ID: 918350805

View in Genome Browser
Species Human (GRCh38)
Location 1:183653786-183653808
Sequence GAACAAATCTTGTCTTAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918350805_918350810 13 Left 918350805 1:183653786-183653808 CCAGTTTAAGACAAGATTTGTTC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 918350810 1:183653822-183653844 AGCCCCTTCTCTGTGGCTAACGG 0: 1
1: 0
2: 3
3: 17
4: 224
918350805_918350809 6 Left 918350805 1:183653786-183653808 CCAGTTTAAGACAAGATTTGTTC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 918350809 1:183653815-183653837 CGGTTGTAGCCCCTTCTCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918350805 Original CRISPR GAACAAATCTTGTCTTAAAC TGG (reversed) Intronic
901094355 1:6666348-6666370 AAACAAATGCTGGCTTAAACTGG - Intronic
908121367 1:60989243-60989265 GAACTATTCTTTTTTTAAACAGG - Intronic
910002869 1:82359146-82359168 AAATAAATCTTGTCATAAAATGG - Intergenic
912033683 1:105283479-105283501 TAACTAATCTAGTCTTCAACTGG - Intergenic
916887032 1:169079643-169079665 AAACAAATATTGTTTTAAAGGGG + Intergenic
918350805 1:183653786-183653808 GAACAAATCTTGTCTTAAACTGG - Intronic
918513960 1:185342013-185342035 GAACAAAGTTTGTCTTATGCAGG + Intergenic
918771202 1:188562606-188562628 GAACAAATCTTGGCACAAATAGG + Intergenic
921240452 1:213175765-213175787 TTACAAATCATCTCTTAAACAGG + Intronic
923584356 1:235253028-235253050 GAAAACATCTTGTATAAAACAGG + Intronic
923909072 1:238419200-238419222 GTACAAATCTTGTGTTATACAGG - Intergenic
1066339884 10:34521286-34521308 GAAATAATTTTGTGTTAAACTGG + Intronic
1066680734 10:37935356-37935378 GAACAAGTCTGGTCTTCACCCGG - Intergenic
1067197319 10:44133216-44133238 GGACAAATCTTGTCTCCAAAGGG + Intergenic
1068012617 10:51472891-51472913 GTAAAAATCATGTATTAAACTGG - Intronic
1069462280 10:68606835-68606857 GAACTCATTTTGTCATAAACTGG + Intronic
1071160155 10:82735949-82735971 ACACAAATCTTGCCTTAACCAGG - Intronic
1072269183 10:93758674-93758696 GAACAAACCTTATGTTAATCCGG - Intronic
1073230798 10:101967969-101967991 GAACAAATCCTTTCTTTAAACGG + Intronic
1073620748 10:105045676-105045698 GAACAAACCTTGGCTTAAGTGGG + Intronic
1082226997 11:49720012-49720034 GAATAAATATTATCATAAACAGG + Intergenic
1084372729 11:68754874-68754896 AAACAAATCTTGTAGTAGACTGG + Exonic
1086159182 11:83702170-83702192 TAACATATCTTCTCTTAAACAGG + Intronic
1088124491 11:106407387-106407409 GAACAAATGTTCTATTAACCAGG + Intergenic
1092419046 12:8315068-8315090 GAACCAATCTTTTCTTTAAGAGG + Intergenic
1092947367 12:13469296-13469318 TAACACATCTTGTCTTAGAGAGG - Intergenic
1094119305 12:26952369-26952391 GAACCAATATTGTCTGATACTGG - Intronic
1096456397 12:51790841-51790863 GACCAAATCCTATCTTGAACTGG - Intronic
1097982729 12:65751147-65751169 CAACAAATCTGGGCTTATACAGG - Intergenic
1099525348 12:83711552-83711574 GAACAAAGATTATCTGAAACTGG - Intergenic
1101539241 12:105650049-105650071 CAACAAATCCTTTCTTAAAAGGG - Intergenic
1102862160 12:116345321-116345343 AAACAAATCCTGTCTTACTCAGG + Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1107951722 13:45467980-45468002 GAACTAGTCTTATCTTAAAAAGG + Intronic
1108957425 13:56177809-56177831 GCACAAACGTTGTCTTTAACAGG + Intergenic
1110425881 13:75366156-75366178 GTAGAAATCTTGCCTTAAATTGG - Intronic
1113683232 13:112259720-112259742 ACACTAATCTTGTCTTAAGCTGG + Intergenic
1114973208 14:28060464-28060486 GATCAAATCTTGTCTGCAAATGG + Intergenic
1118102006 14:62617072-62617094 AAAGAAGTCTTGCCTTAAACAGG + Intergenic
1118469603 14:66063053-66063075 GAAGAAAGCTTATCTGAAACTGG + Intergenic
1118642193 14:67803330-67803352 GAAGAAGACTTGTCTGAAACGGG - Intronic
1126524956 15:49643162-49643184 GAAAATATCTTGTTTCAAACTGG + Intronic
1127517109 15:59706623-59706645 CAACAATTGTTGTTTTAAACAGG - Intergenic
1130008110 15:80122344-80122366 GAACATATCTTATCATGAACTGG - Intronic
1131756253 15:95565684-95565706 GAACAAATCACTTCTAAAACAGG + Intergenic
1133358508 16:5155089-5155111 GAACCAATCTTTTCTTTAAGAGG + Intergenic
1137363309 16:47839954-47839976 AAATAATTCTTGTCTTAAAATGG + Intergenic
1138323098 16:56136096-56136118 GAACCAAGCTTGTCTTTGACTGG + Intergenic
1139830160 16:69791061-69791083 GAACTAATATGGTTTTAAACTGG + Intronic
1141138807 16:81483928-81483950 CAACATATTTTGTCATAAACTGG + Intronic
1144607117 17:16676533-16676555 AAACAAAACTTGTATTAAATTGG + Intergenic
1150137839 17:62705257-62705279 GAACAAATCTTATCTCATGCCGG + Intronic
1150938976 17:69669638-69669660 GAACACATTTTGTGTTAAATTGG + Intergenic
1151252824 17:72850556-72850578 CAACATTGCTTGTCTTAAACAGG - Intronic
1151269165 17:72979733-72979755 AAACAAATCTTGCCTATAACAGG + Intronic
1155980362 18:32173470-32173492 GTTCAAATTTTCTCTTAAACTGG + Intronic
1162277606 19:9669667-9669689 GCACAAAACCTGTCTGAAACTGG + Intronic
1167393162 19:49210410-49210432 GAACAGAGCTTGGCTTAAAAAGG + Intronic
926325444 2:11781504-11781526 GAATAAATCTTTTCTGTAACTGG + Intronic
926452872 2:13027054-13027076 GAACAAATTCTGTATTAATCTGG + Intergenic
926637610 2:15199703-15199725 GAAAAAATCAAGTCTTAAAAAGG - Intronic
928029099 2:27763831-27763853 GGACCAATCTTGTCTTGGACAGG + Intergenic
928267380 2:29823172-29823194 GAGCAAATCATGTCTTACATGGG - Intronic
928857042 2:35814527-35814549 AAATAATTCTTGTCATAAACAGG + Intergenic
931013391 2:57945193-57945215 GAAAAAATCTTGTATTAAGTTGG + Intronic
933375523 2:81475637-81475659 TAACAAATCATGCCTTAAACAGG - Intergenic
935273007 2:101451160-101451182 GAAAAAATTTTGTCTGAAGCCGG - Intronic
938034550 2:128025838-128025860 GAACAGATCTTGTCTTTTAGGGG - Intronic
938753599 2:134359600-134359622 AAACAAATCTCATCATAAACGGG - Intronic
939038436 2:137160447-137160469 AAACAAATATTGTCTTAAGCAGG - Intronic
939305014 2:140400551-140400573 GCATAAATCTTGTCTCAAATTGG - Intronic
941413926 2:165195105-165195127 TAAAAAATTTTGTTTTAAACAGG + Intronic
942291682 2:174478715-174478737 GAACAAATGCAGTCTTAAAAAGG + Intronic
942325578 2:174774108-174774130 TAACTACTATTGTCTTAAACAGG - Intergenic
943947381 2:194085163-194085185 GAAACAATATTTTCTTAAACTGG + Intergenic
947233841 2:227919800-227919822 GAACAAATCTGATCTCAGACAGG - Intronic
1169968079 20:11239115-11239137 GAGCAAGTCCTGTCTTACACGGG - Intergenic
1178180957 21:30160812-30160834 GAAAAAATCTTCTCTTACAGAGG - Intergenic
1180859841 22:19071683-19071705 GAATAAATCTTGAATTAAAAGGG + Intronic
949416507 3:3820655-3820677 GAACAAAGCCTGTCTGAAACAGG - Intronic
953895683 3:46798138-46798160 GTACAATTCTTTTCCTAAACTGG - Intronic
955714293 3:61812463-61812485 TGACAAATCTGGGCTTAAACTGG - Intronic
958874338 3:99598506-99598528 GAACAAATGATGTTTTAAACAGG + Intergenic
962962615 3:140325007-140325029 AAACAAATCTTCTCTTAATAAGG - Intronic
963612436 3:147487279-147487301 AAACCTATGTTGTCTTAAACTGG - Intronic
965249219 3:166320349-166320371 GAACATATCTTTTCTTAATTTGG - Intergenic
965737055 3:171831862-171831884 GATCACAACTTGTATTAAACGGG + Intergenic
970113328 4:12663474-12663496 GAACAAACCTTGTCTGGACCAGG + Intergenic
970426054 4:15947358-15947380 TAACAAATCTTCTCTTACTCTGG - Intergenic
971790149 4:31159751-31159773 GAATAAATCCTTTCTAAAACAGG - Intergenic
971844354 4:31898760-31898782 GAACAAAGATTATCTTAATCTGG - Intergenic
972572598 4:40324475-40324497 GAACAAATGCTATCTTAGACGGG + Intergenic
974636439 4:64569327-64569349 AAACAAATCTGGCCATAAACAGG + Intergenic
974868651 4:67611066-67611088 GAATAATCTTTGTCTTAAACTGG - Intergenic
975225128 4:71863032-71863054 CACCAAATCTTGCCATAAACTGG + Intergenic
976406985 4:84671138-84671160 GAACAAATTTGTTCTTAAGCTGG + Exonic
977221468 4:94342497-94342519 GGAAAAATCCTGTCTTAATCAGG - Intronic
979104403 4:116665696-116665718 GAGCAAGTCATGTCTTACACGGG + Intergenic
980649758 4:135697028-135697050 GAACAAATCCAGTCCTAATCTGG - Intergenic
981120432 4:141044582-141044604 GAAAAAACCTTGTCTTGGACTGG + Intronic
982084084 4:151816843-151816865 AAATAATTCTTGTCGTAAACTGG - Intergenic
987203164 5:15597938-15597960 AAATAAATCTTGCCTGAAACTGG - Intronic
989120509 5:37999852-37999874 GAACAAGTTTTCTTTTAAACTGG + Intergenic
990920903 5:60965478-60965500 GTACAAAGTTTGACTTAAACAGG - Intronic
991313187 5:65268914-65268936 GAATAAATCTTTTTTTAAAAGGG - Intronic
992121400 5:73596904-73596926 GAACTACTCTTGGCTTCAACAGG - Intergenic
992442344 5:76808066-76808088 GAACAAATTTTGGCTTTAGCTGG + Intergenic
995498968 5:112782159-112782181 GAACAAGTCATGTCTTACATGGG + Intronic
1001232365 5:169999717-169999739 GAACAAATCCATTCTTACACAGG - Intronic
1009379022 6:63006733-63006755 AAATAATTCTTGTCTTAAAATGG + Intergenic
1010034827 6:71312736-71312758 GAAGAAATCTTATCTCAAAAAGG - Intergenic
1010845774 6:80705088-80705110 GAATAAATCCTGGCTTAAATTGG - Intergenic
1011368028 6:86602611-86602633 GAATAATTCTTGTCGTAAAATGG - Intergenic
1012141378 6:95630657-95630679 GAGCAAATCATGTCTTACATGGG - Intergenic
1012749095 6:103134763-103134785 GAATAAATTTTGCCTTAAAAAGG - Intergenic
1013027169 6:106287007-106287029 GAACAAATGTTGTTTTAAGCTGG + Intronic
1013380440 6:109564205-109564227 GAACCAATCTTCTCTTTAAATGG + Exonic
1014291942 6:119568956-119568978 ATACAAATTTTGTCTGAAACAGG + Intergenic
1014531720 6:122566885-122566907 GAACATTTCTTTTTTTAAACTGG + Intronic
1014581242 6:123140018-123140040 CAACAAATTTTGACTTGAACTGG - Intergenic
1014776557 6:125517707-125517729 GAATAAATCTTGATTAAAACAGG + Intergenic
1016152456 6:140759115-140759137 GGACAAATATTGGCTTAAAAAGG - Intergenic
1017936847 6:159013238-159013260 GAACAATGCTGGTCTTAAAGTGG - Intergenic
1018531303 6:164766455-164766477 GAAGAAAGCATGTCTTAGACTGG - Intergenic
1019878017 7:3832823-3832845 GAACTAATTTTGTGCTAAACAGG - Intronic
1020659767 7:10967828-10967850 TAACAGATCTTGTGTTCAACAGG + Intergenic
1022060551 7:26789407-26789429 TAACCAATTTTGTTTTAAACAGG + Intronic
1025168943 7:56738645-56738667 GAACTCATTTTGTCATAAACTGG - Intergenic
1025703445 7:63841249-63841271 GAACTCATTTTGTCATAAACTGG + Intergenic
1026130827 7:67619509-67619531 GCACAAATCCTGGCTTAAAAGGG + Intergenic
1028697990 7:93739239-93739261 GAAAATATCTTCTCATAAACTGG + Intronic
1035837909 8:2775224-2775246 AAATAAATCTTGTCTCAAACTGG + Intergenic
1036191787 8:6677692-6677714 TAACAAATCTTGCTTTACACTGG - Intergenic
1036369199 8:8148158-8148180 GAACCAATCTTTCCTTAAAGAGG - Intergenic
1036881691 8:12517484-12517506 GAACCAATCTTTCCTTAAAGAGG + Intergenic
1037209860 8:16373743-16373765 GAACAAACCTTGTTTTTCACAGG - Intronic
1038562399 8:28591514-28591536 GAACAACTCTTGGTCTAAACAGG - Intergenic
1040647888 8:49420903-49420925 AAACAATTCTTGTCGTAAAATGG + Intergenic
1041775202 8:61515339-61515361 GAATGAATCTTGTCTTACACTGG - Intronic
1043957721 8:86381357-86381379 GAAGAAATATTGTATGAAACAGG - Intronic
1044252376 8:90018937-90018959 GAACAAATTTCTTCTCAAACTGG + Exonic
1045183816 8:99815818-99815840 CAACAAATGTTTTCTTAAATTGG - Intronic
1046565925 8:115901094-115901116 AAACACATCTTGTCTTAACAAGG + Intergenic
1048218171 8:132515795-132515817 GAATTAATCTTGTCTGAAACGGG - Intergenic
1048335877 8:133501877-133501899 GAACAAGCCTTGTCTTAATGAGG + Intronic
1050203230 9:3171089-3171111 GAAGAAATCTTTTTTTAAATTGG - Intergenic
1050221073 9:3390735-3390757 GAACAAGTCATGTCTTACACGGG - Intronic
1052528534 9:29653012-29653034 CAACACATCATGTCTTGAACTGG - Intergenic
1056878671 9:90366221-90366243 GGACAAATATTGTGTTAAAATGG + Intergenic
1059148202 9:111921210-111921232 TACCAAATCTTTTCTAAAACTGG - Intronic
1060062058 9:120469604-120469626 CAATAAATCTTTTTTTAAACTGG - Intronic
1061356296 9:130107830-130107852 GAGAAAATCTTGTCTTAGAAGGG + Intronic
1062072245 9:134562614-134562636 GAACAAAACATGACTTAAGCAGG - Intergenic
1186312819 X:8339012-8339034 GAAATAATCCTGACTTAAACTGG + Intergenic
1187297709 X:18018170-18018192 CAACACATCTTATCTTAGACTGG - Intergenic
1189023101 X:37362853-37362875 GAGCAAATCCTGTGTTAAAATGG + Intronic
1189470060 X:41306968-41306990 AAAGAAATTTTGACTTAAACCGG - Intergenic
1191580346 X:62754107-62754129 CCACAAATCTGGCCTTAAACTGG - Intergenic
1192319142 X:70075275-70075297 GAAAAAATATTTTTTTAAACTGG + Intergenic
1194249735 X:91560332-91560354 GAAGAAATCATGTTTTAAACAGG - Intergenic
1196748843 X:119096440-119096462 GAACTCATCTTTTCTTATACAGG + Intronic
1198596231 X:138238976-138238998 GCCCAAATCTTGGCTTAGACTGG - Intergenic
1199806564 X:151306083-151306105 GAACAAAAATTATCTGAAACTGG - Intergenic
1200568696 Y:4801582-4801604 GAAGAAATCATGTTTTAAAAAGG - Intergenic
1201300139 Y:12498145-12498167 GAACAATTCTTGTGTAAACCTGG - Intergenic
1201422174 Y:13811791-13811813 GAACACCTCTTCTCTTAAAAAGG - Intergenic