ID: 918344547

View in Genome Browser
Species Human (GRCh38)
Location 1:183595208-183595230
Sequence CAGGAAACCCTGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 398}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918344543_918344547 21 Left 918344543 1:183595164-183595186 CCGTCAACTCTAACATTGAGTAG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG 0: 1
1: 0
2: 0
3: 40
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918344547 Original CRISPR CAGGAAACCCTGAAGGAGGC AGG Intronic
900526017 1:3129024-3129046 CAGGAAACCAGGAGGGAGTCTGG + Intronic
901081962 1:6588682-6588704 GAGGAAACCCAGCAGGAGGTTGG - Intronic
901878685 1:12181430-12181452 CAAGAACCCCTGGAGGAGACAGG + Intronic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902683128 1:18057950-18057972 CAAGAAGCCAAGAAGGAGGCTGG - Intergenic
903034623 1:20485900-20485922 GAGGAAACCCGGAGGGAGGGTGG + Exonic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907337025 1:53706515-53706537 CAGAAAATGCTGAAGGCGGCAGG - Intronic
907889970 1:58627460-58627482 CAGCAAACCCTGAGGGAGAAGGG - Intergenic
907955979 1:59228721-59228743 CTTGAAAACCTGAAGAAGGCCGG - Intergenic
908471531 1:64448787-64448809 AATGATACACTGAAGGAGGCAGG - Intergenic
908991948 1:70102275-70102297 CAGGAAACCATAGATGAGGCAGG + Intronic
910217315 1:84855406-84855428 CATGAAACCTTCCAGGAGGCTGG + Intronic
910864958 1:91779930-91779952 CACGAGAACCTGAAAGAGGCTGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911162874 1:94699276-94699298 CAGTAAACCCAGTAGGGGGCAGG + Intergenic
913040003 1:115012682-115012704 CAGGACACACTGAAGCAAGCAGG - Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
914044643 1:144080533-144080555 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
914133467 1:144880153-144880175 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
916165014 1:161958891-161958913 CAGGTAACACTGGAGGATGCAGG - Exonic
916207174 1:162326285-162326307 CAGGAAACCTTGCAGGTGACTGG + Intronic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
918052959 1:180990664-180990686 CTGGAAAGCCTGAAGGACCCTGG - Intronic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
919905928 1:202078297-202078319 CAGAATTCCCTGAATGAGGCAGG - Intergenic
922726553 1:227925553-227925575 CAGGAAGCCCTGCTGGAGCCTGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924354793 1:243161024-243161046 CAAGAATCACTGAAGGAGACTGG + Intronic
924847759 1:247790102-247790124 CCGAAAACCCTGGAGGAAGCAGG - Intergenic
1064362753 10:14680620-14680642 GAGGAATCCTTGCAGGAGGCAGG - Intronic
1064608973 10:17077191-17077213 CAGGAAACACTGAAGGTTTCAGG + Intronic
1064812246 10:19213526-19213548 CAAGATACACTAAAGGAGGCTGG - Intronic
1066393044 10:34994175-34994197 CAGGAATGACTGAAGCAGGCTGG - Intergenic
1068983322 10:63084177-63084199 CAGGACACCCTGTGGGAGGAGGG + Intergenic
1070147175 10:73783098-73783120 CAGGAAACCCTGGGAGAGTCTGG + Exonic
1070828839 10:79406532-79406554 CAGGAAGCTCTGCAGGAAGCAGG + Intronic
1072595258 10:96865915-96865937 TAGCAAACCTTCAAGGAGGCTGG - Intronic
1072681511 10:97510697-97510719 CAGGACACACTGAAGAAGTCAGG - Intronic
1072714237 10:97738628-97738650 CTGGAACCCTTGAAGGATGCAGG + Exonic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1077068085 11:653714-653736 CCGGAAACCCTGAGGGCTGCTGG - Intronic
1077107699 11:849192-849214 CAGGCAGCCCCGCAGGAGGCTGG - Intronic
1077244530 11:1529778-1529800 CAGGGCCTCCTGAAGGAGGCAGG + Intergenic
1077353492 11:2103883-2103905 TTCGAAACCCTGAAGGAGTCAGG + Intergenic
1077383306 11:2257452-2257474 CGGGGTACCCTGGAGGAGGCAGG - Intergenic
1079175714 11:18138130-18138152 CAGGAAACCCTGGAGCTGTCGGG + Exonic
1079181461 11:18197307-18197329 CAGGAAACCCTGGAGATGTCGGG + Intronic
1079261504 11:18886946-18886968 GAGGAAACCCTGAAGCTGTCGGG - Intergenic
1079263754 11:18910450-18910472 CAGGAAACCCTGGAGCTGTCGGG - Intergenic
1079275265 11:19029707-19029729 CAGGAAACCCTGAAGCTGTCGGG - Intergenic
1080426335 11:32158205-32158227 AAGGAGACCCTGATGGATGCTGG + Intergenic
1081488446 11:43548646-43548668 CAAGGAACCATGAAGGACGCTGG - Intergenic
1081634797 11:44714004-44714026 CAGGAAGCCCTGAGTGAGGTAGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083962664 11:66022967-66022989 CCGGAAGCCCTGAATGAGGAAGG + Exonic
1084475249 11:69385182-69385204 TAAGAAACCCTGGAGGAGCCTGG + Intergenic
1084564582 11:69921788-69921810 CAGGACACCCCGAGGAAGGCTGG + Intergenic
1086189281 11:84059398-84059420 GTGGAAGCCCTGAAGGAAGCAGG - Exonic
1088923141 11:114276267-114276289 CAGGAGCCCCTGCAGGAGACAGG + Intronic
1089601986 11:119622044-119622066 CAGAAAGCTCTGAAGGAGGAAGG - Intergenic
1089954953 11:122561655-122561677 CAAGAAACCCAGAAGGGTGCTGG + Intergenic
1092225492 12:6745622-6745644 CAGAGAACCCTGAAGGAGCAAGG + Intergenic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1093264551 12:16987355-16987377 CAGGAAAAGCTGATGGAGACAGG - Intergenic
1095360037 12:41326272-41326294 CAAGAAACATTGAAAGAGGCTGG - Intronic
1095497548 12:42801268-42801290 CAGGACACCTTGAAGGTGACAGG + Intergenic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1096243630 12:49972668-49972690 CAGGACCCCCTGAAGCAGGCCGG + Intronic
1097994490 12:65872698-65872720 CAGGAAAACTAGTAGGAGGCTGG - Intronic
1098217327 12:68234293-68234315 CAGGAAACAATGATGAAGGCAGG - Intergenic
1100560616 12:95745976-95745998 CATTACACCCTGAAGGAGGGAGG - Intronic
1101191042 12:102332911-102332933 CAGGACACCTTGAAGAACGCTGG + Intergenic
1101647841 12:106647589-106647611 CAGTAAACACTGCAGGAGGAAGG - Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1101871943 12:108572815-108572837 CAGGACACCCTGAGAGAGACAGG - Intergenic
1101984327 12:109433791-109433813 CAGCACATCCTGAGGGAGGCAGG + Intronic
1102208566 12:111107375-111107397 CAGGAAATCCTGAAGAAGAATGG - Intronic
1104636069 12:130438447-130438469 CAGGAGACCCGGATGGTGGCGGG + Exonic
1106081161 13:26501245-26501267 CAGAAAGCTCTGAAAGAGGCTGG - Intergenic
1106753482 13:32797820-32797842 CAGGAAAGCCTCAATGAAGCTGG + Intergenic
1107750351 13:43558465-43558487 CAGAACACTCTGAAGGAGCCAGG + Intronic
1108821478 13:54355943-54355965 CAGCAAATCCTGAATCAGGCAGG - Intergenic
1112166679 13:96927294-96927316 AAGGAAACCCTGAGGCATGCCGG - Intergenic
1112628927 13:101139307-101139329 CAGCAACCCCAGAAGGGGGCTGG - Intronic
1114054234 14:18952743-18952765 CAGCAAACCCTGGAGGTGGCTGG - Intergenic
1114108320 14:19449189-19449211 CAGCAAACCCTGGAGGTGGCTGG + Intergenic
1115556018 14:34545786-34545808 TAGGAAAACCTAAAGGAGGGGGG - Intergenic
1115557890 14:34557295-34557317 TAGGAAAACCTAAAGGAGGGGGG + Intergenic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1116890980 14:50268080-50268102 CAAGAAACCCTGATGCTGGCTGG + Intronic
1118052216 14:62041742-62041764 TGGGAAACCCTGAAGGAGAGAGG - Intronic
1119347237 14:73936033-73936055 CTAGACACCCTGAAGCAGGCTGG - Exonic
1120967959 14:90184293-90184315 CAGGAGAGCCTGAAGGATGCGGG + Exonic
1121406667 14:93723205-93723227 CTGGGAACCCTGGAGGGGGCTGG - Intronic
1121781207 14:96623705-96623727 CAGGGACCCCGGATGGAGGCAGG + Intergenic
1122104446 14:99441612-99441634 CAGGGAAGCCTGCAGCAGGCAGG + Intronic
1122209465 14:100165690-100165712 CAGCCAGCCCGGAAGGAGGCAGG - Intergenic
1122879584 14:104684210-104684232 GAGGCAACCGAGAAGGAGGCTGG + Intergenic
1123163358 14:106301673-106301695 CAGGTCACCTTGAAGGAGTCTGG - Intergenic
1123207049 14:106723852-106723874 CAGGTCACCTTGAAGGAGTCTGG - Intergenic
1202936348 14_KI270725v1_random:91540-91562 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1123680801 15:22762071-22762093 CAAACAACCTTGAAGGAGGCAGG - Intergenic
1124141311 15:27079607-27079629 CAAGAACCCCTGAAGGAGTCTGG + Intronic
1124333009 15:28836529-28836551 CAAACAACCTTGAAGGAGGCAGG - Intergenic
1124376653 15:29133011-29133033 CGGAAACCCCTGAAGGCGGCAGG - Intronic
1124666294 15:31595765-31595787 CTGGCACACCTGAAGGAGGCTGG - Intronic
1125634850 15:41178858-41178880 CAGGAAAGCATGCATGAGGCAGG + Intergenic
1125827717 15:42690370-42690392 CAAGGAACCCTGAAGGCAGCAGG + Exonic
1128756085 15:70185075-70185097 GGGGAAGCCCTGAAGGAGTCTGG + Intergenic
1128780920 15:70358155-70358177 CAGGAGACACTGAAGGAGACTGG + Intergenic
1129458558 15:75688621-75688643 GAGGCCACCCTGGAGGAGGCAGG - Exonic
1129725235 15:77898251-77898273 GAGGCCACCCTGGAGGAGGCAGG + Intergenic
1130085623 15:80776799-80776821 CAGGAAAACCTGGAGTAGACGGG - Intergenic
1130273284 15:82463457-82463479 GAGGCCACCCTGGAGGAGGCAGG + Intergenic
1130465635 15:84190828-84190850 GAGGCCACCCTGGAGGAGGCAGG + Intergenic
1130487056 15:84403992-84404014 GAGGCCACCCTGGAGGAGGCAGG - Intergenic
1130498630 15:84482708-84482730 GAGGCCACCCTGGAGGAGGCAGG - Intergenic
1130587925 15:85195423-85195445 GAGGCCACCCTGGAGGAGGCAGG + Intergenic
1132645482 16:997493-997515 CTGGACACCGTGGAGGAGGCGGG - Intergenic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1133000517 16:2849018-2849040 CAAGAAGCCTGGAAGGAGGCAGG + Intergenic
1133127128 16:3654360-3654382 CAGGCAACTCTGCAGGAGGCTGG - Intronic
1133136650 16:3717181-3717203 ATGGGAGCCCTGAAGGAGGCTGG - Intronic
1133313097 16:4863831-4863853 CACCAAGCCCTGAAGAAGGCAGG - Intronic
1133941171 16:10310319-10310341 CAGGAAACCCTGACAGAGACTGG + Intergenic
1134444632 16:14321549-14321571 CAGAAGGCCCTGAGGGAGGCAGG + Intergenic
1134462600 16:14442551-14442573 CTAGAAGCCCTGAAGGAGACTGG + Intronic
1135632613 16:24047924-24047946 CAGGTAGCCCTGGAGAAGGCAGG + Intronic
1135973874 16:27092797-27092819 CAGGTAACCCAGAGGAAGGCAGG + Intergenic
1136192280 16:28623597-28623619 CAGGAGCTCCTGGAGGAGGCAGG - Intronic
1136771951 16:32847856-32847878 CAGGTCACCTTGAAGGAGTCTGG + Intergenic
1137556759 16:49475066-49475088 CTGGAAACCGTGGGGGAGGCAGG + Intergenic
1138343528 16:56306395-56306417 GAGGAAACCCTGAAGGAGCGGGG - Intronic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1141436136 16:84000949-84000971 CAGTAAACCCTGGTGGAGGCAGG + Intronic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1203074372 16_KI270728v1_random:1109945-1109967 CAGGTCACCTTGAAGGAGTCTGG + Intergenic
1142527018 17:550224-550246 AAGGAAACCCTGGAGGAGTTAGG + Intronic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1143832241 17:9661786-9661808 AAGAAAACCCTGAAAGAGGCTGG - Intronic
1143995238 17:11000978-11001000 CAGAAAACTATGAAGAAGGCAGG - Intergenic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1144754664 17:17671810-17671832 CAGGACAACCTGAAGAAGGTGGG + Intergenic
1146647255 17:34583475-34583497 CAGGCAGCCCTGGAGGAGGAGGG - Intronic
1147844263 17:43393850-43393872 CAGGGAACACTGAGGCAGGCAGG - Intergenic
1148330876 17:46813275-46813297 AATGAAGCCCAGAAGGAGGCAGG + Intronic
1148782824 17:50130996-50131018 CAGGAAGCCCTGGAGCAGGTGGG + Intergenic
1149379045 17:56074424-56074446 CAGGAAACCATGAGGGGGCCTGG - Intergenic
1149559206 17:57596102-57596124 CTGGAAACGCTGTCGGAGGCGGG + Intronic
1149782677 17:59410365-59410387 CAGGAATCCCTTCAGGGGGCTGG + Intergenic
1150309839 17:64119064-64119086 CAGGATACTGTGAAGGAGCCTGG + Intronic
1152070075 17:78129973-78129995 CTGGAAACCAGGAAGGAGGTGGG + Intronic
1152072703 17:78141895-78141917 CAGGGAGCCATGAAGCAGGCTGG - Exonic
1152659156 17:81534504-81534526 CAGGAACCCCAGATGGAGCCCGG + Intronic
1152809708 17:82375666-82375688 CTGGAGACCCTCAGGGAGGCGGG - Intergenic
1153526686 18:6001496-6001518 CAGCAAACCCTGGGGAAGGCGGG + Intronic
1153578792 18:6550371-6550393 AATGCAAGCCTGAAGGAGGCTGG - Intronic
1153932203 18:9887857-9887879 GAGGCATCACTGAAGGAGGCCGG + Exonic
1154303238 18:13213111-13213133 CATCAAACACTGACGGAGGCAGG - Intergenic
1154489910 18:14913352-14913374 CAAGCTACCCAGAAGGAGGCTGG + Intergenic
1155047209 18:22113531-22113553 CAGGAAACACTGCAGGAATCCGG - Intergenic
1155884381 18:31189412-31189434 CAGGAAACCCTGTGACAGGCAGG - Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157103435 18:44750674-44750696 TAGGAAACCCGGAAGAAGTCTGG - Intronic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159959940 18:74547522-74547544 CAGGCATCCCTAAAGGAGGATGG - Intronic
1160537743 18:79604012-79604034 CAGGAAAGCCTCAGGGAGCCGGG - Intergenic
1160556727 18:79730370-79730392 CAGGAAACCAGGAGGGAGACGGG - Intronic
1161210611 19:3063299-3063321 CAGGAAGGCCGGAGGGAGGCAGG + Intergenic
1162510728 19:11116630-11116652 CAGAAAAACTTCAAGGAGGCTGG - Intronic
1162669723 19:12245882-12245904 CAGGAAAACAGGCAGGAGGCCGG - Intronic
1163182625 19:15615181-15615203 TAGGAAACACTTCAGGAGGCTGG - Intergenic
1164622836 19:29707521-29707543 AAGGAAACCAGGGAGGAGGCTGG - Intronic
1164639382 19:29812702-29812724 CGGGACACCATGAAGGAGGACGG + Exonic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1165120627 19:33556389-33556411 CTGGAAACCCTAAAAGAAGCAGG + Intergenic
1166547552 19:43642376-43642398 CAGGGTACCCTGAAGTAGGATGG - Intergenic
1166993357 19:46706338-46706360 CTGGAAAGCCTGGAGCAGGCGGG - Intronic
1167247606 19:48383150-48383172 CCTGAAACCCGGCAGGAGGCGGG + Exonic
1167410883 19:49343103-49343125 CATTAAACCCTCAAAGAGGCTGG + Intronic
1167609845 19:50501776-50501798 CAGGAGGCCCGGGAGGAGGCTGG - Intergenic
1167674896 19:50877889-50877911 CAGGAGACTGTGAGGGAGGCTGG - Intronic
1167803329 19:51760916-51760938 CATGAAACTCTGAAGAAGGAAGG + Intronic
1168394644 19:56037834-56037856 CATGAAAACCTGAGGGAGGGAGG + Intronic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
1202684201 1_KI270712v1_random:33952-33974 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
925906116 2:8540483-8540505 CAGAAAACCCTGCATGAGGCAGG - Intergenic
926281018 2:11446621-11446643 CAGAAAACCCTGAAGATGCCTGG + Intronic
926581326 2:14634466-14634488 CAGGACAGCCTGTATGAGGCGGG + Exonic
926676946 2:15632917-15632939 AAGGCAATCCCGAAGGAGGCAGG - Intergenic
927221042 2:20710026-20710048 CAGTTAACTCTGAAGTAGGCAGG + Intronic
927553530 2:24017776-24017798 GAAGGAACCCAGAAGGAGGCAGG - Intronic
927640599 2:24843121-24843143 CAGAAATCCCTGAAGGACCCTGG - Intronic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
928219949 2:29395351-29395373 CAGAAAAGCCTGGAGGAGCCTGG + Intronic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
932604577 2:73156651-73156673 CAGGAGACCAGGCAGGAGGCTGG - Intronic
932859434 2:75274554-75274576 CAGGAAACACTGGGGGAGCCAGG - Intergenic
933326545 2:80844936-80844958 CAGGAAACCAGGGAGGAGGCAGG + Intergenic
933350652 2:81148193-81148215 CAGGAGAGACTGGAGGAGGCAGG + Intergenic
934129968 2:88938576-88938598 CAGGAAACCCTGGAGTATCCAGG + Intergenic
934134705 2:88984378-88984400 CAGGAAACCCTGGAGTATCCAGG + Intergenic
934145440 2:89088978-89089000 CAGGAAACCCTGGAGTATCCAGG + Intergenic
934223818 2:90111566-90111588 CAGGAAACCCTGGAGTATCCAGG - Intergenic
934235602 2:90229376-90229398 CAGGAAACCCTGGAGTATCCAGG - Intergenic
934247518 2:90320900-90320922 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
934261806 2:91481701-91481723 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
934730408 2:96652916-96652938 CAGAAAACCCTCCAGGAGGCTGG + Intergenic
934730454 2:96653213-96653235 TAGGAAACCCTCTAGGAGCCCGG + Intergenic
935762722 2:106336299-106336321 CAGGAAACACTCAGGGAGACAGG - Intergenic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
938472237 2:131575507-131575529 CAGCAAACCCTAGAGGGGGCTGG - Intergenic
938655582 2:133429482-133429504 CAGTAGACCTTGAAGGAGGGAGG - Intronic
938855703 2:135308243-135308265 CAGGAAACCCTGTTGGACTCAGG - Intronic
938967605 2:136402246-136402268 CAGGAATCCCAGGAGGAGGTTGG - Intergenic
940961312 2:159789296-159789318 CATGAAAAACTGAAGTAGGCTGG - Intronic
942579498 2:177402322-177402344 CAGGAAAGCCACAAGGAGACTGG + Intronic
946007014 2:216533837-216533859 CAGGAAACCCTGAATCAAGGGGG + Intronic
946261336 2:218493779-218493801 CAGGCAACCCAGAAGAAAGCAGG - Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946517708 2:220431164-220431186 CAGCAAACCCAGAATAAGGCAGG - Intergenic
947909543 2:233792101-233792123 GTGGGACCCCTGAAGGAGGCTGG + Intronic
947983520 2:234429379-234429401 CAGGAAACCATTGAGGAAGCAGG - Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
948336202 2:237209217-237209239 CAGAACACTCTGGAGGAGGCAGG - Intergenic
948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG + Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
1169130988 20:3166364-3166386 CAGGAAACGCAGGAGGGGGCTGG + Intronic
1169653725 20:7898290-7898312 CAGGAAATCCTAGAGGAGGTAGG - Intronic
1170105829 20:12753716-12753738 CAGGAAACACTGAAGCATGAGGG - Intergenic
1170465120 20:16615768-16615790 CAGGAAACACTGAAGGGGGTTGG - Intergenic
1171387519 20:24780215-24780237 CAGGAAGCCCTGGAGGGGGGTGG - Intergenic
1172132622 20:32665489-32665511 CCGGAAACACTGTAGGAGGTGGG + Intergenic
1172620616 20:36316177-36316199 CAGGAAATCAGGTAGGAGGCGGG - Intronic
1173073364 20:39791987-39792009 CAGGATACCCTGGATCAGGCTGG + Intergenic
1173648754 20:44650167-44650189 CAGTAAGACGTGAAGGAGGCAGG + Intronic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1175327029 20:58137033-58137055 CAAGAAACCCTAAAGGAGGGAGG + Intergenic
1175813697 20:61872712-61872734 CAGGAACACCGGAAGGTGGCGGG + Intronic
1176286359 21:5021265-5021287 CAGGAAGCCCTGAAGCCGGGCGG - Intergenic
1176587149 21:8598059-8598081 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1178426463 21:32482807-32482829 CCCCAAACCCTGAAGGGGGCAGG - Intronic
1178433135 21:32534179-32534201 AAGGAAACCCGGGAGGAGGTGGG + Intergenic
1179028675 21:37701285-37701307 AAGGGAACCTTGAAGGAGACAGG + Intronic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179730410 21:43364339-43364361 CAGGAAACCCTGGGGAAGGTGGG + Intergenic
1179870822 21:44242210-44242232 CAGGAAGCCCTGAAGCCGGGCGG + Intergenic
1179928355 21:44550713-44550735 GAGGAAAAGCTGCAGGAGGCTGG + Exonic
1180269980 22:10575056-10575078 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1180472707 22:15675122-15675144 CAGCAAACCCTGGAGGTGGCTGG - Intergenic
1180587927 22:16909807-16909829 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1181408738 22:22703343-22703365 CAGCATCTCCTGAAGGAGGCTGG - Intergenic
1181674261 22:24441581-24441603 CAGGAGACCCTGAGGGCAGCCGG + Exonic
1182235455 22:28872297-28872319 CATGAGACCGTGTAGGAGGCTGG + Intergenic
1182647320 22:31820821-31820843 CAGGGAACCCTGATGAAGGAGGG - Intronic
1183160484 22:36110025-36110047 CAGAAAACACTGACTGAGGCCGG - Intergenic
1183426831 22:37744560-37744582 CAGAAAAGCCTGGAGGAGGCTGG + Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184644052 22:45886517-45886539 CAAGACACCCTGAATCAGGCAGG - Intergenic
1185384870 22:50527007-50527029 TAGGAAGCCGTGAAGGAGGGAGG + Intronic
949897946 3:8784098-8784120 CAAGAGACCCTGAAGGAGCTTGG - Intronic
950143956 3:10634681-10634703 CAGGTCACCCTGCTGGAGGCAGG - Intronic
950646820 3:14382316-14382338 CAGGAGACCATGGAGGAGGCTGG + Intergenic
950919874 3:16683661-16683683 CGGGAAAACCTGAAGTAGGAAGG - Intergenic
952406857 3:33012913-33012935 GAGGAAACCATCTAGGAGGCTGG - Intronic
952412270 3:33060158-33060180 CATGAAACCTTGTGGGAGGCAGG - Intronic
952945768 3:38477186-38477208 CAGGCCACCCTGAGGGAGGGAGG - Intronic
953215841 3:40917350-40917372 CAGGAAATCCTGATGGAGAATGG - Intergenic
954065762 3:48104661-48104683 CATAAAACCCCGAGGGAGGCTGG - Intergenic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954840841 3:53509822-53509844 CAGGAATCCCTGACGGACACAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955717687 3:61847614-61847636 CTGGAATCCCCGAAGGAGGGAGG - Intronic
957181571 3:76885835-76885857 GAGGAAAACATGAAGGAGGCAGG - Intronic
957418900 3:79942799-79942821 CAGAAAATACTGAAGGAGGTAGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960569565 3:119172558-119172580 CAGGAAACTCTGGAGGAAGATGG - Intronic
962290879 3:134135385-134135407 CCGGAAGCCTGGAAGGAGGCTGG - Intronic
962321779 3:134396569-134396591 GAGGTTCCCCTGAAGGAGGCCGG - Intergenic
962808212 3:138941509-138941531 CAGGAAACCCTGGCAAAGGCTGG + Intergenic
962947131 3:140182456-140182478 CAGGACAGACTGAAGAAGGCTGG - Intronic
963001727 3:140687973-140687995 AAGGAAGCCCTGAAGGAGACTGG + Exonic
965680595 3:171247478-171247500 CGGGAAAACATGAAGAAGGCAGG + Intronic
969284765 4:6196280-6196302 TAGGAAGCCCTGTAGGAGGTGGG - Intronic
969315635 4:6380032-6380054 CAGGAAACCAAGGAGGAGGGAGG - Intronic
969576556 4:8039346-8039368 CAGGGAAGCCTGAGGAAGGCTGG - Intronic
969596482 4:8151984-8152006 CAGGAACCCCCATAGGAGGCGGG + Intronic
969728639 4:8940273-8940295 CTGGAAACCTTGTAGGAGGAAGG + Intergenic
970137079 4:12936784-12936806 CAGGAAACTGTGAAAGAGCCCGG - Intergenic
971990193 4:33882490-33882512 CAAGAAACCCTGAAAGAGGATGG - Intergenic
973936175 4:55849184-55849206 CTTGAACCCCTGAAGGAGGAAGG - Intergenic
975176292 4:71293265-71293287 CATAAAATCCAGAAGGAGGCTGG + Intronic
977672648 4:99714205-99714227 GAAGAGAACCTGAAGGAGGCAGG + Intergenic
978463591 4:108984471-108984493 CAGGAGACCATGAGGGGGGCGGG + Intronic
979216342 4:118169495-118169517 CAGAAAAACCTGAAGTGGGCCGG + Intronic
979247009 4:118518632-118518654 CAAGAATCACTGAAGGAGACTGG - Intergenic
983454291 4:167942731-167942753 CAGTAAACCCTGCAGGATACAGG - Intergenic
984822396 4:183893287-183893309 GTGGAAACCCTGCAGTAGGCTGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
986391793 5:7294042-7294064 CAAACAACCTTGAAGGAGGCAGG - Intergenic
986743860 5:10727354-10727376 CAGCACACCCTGATGAAGGCAGG + Intronic
986982605 5:13466526-13466548 CAATAAACCCTGAAGGAGCAGGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987067501 5:14303817-14303839 TAGGAAAGGCTTAAGGAGGCAGG - Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987802272 5:22714416-22714438 CAGTAATCGCTGAAAGAGGCTGG - Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989090156 5:37722048-37722070 CAGGAAGCTCTGAAGGAAGATGG - Intronic
989719569 5:44508563-44508585 GAGGAAACCCTGCAGGAGAGTGG - Intergenic
990028923 5:51231771-51231793 GAGGCAACCCAGAAGGAGTCTGG - Intergenic
990477485 5:56175253-56175275 CAGGACACCCTCAATGGGGCTGG + Intronic
990743177 5:58933197-58933219 CAGGAGATTCTGCAGGAGGCCGG + Intergenic
990776799 5:59312844-59312866 TAGGAGACCCTGGAGGGGGCTGG - Intronic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
993076503 5:83238931-83238953 CAGGCAGCTCTGAAGTAGGCTGG + Intronic
993358646 5:86946015-86946037 AAGGAAGCCCTGAAGGAAGCAGG + Intergenic
994900196 5:105761071-105761093 CTGAAAACCCTGGAGGACGCAGG - Intergenic
995539348 5:113169277-113169299 CAAGAAACCCAGAAGGAGAAAGG + Intronic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996397386 5:123026896-123026918 TAGAAAACCCAGAAGTAGGCTGG + Intronic
996469686 5:123845253-123845275 TAGGAAACCCAGAATCAGGCTGG - Intergenic
997207670 5:132059571-132059593 CAGGAAACCCAGAAGGGCGGGGG - Intergenic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
999127648 5:149258277-149258299 CAGGTGGCGCTGAAGGAGGCAGG - Exonic
999203203 5:149831041-149831063 CAGAAAACCCTAAACTAGGCTGG - Intronic
999310532 5:150548927-150548949 CAGAAAGCCCTGAGGCAGGCAGG + Intronic
1001839880 5:174866103-174866125 CAGCAAACCCTGAGGAAGGAAGG - Intergenic
1001875261 5:175194824-175194846 CAGGCAGCCCAGAAGGAGGGAGG + Intergenic
1002294592 5:178223319-178223341 CAGGCAAATCTGCAGGAGGCAGG - Intronic
1002356166 5:178630791-178630813 CAGGAAACACTGGAGGCAGCTGG - Intergenic
1002671834 5:180873723-180873745 CAGGAGGCCCTAAAGGCGGCTGG + Intergenic
1002802154 6:533771-533793 CAGGTCACCCTGCAGGGGGCTGG + Intronic
1002847227 6:957670-957692 CAGGATAGGCTGAAGGGGGCAGG - Intergenic
1003458335 6:6305652-6305674 AATGAAACTCTGTAGGAGGCAGG + Intronic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1005419115 6:25630955-25630977 GAGGAAATGCTGGAGGAGGCTGG - Intergenic
1006987425 6:38185166-38185188 CAGCCAGCCCTGAAGGAGGAGGG - Intronic
1007184553 6:39957980-39958002 CAGGAAACCCTAAAAGGGTCTGG - Intergenic
1007589442 6:43012559-43012581 CAGGAACCCCTGGCGCAGGCAGG + Exonic
1011013175 6:82724829-82724851 CTGGACAACCTCAAGGAGGCGGG + Intergenic
1011246256 6:85324194-85324216 CAGGAGACCCTTTAGGTGGCTGG + Intergenic
1012523651 6:100151043-100151065 GAGGAAAACCTGGAGGATGCTGG + Intergenic
1012745627 6:103083518-103083540 CAGAAAAACTTAAAGGAGGCGGG - Intergenic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013768145 6:113597047-113597069 CAGGCAGGCCGGAAGGAGGCTGG + Intergenic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1014973081 6:127842970-127842992 CAGGAAACTCTTAAGTAGCCAGG - Intronic
1015710390 6:136132855-136132877 CAGGACACTCTTAAGGAAGCAGG - Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019510837 7:1416532-1416554 GAGGAAACTGTGCAGGAGGCAGG + Intergenic
1020101777 7:5397828-5397850 CATGAAATCCACAAGGAGGCTGG - Intronic
1020487802 7:8740140-8740162 TATGAAACCCTGAAGGAGAAAGG - Intronic
1020907677 7:14084653-14084675 AAGGAAAACCAGAAGGAGACAGG - Intergenic
1022505676 7:30907583-30907605 CAGAGAACCCTGATGGAGGGTGG - Intergenic
1022505684 7:30907614-30907636 CAGGAAAGCCTGAATGATTCTGG + Intergenic
1023280514 7:38564588-38564610 CAGGAGACCCTCAAAGATGCTGG + Intronic
1023623615 7:42095902-42095924 GAGGAAACCTGGAGGGAGGCTGG + Intronic
1024307923 7:47943778-47943800 CAGGAAGCCCTGGAGGCAGCAGG - Intronic
1024700948 7:51903659-51903681 CAGGAAAGCCTGTAGAAAGCAGG + Intergenic
1027610967 7:80360127-80360149 GAGGAAAAGCTGAAGGATGCTGG - Intergenic
1029283064 7:99449117-99449139 CAGGGAGCCCGGCAGGAGGCTGG + Intronic
1029367379 7:100125335-100125357 CAGCAAACCGTGAAGGAGAATGG + Exonic
1029656239 7:101926627-101926649 CAGGACCCCTTGAAGTAGGCAGG - Intronic
1029993737 7:104986110-104986132 CAGGATACCCTGAAGGCAGTAGG + Intergenic
1030829236 7:114200462-114200484 CAGGAAACACTGAAAGAAGAAGG + Intronic
1031198137 7:118642722-118642744 CAGGAACCATTGAAGGAGACAGG + Intergenic
1032229198 7:130059730-130059752 CAGGAAACCCTGAGGCTGGATGG - Intergenic
1033649445 7:143329688-143329710 CAGGAAACCTTGAACTAGGCAGG - Intronic
1034553367 7:151834924-151834946 CAGGAAACCCCAAAGATGGCCGG - Intronic
1035253901 7:157614084-157614106 CAGGGAACCATGAAAGAGGTGGG + Exonic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035330636 7:158094850-158094872 CAGGAGACCCTGAGGGATGGTGG - Intronic
1036037045 8:5031060-5031082 CAGGAAGACCTGAAGGAGAGGGG - Intergenic
1038048661 8:23789109-23789131 CAGGAGAACCTGAACAAGGCTGG + Intergenic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039566827 8:38557932-38557954 TAGGAATCCCTCCAGGAGGCAGG - Intergenic
1040412296 8:47166926-47166948 CAGCAAACTCTGGAGGTGGCTGG + Intergenic
1040800891 8:51338564-51338586 CAGAAAACACTGTAGGAGGATGG - Intronic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1040944786 8:52873336-52873358 CAGGATACCTTGAAGCAGGGAGG + Intergenic
1041768573 8:61447467-61447489 CAAGTAACCCAGAAGAAGGCAGG - Intronic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1041963415 8:63646866-63646888 CAGGAAGCCATGAAGGAGCCCGG + Intergenic
1043266802 8:78276961-78276983 CAGTAATACCTGAAGGTGGCTGG - Intergenic
1043566303 8:81552355-81552377 CAGGAAACACTTAAGGAAGAAGG + Intergenic
1043782104 8:84348964-84348986 CAGGCAACCCTGAAACAGGCTGG + Intronic
1044547491 8:93476039-93476061 GAGGAAGCCCTGAATGAGGTGGG - Intergenic
1045869559 8:106909162-106909184 CAGGAAACCCTGAAGGCTTCAGG - Intergenic
1046771266 8:118118825-118118847 CTAGAAACCCTGAACCAGGCCGG - Intergenic
1047039822 8:120980588-120980610 TAGGAAGGGCTGAAGGAGGCAGG - Intergenic
1047339379 8:123966084-123966106 CAGGAAGCACTGGGGGAGGCTGG - Intronic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1049062420 8:140286549-140286571 CAGGAAGCACTGAGGGAGGGAGG + Intronic
1049322300 8:142003016-142003038 GAAGAAACCCTGCTGGAGGCTGG + Intergenic
1050317193 9:4414561-4414583 CAGGCAATCCTGAAGCAGGCAGG - Intergenic
1050922882 9:11228471-11228493 CAGGAAAACTTGAAGCAGGGAGG + Intergenic
1052584951 9:30415000-30415022 CAGCACATCCTGAAGGGGGCTGG - Intergenic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053696841 9:40647385-40647407 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054308092 9:63446618-63446640 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054406825 9:64770609-64770631 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054440450 9:65256075-65256097 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054489957 9:65765849-65765871 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1057174367 9:92985221-92985243 TAGGGAAACCTGGAGGAGGCTGG + Intronic
1057799159 9:98179447-98179469 GAGGACAGCCTGGAGGAGGCAGG - Intronic
1059215451 9:112557250-112557272 CAAGAAACACTGAATGGGGCTGG - Intronic
1059434075 9:114266031-114266053 CAGGAACCCCATGAGGAGGCTGG + Intronic
1061211813 9:129198084-129198106 CAGACGACCCTGAGGGAGGCAGG + Intergenic
1062037422 9:134388997-134389019 GAGGCCACCCTGGAGGAGGCAGG - Intronic
1062260439 9:135660088-135660110 CCACAGACCCTGAAGGAGGCTGG - Intergenic
1062555686 9:137112575-137112597 CCAGAAACCCTGGGGGAGGCAGG - Intronic
1202779293 9_KI270717v1_random:21044-21066 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1203617107 Un_KI270749v1:75774-75796 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1188092323 X:25978288-25978310 CTGGAATACCTGAAGGAGACAGG + Intergenic
1188182902 X:27077218-27077240 AAGGAAACCATGAAGGATGAGGG - Intergenic
1189170572 X:38905594-38905616 CTGGAAAGCCTAAAGGATGCTGG - Intergenic
1190040616 X:47068554-47068576 TAGGAAAACATGAAGGAAGCAGG - Intergenic
1190244102 X:48679317-48679339 CAAAAAAACCTGAAGCAGGCTGG - Intronic
1190832464 X:54071490-54071512 CATGAATCCCTGAAGGAGAGAGG - Exonic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1196117520 X:112013628-112013650 CAGGATACAATGAAGGAAGCAGG - Intronic
1197870543 X:131058819-131058841 CCAGGGACCCTGAAGGAGGCGGG + Intronic
1199499943 X:148498181-148498203 CAGGCAACACTGAAGGGGCCAGG - Intergenic
1199601997 X:149546539-149546561 CAGGAAACGCTGGGAGAGGCAGG - Intronic
1199648391 X:149932945-149932967 CAGGAAACGCTGGGAGAGGCAGG + Intronic
1199810398 X:151343298-151343320 CAGGAAACCCTGGAGTAAGTTGG - Intergenic
1200114173 X:153762880-153762902 CAGGCAGCCTTGAAGGAGCCAGG - Intergenic
1200249085 X:154542627-154542649 CAGGACACCCTGGGGCAGGCTGG - Intronic
1200274118 X:154715918-154715940 CAAAACACCCTCAAGGAGGCAGG + Intronic
1201194569 Y:11479325-11479347 CAGGACAGCCCGAAGGAGGGGGG + Intergenic