460374-63460396 AACCCCATGCTGCTGCTTCTTGG - Intergenic
1085314636 11:75537001-75537023 GATCCCAGGGTGTTGCTGCTGGG + Intergenic
1085366800 11:75955216-75955238 TACTCCATCCTGTTGCCTCTTGG - Intronic
1088566808 11:111181212-111181234 GAGCCCAGGCTGTTGCTTCCTGG + Intergenic
1089664763 11:120011283-120011305 GACTCCATCCTGTTGCTCCATGG + Intergenic
1093967907 12:25346456-25346478 GACCCCCTAGTGTTGCTTTTGGG - Intergenic
1094817142 12:34199201-34199223 GAGCACAGGCTGTTGCTTCCCGG + Intergenic
1094830203 12:34296676-34296698 GACCCCATGCAGGGGCTGCTGGG - Intergenic
1094830977 12:34300131-34300153 GGCCCCATGCAGGTGCTGCTGGG - Intergenic
1094832203 12:34305516-34305538 GACCCCAAGCCGCGGCTTCTGGG - Intergenic
1094835252 12:34319198-34319220 GGCCCCATGCAGTGGCTGCTGGG + Intergenic
1094837344 12:34328314-34328336 GGCCCCATGCAGTGGCTGCTGGG + Intergenic
1095456764 12:42394731-42394753 AACACCAAGCTGTTCCTTCTTGG + Intronic
1099584582 12:84501619-84501641 GGCCCCATGCTTTGTCTTCTGGG - Intergenic
1101876070 12:108597686-108597708 GATGCCAGGCTGTTGCTTCCAGG - Intronic
1104952531 12:132448129-132448151 GACCCCAGGCTGTGTCTCCTGGG - Intergenic
1105877943 13:24576012-24576034 GATACCATCCTTTTGCTTCTGGG + Intergenic
1105978559 13:25495295-25495317 GATCCAATCCTGCTGCTTCTTGG - Intronic
1106032668 13:26017019-26017041 GACCCCATGCTGCAGCCACTTGG + Intronic
1106412142 13:29517962-29517984 CACCTCCCGCTGTTGCTTCTGGG + Intronic
1107386365 13:39914134-39914156 TACACCATGCTGTTGCCTCTAGG + Intergenic
1108691810 13:52865869-52865891 GAAATCCTGCTGTTGCTTCTGGG + Intergenic
1108731191 13:53237648-53237670 GACACCATCTAGTTGCTTCTAGG + Intergenic
1109315839 13:60748193-60748215 GACTACAGGCTGTTGCCTCTTGG - Intergenic
1110336968 13:74344733-74344755 GGCCCTTTGCTTTTGCTTCTGGG + Intergenic
1111579557 13:90205869-90205891 GAGCCCAAGCTGTTGCTTCTCGG - Intergenic
1111579565 13:90205940-90205962 GAGCCCAGGCTGATGCTTCCCGG - Intergenic
1111579575 13:90206011-90206033 GAGCCCAGGGTGTTGCTTCCCGG - Intergenic
1112881020 13:104106776-104106798 GAAACAATGCTGTTCCTTCTAGG + Intergenic
1113333026 13:109349785-109349807 CAGCCTGTGCTGTTGCTTCTGGG - Intergenic
1115436263 14:33378288-33378310 GATTCCCTCCTGTTGCTTCTAGG - Intronic
1119640101 14:76308489-76308511 GACCCCAGGCTTTTGCTTGCAGG - Intergenic
1120222961 14:81756246-81756268 GAGCCCAAGCTGTTGCTTCCTGG + Intergenic
1122339224 14:101017238-101017260 GACCCCAAGCTGTTGGTGCTGGG + Intergenic
1122655501 14:103256517-103256539 GAGCCCAGGCTGTTGCTTCCCGG - Intergenic
1124023811 15:25946368-25946390 GGCTCCATGCTGTCGCTTCCTGG + Intergenic
1124806542 15:32889560-32889582 GACCACAATCTCTTGCTTCTAGG + Intronic
1126801335 15:52299998-52300020 GAGCCCAGGCTGTTGCTTACGGG + Intergenic
1128157577 15:65401567-65401589 GTCCCCATCCTGTTCCTTCTGGG - Intronic
1128470204 15:67945463-67945485 GATCCCGTGCTGGTGCTTCTAGG - Intergenic
1128700119 15:69797909-69797931 CATCCCATGTTGGTGCTTCTTGG + Intergenic
1129536973 15:76321514-76321536 GACCCCAGGGCGCTGCTTCTGGG + Intergenic
1129783602 15:78292159-78292181 GACCCCATGCTTTACATTCTAGG + Intronic
1131970800 15:97891181-97891203 TACCCTATTCTATTGCTTCTTGG - Intergenic
1133508822 16:6438428-6438450 GACCACATCCTGTAGCCTCTTGG + Intronic
1135234519 16:20742734-20742756 GAGCCCAGGCTGTTGCTTCCCGG + Intronic
1135595996 16:23743729-23743751 GAGCCCAGGCTGTTGCTTCCCGG - Intergenic
1139672455 16:68501039-68501061 GACCCCATCCTCATGCCTCTTGG + Intergenic
1140899746 16:79356786-79356808 GGCCACATGCTGTTGCTCTTGGG + Intergenic
1143058703 17:4181946-4181968 GCCGCCATTCTCTTGCTTCTTGG + Intronic
1145247451 17:21278880-21278902 GACACCATGCTGAGGCTCCTTGG + Intergenic
1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG + Exonic
1145981537 17:29015238-29015260 GACCTCATGCGGTAGCTGCTTGG - Intronic
1145990017 17:29073709-29073731 GACCACATGGTGTTGTGTCTGGG + Exonic
1146644681 17:34569101-34569123 GAACCTCTTCTGTTGCTTCTGGG - Intergenic
1147965336 17:44191654-44191676 GGCCCTAGGCTCTTGCTTCTGGG + Exonic
1203160020 17_GL000205v2_random:40616-40638 GAGCCCAGGCTGTTGCTTCTCGG - Intergenic
1153468343 18:5415157-5415179 CACTGCATGCCGTTGCTTCTGGG + Intronic
1153665452 18:7364157-7364179 GACCCCCTGCTGTTTCAGCTTGG - Intergenic
1155283905 18:24269386-24269408 TACCCTCTTCTGTTGCTTCTGGG + Intronic
1155910072 18:31496807-31496829 GAGCCCAGGCTGTTGCTTCCCGG + Intergenic
1157029649 18:43890190-43890212 GACCTCATGGGGTTCCTTCTAGG + Intergenic
1157804485 18:50648049-50648071 GACACCATGCTTTTGCTCTTGGG + Intronic
1159610896 18:70524620-70524642 AACCTCATGCTGCTGGTTCTAGG + Intergenic
1159697497 18:71578833-71578855 GAGCCCAGGCTGTTGCTTCCCGG - Intergenic
1159741191 18:72173332-72173354 GACCCCCTGCTGATGGTCCTAGG + Intergenic
1162000156 19:7739408-7739430 CATCCCCTGCTGATGCTTCTTGG - Intergenic
1163481887 19:17561437-17561459 GACCCCTTCCTCCTGCTTCTTGG - Intronic
1163523048 19:17803400-17803422 CACCCCAGGCGGTGGCTTCTGGG + Intronic
1163871287 19:19823380-19823402 GAGCCCAGCCTGTTGCTTCCTGG + Intergenic
1163885059 19:19958115-19958137 GAGCCCAGCCTGTTGCTTCCTGG + Intergenic
1163888580 19:19991032-19991054 GAGCCCAGGCTGTTGCTTCCTGG - Intergenic
1163897985 19:20076421-20076443 GAGCCCATCCTGTTGCTTTCCGG - Intergenic
1163915751 19:20239201-20239223 GAGCTCAGGCTGTTGCTTCTTGG + Intergenic
1163915761 19:20239273-20239295 GAACCCATGCTGTTGCTTCCTGG + Intergenic
1163927331 19:20358285-20358307 GAGCCCATACTGTTGCTTCCTGG + Intergenic
1163935369 19:20437562-20437584 GAGCCCAGACTGTTGCTTCCTGG + Intergenic
1163958165 19:20662983-20663005 GAGCCCAGGCTGTTGCTTCCTGG + Intronic
1163977330 19:20864615-20864637 GAGTCCAGCCTGTTGCTTCTTGG + Intergenic
1165322353 19:35093971-35093993 GACCCCCAGCTGTTGAATCTGGG + Intergenic
1165576857 19:36827282-36827304 GAGCCCAGGCTGTTGCTTCCCGG - Intronic
1166293235 19:41876881-41876903 GACCCCATTTCCTTGCTTCTTGG - Intergenic
927885243 2:26714272-26714294 GACCCCAGCCTCTTGATTCTGGG - Intronic
929891555 2:45922629-45922651 CACCCCAGGCAGTTGCTGCTGGG - Intronic
935978312 2:108601301-108601323 GAGCCCAGGCTGTTGCTTCCCGG - Intronic
936135929 2:109893867-109893889 GAGCACAGGCTGTTGCTTCCCGG - Intergenic
936176060 2:110220977-110220999 GAGCCCAGGCTGTTACTTCCTGG - Intergenic
936208768 2:110477618-110477640 GAGCACAGGCTGTTGCTTCCCGG + Intergenic
937695828 2:124807592-124807614 GATCCCTTGCTGTGTCTTCTTGG - Intronic
937911864 2:127079676-127079698 GACCTCAAGCTGTTCCTTCAGGG - Intronic
938213875 2:129491734-129491756 GAGCCAGTGCTGTTGCTTCTGGG + Intergenic
938403814 2:131016093-131016115 AACCCCACCCTCTTGCTTCTGGG + Intronic
939444100 2:142286835-142286857 TAACCCCTGCTGTTGCTCCTTGG - Intergenic
941180526 2:162253988-162254010 GACCCCATGCTGGTGTCTGTGGG - Intergenic
942084700 2:172433029-172433051 GATCCCATGCTATGGCTCCTAGG - Intronic
944277430 2:197854862-197854884 TCCCCCATGCTTTTGCTTTTTGG + Intronic
944431131 2:199634672-199634694 CAGTCCATGCTTTTGCTTCTGGG - Intergenic
945014146 2:205497491-205497513 GACCTCTTTCTGTTGCTTTTAGG + Intronic
946039864 2:216774273-216774295 GGTCACACGCTGTTGCTTCTTGG + Intergenic
946230721 2:218289732-218289754 GACCCCCTGGTGTAGGTTCTTGG - Intronic
948588802 2:239036779-239036801 GGCCCCGTGCTGCTGCTTCAGGG - Intergenic
1169018460 20:2310639-2310661 GACATCCTGCTGTTTCTTCTGGG + Intronic
1171779056 20:29401837-29401859 GAGCCCAGGCTGTTGCTTCCTGG + Intergenic
1172100226 20:32480837-32480859 GTCCCAAGGCTGTTGCTTCATGG + Intronic
1172387351 20:34543332-34543354 GAACCCATGCTTTTCCCTCTAGG - Intergenic
1172658400 20:36550302-36550324 GCCCCCATGCTGTTGGTCCTGGG - Exonic
1173522263 20:43709094-43709116 GGCCCCAGGCTGCTGTTTCTAGG + Intronic
1174054416 20:47788205-47788227 GGCCCCTTGGTGGTGCTTCTGGG + Intergenic
1175208526 20:57330203-57330225 GCCCCCCTTCTGTGGCTTCTAGG + Intronic
1175293156 20:57891590-57891612 GAGCCCCTGCTGTGGCTTGTGGG + Intergenic
1175370216 20:58483284-58483306 GAGGCCTTGCTGCTGCTTCTTGG + Intronic
1176347645 21:5764814-5764836 TAGCCCAGGCTGTTGCTTCCCGG + Intergenic
1176354459 21:5885398-5885420 TAGCCCAGGCTGTTGCTTCCCGG + Intergenic
1176497182 21:7559641-7559663 TAGCCCAGGCTGTTGCTTCCCGG - Intergenic
1176541966 21:8162884-8162906 TAGCCCAGGCTGTTGCTTCCCGG + Intergenic
1176560917 21:8345929-8345951 TAGCCCAGGCTGTTGCTTCCCGG + Intergenic
1177477635 21:21644723-21644745 GACCTCATGCTGTGGCCTCAGGG + Intergenic
1178431965 21:32525340-32525362 GGCCCACTGCTTTTGCTTCTGGG - Intergenic
1180390881 22:12280738-12280760 AACCCCTTGCTGTTGCTTTAGGG - Intergenic
1180408861 22:12584019-12584041 AACCCCTTGCTGTTGCTTTAGGG + Intergenic
1182059856 22:27389039-27389061 GATCCCAAGCTGTAGCTTCCAGG + Intergenic
1183739291 22:39661230-39661252 GACCCCATGCTGGTGGCCCTGGG + Exonic
1184737831 22:46409558-46409580 GAGCCCCTGCTCCTGCTTCTGGG - Intronic
1203246908 22_KI270733v1_random:79303-79325 TAGCCCAGGCTGTTGCTTCCCGG + Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
950162245 3:10769195-10769217 CAGCACATGCTGTTCCTTCTGGG + Intergenic
950698501 3:14723014-14723036 GTCACCCTGCTTTTGCTTCTAGG - Intronic
953191928 3:40696020-40696042 GAGCCAATGTTGTTGTTTCTTGG - Intergenic
954983994 3:54773277-54773299 GACCCCATTTAATTGCTTCTAGG - Intronic
957086086 3:75678856-75678878 GAGCCCAGGCTGTTGCTTCCTGG - Intergenic
960976615 3:123181468-123181490 GGCCTCATGGTGTTGCTTGTAGG + Intronic
966971217 3:185047169-185047191 GGCCACATGATGTTGCTTCTTGG + Intronic
972145850 4:36024014-36024036 GATCCCATGTGGTTGCTTGTAGG - Intronic
977028315 4:91849185-91849207 ATTCCCATGCTGGTGCTTCTTGG + Intergenic
979116560 4:116831477-116831499 GACCACATACTGATGCATCTTGG - Intergenic
983780057 4:171658896-171658918 GAGCCCAGGCTGTTGCTTCCCGG + Intergenic
985090621 4:186359266-186359288 GAGCCCAGACTGTTGCTTCCCGG - Intergenic
991526221 5:67561383-67561405 GTCCCCAAGCTGTTGCCTCATGG + Intergenic
995092796 5:108198696-108198718 GACCAAATGCTGTTGCCTCTTGG - Intronic
995587264 5:113660938-113660960 GACCACATGGTTTGGCTTCTAGG + Intergenic
995671213 5:114605064-114605086 GACCCCATGCTTTTGCGTAGAGG - Intergenic
996682625 5:126244442-126244464 AACCCCATGATCTTGCTCCTGGG - Intergenic
996793318 5:127316966-127316988 TCGCCCATGCTGTTCCTTCTTGG - Intronic
997613293 5:135230005-135230027 GTCCCCATTCTGTGGCTTCGTGG + Intronic
1001197437 5:169686214-169686236 GGCCCCATACTGTTTCCTCTCGG - Intronic
1001869198 5:175135906-175135928 GACTCCCTGCTGTTACGTCTGGG - Intergenic
1004145762 6:13064658-13064680 GAGCCCAGGCTGTTGCTTCCCGG - Intronic
1005534272 6:26738835-26738857 GAGCCCAGGCTGTTGCTTCCCGG + Intergenic
1005536523 6:26762819-26762841 GAGCCCAGGCTGTTGCTTCCCGG - Intergenic
1007766993 6:44166540-44166562 GACCTCCTGCTCTTGCTTCTGGG + Intronic
1009007421 6:57805233-57805255 GAGCCCAGGCTGTTGCTTCCCGG - Intergenic
1011020872 6:82810483-82810505 GACCCCAGGAGGTTTCTTCTAGG + Intergenic
1015531752 6:134227595-134227617 GACAACATGCTTTTCCTTCTTGG - Intronic
1017979297 6:159385569-159385591 GACCCTCTGCAGTTGCTTCTGGG + Intergenic
1018576629 6:165266502-165266524 GAGCCCATGGTGTAGATTCTAGG - Intergenic
1018712911 6:166509455-166509477 CACACCCTGCTGTTCCTTCTCGG - Intronic
1019751786 7:2735212-2735234 GACAGTATGCTGATGCTTCTTGG - Intronic
1022345822 7:29513533-29513555 GACCGCATTCTGTATCTTCTGGG - Exonic
1022478393 7:30726858-30726880 GACACCAGGCTGTTGCTTCTGGG - Intronic
1022495636 7:30851281-30851303 CTCCCAATGCTGTTGCTTATTGG + Intronic
1023891274 7:44393552-44393574 AAACCCACTCTGTTGCTTCTTGG - Intronic
1023942102 7:44775811-44775833 GACCCCGAGCTGTGACTTCTGGG - Intergenic
1029626405 7:101722703-101722725 GACCCCATTCTCCTGCCTCTGGG - Intergenic
1030689409 7:112517257-112517279 AGCCCCATTCTGTGGCTTCTTGG - Intergenic
1032114888 7:129108537-129108559 GGCTCCATGCTGTGTCTTCTGGG + Intergenic
1032701695 7:134386047-134386069 GATCACTTGCTGTAGCTTCTAGG - Intergenic
1033822758 7:145153721-145153743 CACCCCATGCTGAAGATTCTGGG + Intergenic
1034189133 7:149200388-149200410 AACCCCTTGCCGTGGCTTCTGGG + Intronic
1035670297 8:1411969-1411991 GAGCCCTTGCTGTTGCCTGTAGG - Intergenic
1038506605 8:28090284-28090306 GAGCCCAGGCTGTTGCTTCCTGG + Intronic
1038506618 8:28090355-28090377 GAGCCCAGGATGTTGCTTCCCGG + Intronic
1038506631 8:28090426-28090448 GAACCCAGGCTGTTGCTTCTTGG + Intronic
1039933640 8:42019018-42019040 AACCAGATGCTGTTGCCTCTTGG - Intronic
1040761946 8:50858027-50858049 GAGCCCAGGCTGTTGCTTCTCGG - Intergenic
1040809475 8:51435612-51435634 GCCTCCATGCTGTTTCCTCTTGG - Intronic
1043567152 8:81561077-81561099 CACCAAATCCTGTTGCTTCTAGG - Intergenic
1044123737 8:88431427-88431449 GACACCATGCTGCAGCTGCTTGG - Intergenic
1050136762 9:2473528-2473550 GACCCCATGCTCGTGGGTCTTGG - Intergenic
1050367579 9:4886771-4886793 GAGCCCATGCTTTTCCTACTTGG + Intergenic
1052642924 9:31192507-31192529 ACCCCCATGCTGTATCTTCTGGG - Intergenic
1052754334 9:32525316-32525338 CACCCGATGCTGTTGCTGTTCGG - Intronic
1053011911 9:34638276-34638298 GACCCCAAGCTGTCTCTCCTCGG - Intronic
1053572429 9:39323031-39323053 GACCCGCTGCTGTTGCATCATGG + Intergenic
1053623812 9:39847561-39847583 GACCCGCTGCTGTTGCATCATGG + Intergenic
1053881056 9:42595667-42595689 GACCCGCTGCTGTTGCATCATGG - Intergenic
1053891611 9:42698651-42698673 GACCCGCTGCTGTTGCATCATGG + Intergenic
1054093990 9:60881743-60881765 GACCCGCTGCTGTTGCATCATGG + Intergenic
1054115464 9:61157663-61157685 GACCCGCTGCTGTTGCATCATGG + Intergenic
1054124716 9:61295980-61296002 GACCCGCTGCTGTTGCATCATGG - Intergenic
1054220085 9:62403138-62403160 GACCCGCTGCTGTTGCATCATGG - Intergenic
1054230630 9:62506034-62506056 GACCCGCTGCTGTTGCATCATGG + Intergenic
1054592292 9:67024879-67024901 GACCCGCTGCTGTTGCATCATGG - Intergenic
1054769721 9:69072079-69072101 GACCCAGTGCTGTTGTTCCTTGG - Intronic
1055821668 9:80272197-80272219 TATCCCATACTGTTGCTTATGGG - Intergenic
1056603483 9:88065483-88065505 GAGCCCAGGCTGTTGCTTCCTGG - Intergenic
1059387150 9:113973427-113973449 CAGCCCATGCTGTTGATTTTGGG - Intronic
1061032909 9:128097721-128097743 GACCCCAGATTGATGCTTCTGGG + Intronic
1061119587 9:128634845-128634867 GACCCTAGGCTGTTCATTCTGGG - Exonic
1203463241 Un_GL000220v1:62365-62387 TAGCCCAGGCTGTTGCTTCCCGG + Intergenic
1203492202 Un_GL000224v1:117655-117677 GAGCCCAGGCTGTTGCTTCTCGG + Intergenic
1203504825 Un_KI270741v1:59527-59549 GAGCCCAGGCTGTTGCTTCTCGG + Intergenic
1185460876 X:332341-332363 GAGCTCATGCTGCTGCTCCTGGG + Intergenic
1185980236 X:4771297-4771319 GAGCCCAGGCTGTTGCTTCCCGG - Intergenic
1185980770 X:4775230-4775252 GAGCCCAGGCTGTTGCTTCCCGG - Intergenic
1186344504 X:8677983-8678005 CACCCCAAGCTGTTCCTGCTGGG + Intronic
1187519661 X:20002347-20002369 AACCCCATGTTCTTGCTTTTAGG + Intergenic
1187533027 X:20113628-20113650 GACCCAATGCCTTTGCTACTCGG + Intronic
1189112873 X:38311811-38311833 AAGCCCATTCTGTTGCTTCTAGG - Intronic
1189412013 X:40780645-40780667 CACACCATGCAGCTGCTTCTGGG + Intergenic
1189468371 X:41295392-41295414 GAGCCCAGGCTGTTGCTTCCTGG - Intergenic
1190498724 X:51054076-51054098 AACACCACGCTGCTGCTTCTAGG + Intergenic
1191774721 X:64801513-64801535 TACACCATGCTGCTGCTGCTGGG - Intergenic
1194494701 X:94600133-94600155 GAGCCCAGGCTGTACCTTCTCGG - Intergenic
1196936433 X:120735307-120735329 GTCCCCATTCTGGTGCATCTGGG - Intergenic
1199440848 X:147866437-147866459 CACCCCATGCTGCTGCTGCAGGG - Intergenic
1202200108 Y:22337328-22337350 GAACCCATGCAGTTGCTGCCTGG - Intronic