ID: 918354220

View in Genome Browser
Species Human (GRCh38)
Location 1:183690980-183691002
Sequence AATCTCAGTGAACCCCAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 2, 1: 0, 2: 7, 3: 59, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918354220_918354222 14 Left 918354220 1:183690980-183691002 CCTGATTGGGGTTCACTGAGATT 0: 2
1: 0
2: 7
3: 59
4: 295
Right 918354222 1:183691017-183691039 TTAAAGTATAAATTAAATTTTGG 0: 1
1: 1
2: 5
3: 126
4: 1447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918354220 Original CRISPR AATCTCAGTGAACCCCAATC AGG (reversed) Intronic
900508782 1:3046203-3046225 AATCTCAATGAACCCCAAGCAGG + Intergenic
901179114 1:7328138-7328160 AAGCCCAGTGAATCCCAGTCAGG - Intronic
902523765 1:17040304-17040326 AAGCTTAGTGAACCCCAACTAGG - Intronic
903740818 1:25557390-25557412 AATCTCTGGGAACCCCAAGTGGG + Intronic
903824336 1:26132107-26132129 AAACTCAGAGAACACCAAGCAGG + Intergenic
904062789 1:27724817-27724839 ACTCTCTCTGAACCCAAATCTGG - Intergenic
904294734 1:29512157-29512179 AAGCTGAGTGAACTCCAAACAGG + Intergenic
905487995 1:38319965-38319987 AAGCTCAGAGAACACCAAGCAGG - Intergenic
905836591 1:41128651-41128673 AAGCTCAATGAACCCCAAGCAGG - Intronic
906697710 1:47835427-47835449 AAGCTCAGTGAACTCCAAGTAGG + Intronic
907618085 1:55945438-55945460 AATCTGGGTGAACCTCTATCAGG + Intergenic
907843603 1:58182285-58182307 AACCTCAGTGAACTCCAAATAGG - Intronic
907897568 1:58706164-58706186 AAACTCAAGGAACCCCAAGCAGG + Intergenic
908312497 1:62899186-62899208 AATTTCTGTGAACCCCAAGAAGG - Intergenic
908376601 1:63548488-63548510 AAGCTCAGAGAACCCCAAGCAGG - Intronic
909031863 1:70550777-70550799 AAGCTCAGAGAACACCAAGCAGG + Intergenic
910926492 1:92403331-92403353 AAACTCAATGAACCCCATGCAGG - Intergenic
911812723 1:102303939-102303961 AATCTCAGAGAACACCAAACAGG + Intergenic
912810432 1:112790129-112790151 AATCTCAGGAAACACCCATCAGG + Intergenic
913114447 1:115683722-115683744 AATCTCCCTAAACCCCAATCTGG - Intronic
916319319 1:163485671-163485693 AATTTCAATGAACCTCAAGCTGG - Intergenic
916603745 1:166320645-166320667 AATCTCACAGAACACCAAGCAGG - Intergenic
916919467 1:169448657-169448679 AAGCTCAGAGAACACCAAGCAGG - Intronic
917568850 1:176242381-176242403 AAGCTCAGAGAACACCAAGCAGG - Intergenic
917768934 1:178254816-178254838 AAGCTCAGTGAACTCCAAGTAGG + Intronic
918274308 1:182937512-182937534 AAGCTCAGAGAACACCAAACAGG - Intronic
918354220 1:183690980-183691002 AATCTCAGTGAACCCCAATCAGG - Intronic
918593901 1:186270403-186270425 AATCTGAGTGAACCCCAAAGAGG + Intergenic
919595905 1:199562381-199562403 AAGCTCAGAGAACACCAAGCAGG + Intergenic
919612967 1:199769231-199769253 AATCTCAATGAACCTCAAGCAGG + Intergenic
920667549 1:207974565-207974587 AAGCTCAGTAAACCACAAACAGG + Intergenic
921874792 1:220182411-220182433 AATCTTATTGAATCACAATCTGG + Intronic
922655624 1:227380336-227380358 AAACTCAGAGAACACCAAGCAGG + Intergenic
923142643 1:231173928-231173950 AAGCTCAGAGAACCCCCAGCAGG - Intronic
923560721 1:235038758-235038780 AAACTCAGAGAACACCAACCTGG + Intergenic
1063757739 10:9033941-9033963 AAGCTCAGAGAACACCAAGCAGG + Intergenic
1064704007 10:18051536-18051558 AAGCTCAGAGAACACCAAGCAGG + Intergenic
1065058516 10:21872801-21872823 AAGCTCAATGAACTCCAAGCAGG + Intronic
1065170888 10:23027636-23027658 AATTTCAGTGAATGCCAATAAGG - Intronic
1065376085 10:25043585-25043607 AAGCTCAGCTAACCCAAATCAGG - Intronic
1066371907 10:34824716-34824738 GATTGCAGTGAGCCCCAATCTGG + Intergenic
1067150165 10:43725694-43725716 AAGTTGAGTGAACCCCAAACAGG + Intergenic
1067185360 10:44022600-44022622 AATCTCAGTTACCCCCACTTTGG - Intergenic
1068457590 10:57277798-57277820 AATCTCAGTGAACTGCAAGTGGG + Intergenic
1068548273 10:58377273-58377295 AAGCTCTGTGAACCTCAAGCAGG - Intergenic
1068790903 10:61030123-61030145 TATCTCTGTGAAGCCCAAACTGG + Intergenic
1068911633 10:62384203-62384225 AACCTGAGTGAAACTCAATCAGG - Intronic
1068972319 10:62973142-62973164 AAACGCTGTGAACCCCAAGCAGG + Intergenic
1069292589 10:66799759-66799781 AATCTCAGTGAGCCCCAACTAGG + Intronic
1069333339 10:67319385-67319407 AATCTCCGGTAACCCCAACCCGG + Intronic
1069816485 10:71198586-71198608 ATGTTCAGTGAACCCCAAGCAGG + Intergenic
1069875397 10:71559926-71559948 TATCTCAGGGAGCCCCATTCTGG - Intronic
1071138075 10:82474765-82474787 AAGCTCAGTGAACTCCAAATAGG + Intronic
1073710798 10:106037981-106038003 AATCCCTGAGAACACCAATCAGG - Intergenic
1074083783 10:110191312-110191334 TAGCTTAGTGAACCCCAAACAGG - Intergenic
1074096947 10:110322089-110322111 AATCTTGGTAAACCCCAAGCAGG + Intergenic
1076545840 10:131245320-131245342 AAACTCAGAGAACCCCAAAGAGG - Intronic
1078404025 11:11053444-11053466 AAGCTGAGTGAACCCCAAACAGG - Intergenic
1078814402 11:14805142-14805164 AAGTGCAGTGAACCCCAAGCAGG + Intronic
1078890443 11:15551620-15551642 AAGCTCAGGGAACACCAAACAGG - Intergenic
1079054160 11:17190981-17191003 AAGTTCAGTGAAGCCCAAGCAGG + Intronic
1079244581 11:18743227-18743249 GAACTCAGAGAAGCCCAATCTGG + Intronic
1079294031 11:19215980-19216002 AAGCTCAGAGAACACCAAGCAGG + Intergenic
1080166735 11:29246111-29246133 AAGCTCAGAGAACACCAAGCAGG + Intergenic
1080947297 11:36988265-36988287 AAGCTCAGAGAACACCAAGCAGG + Intergenic
1084099598 11:66937462-66937484 AAGCTCAGTGAACTCCAATGAGG - Intronic
1084469683 11:69351147-69351169 AAACTCAGAGAACCCCAAACAGG - Intronic
1085997650 11:81939861-81939883 AAACTCAATGAAACCCAAGCAGG + Intergenic
1086752940 11:90521093-90521115 AAGTTCAGTGAGCCCCAATCAGG + Intergenic
1088131003 11:106490855-106490877 AAGCTGAGTGAACCCCAAATAGG - Intergenic
1091165954 11:133476303-133476325 TCTCTCTGTGCACCCCAATCAGG - Intronic
1091594491 12:1867191-1867213 AATCTCAGCAAACCCCAAGCAGG - Intronic
1091859393 12:3766138-3766160 AAGCTCAGAGAACATCAATCAGG + Intergenic
1092176219 12:6409276-6409298 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1093473593 12:19531358-19531380 AAGCTCAGAGAACACCAAGCAGG - Intronic
1093791062 12:23250649-23250671 AATCTCAGATAACCCAAAGCAGG - Intergenic
1093977945 12:25443580-25443602 AAGCTCGGTGAACCCCAAATAGG - Intronic
1095862826 12:46937946-46937968 AAACTCAGAGAACACCAAGCAGG - Intergenic
1096438502 12:51617101-51617123 AAACTCAGTGATCACCAAACAGG - Intronic
1100441864 12:94624682-94624704 AATCTCACTGTAGCCCAAGCTGG - Intronic
1104565753 12:129880015-129880037 AACCTCAGAGAATCCCAAGCAGG + Intronic
1104678947 12:130735682-130735704 AAGCTCAGAGAACACCAAGCGGG - Intergenic
1105560614 13:21487002-21487024 AAGCTCAATGAACTCCAAGCAGG - Intergenic
1106051618 13:26195538-26195560 AATCTCAGAGAACACCAAGCAGG + Intronic
1106093832 13:26624616-26624638 AATCTCAGAGAACCCCAAGCAGG + Intronic
1106306266 13:28513899-28513921 AAACTCAGGGAACACCAAGCAGG - Intergenic
1106395312 13:29374341-29374363 AAGCTCAGTGAACCACAAACAGG + Intronic
1106403868 13:29456503-29456525 AAGCTAAGTGAAACCCAAGCAGG + Intronic
1106500749 13:30326406-30326428 AAATTCAGTGAACTCCAAACAGG + Intergenic
1106761308 13:32870948-32870970 AAGCTTAGTAGACCCCAATCAGG + Intergenic
1108322921 13:49304445-49304467 AATCTCAGTGACCGCCAAATCGG + Intergenic
1108995226 13:56723121-56723143 AAACTCAGTGAACCTCAAGCAGG + Intergenic
1109987158 13:70002604-70002626 AATCTCAGTGAACCCCAATCAGG + Intronic
1113704719 13:112420713-112420735 TATCTCAGAGAACACCAAGCAGG + Intronic
1113837452 13:113337786-113337808 GACCTCAGGGAACCCCACTCGGG + Intronic
1115482647 14:33876718-33876740 AAGCTCAGTGAACTCCAACTAGG + Intergenic
1115668664 14:35583601-35583623 AAGCTCAGTGAACACCACGCAGG + Intronic
1117231815 14:53727309-53727331 AAGCTCAGAGAACCCCAAATAGG + Intergenic
1117462642 14:55960633-55960655 AAACTCAATGATCCCCAAACAGG + Intergenic
1117762392 14:59043780-59043802 AAACTCAATGAACCACAAGCAGG - Intergenic
1119109028 14:71954168-71954190 AAAGTCAGTAAACACCAATCAGG - Intronic
1119727325 14:76929467-76929489 TATCTCATTAAAACCCAATCAGG + Intergenic
1119789894 14:77340781-77340803 AAATGCAGTGAAACCCAATCAGG - Exonic
1120307665 14:82790910-82790932 AACCTGAGTGAACCCATATCAGG + Intergenic
1120322103 14:82976731-82976753 AATCTCAGTGATCCCCAGGCTGG + Intergenic
1122669932 14:103363423-103363445 AAGCTCAGTGAACTCCAAGTAGG - Intergenic
1123030937 14:105450703-105450725 AATCACAGTGACCCCCAAGGTGG - Intronic
1202904925 14_GL000194v1_random:64129-64151 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1123784822 15:23660589-23660611 ACGCTCAGTGAATCCCAGTCAGG - Intergenic
1124839520 15:33228817-33228839 AAACTCATTGAACCCCAAGAGGG + Intergenic
1125372035 15:38988199-38988221 AAACTCAGTGAAAGCAAATCAGG - Intergenic
1126017658 15:44367982-44368004 AACCTCAGAGAACCCTAAGCAGG - Intronic
1127302633 15:57671380-57671402 AAGCTCAGTAAACCCCAAACAGG - Intronic
1128864285 15:71102218-71102240 AAACTCAGTGAATCCCAAACAGG - Intronic
1132009589 15:98264561-98264583 AATCTCAGAGAACCACAAGCAGG + Intergenic
1132346192 15:101110575-101110597 AATCTCAGGGAAGGCCCATCGGG + Intergenic
1132879342 16:2154871-2154893 AACCTAAGTAAACCTCAATCCGG - Intergenic
1133570085 16:7032396-7032418 GATCCCAGTGCACTCCAATCTGG + Intronic
1133871647 16:9693900-9693922 AAGCTTAGTGAACCCCAAACGGG - Intergenic
1135110515 16:19687257-19687279 AATCAAAGTGAACTCCAACCTGG + Intronic
1136015124 16:27392753-27392775 AAGCTCAGTGAACTCCAACTAGG + Intergenic
1137308968 16:47234552-47234574 AAGCTCAGAGAACACCAAGCAGG + Intronic
1138339074 16:56276830-56276852 AATCTCAGTGATCCTCCCTCTGG + Intronic
1139232570 16:65298515-65298537 AAGCTCAGAGAACATCAATCAGG + Intergenic
1139294862 16:65891752-65891774 AAGCTGAGTGAATCCCAAACAGG - Intergenic
1140239082 16:73184746-73184768 AATGTCAGTGAAACCCTATTTGG + Intergenic
1141024259 16:80529123-80529145 AATCTCATTTCACCCCATTCTGG - Intergenic
1141875165 16:86819288-86819310 AATCGCCGTGAACCCCAGTGTGG + Intergenic
1141978945 16:87537610-87537632 AATGTCAGAGAACCCCAGGCTGG - Intergenic
1142097558 16:88250474-88250496 AATCTCAGTGAAGCCCGGGCAGG - Intergenic
1143309415 17:5976116-5976138 AATTTCACTGTACCCCAACCAGG - Intronic
1143532965 17:7516504-7516526 AATCTCAGGGAAACTCAAACGGG - Intergenic
1144114346 17:12072172-12072194 ACTCTTAGTGAACCCTAATTTGG - Intronic
1148799573 17:50214840-50214862 ACCCTCAAAGAACCCCAATCTGG - Intergenic
1151357458 17:73568754-73568776 AGGCTCAATGAACCCCAAGCAGG + Intronic
1152771673 17:82173616-82173638 AAGCTCAGTGAACCCTAAGCAGG + Intronic
1156272434 18:35548351-35548373 AAGCTCAGAGAACACCAAACAGG + Intergenic
1156842982 18:41631465-41631487 AATCTATGTGAATCCCAAGCAGG + Intergenic
1157632299 18:49110697-49110719 AAGCCCAGAGAACCCCAATCAGG - Intronic
1157767288 18:50309321-50309343 AAGCTCAATGAACCCCAAACGGG - Intergenic
1159907453 18:74108702-74108724 AAGCTCAGAGAACACCAAACAGG + Intronic
1160498550 18:79389686-79389708 AATCTCAATGAACTCCAACTGGG + Intergenic
1160611328 18:80089084-80089106 AATCTCAATGAACTCCAAACAGG - Intronic
1162946782 19:14048824-14048846 AATCCCAGAAAACCCCAATAGGG - Intronic
1164815338 19:31195239-31195261 AAGCTCAGAGAACACCAATCAGG + Intergenic
1167069897 19:47215160-47215182 AGGCTCAGTGAATCCCAAACGGG + Intergenic
926042698 2:9687070-9687092 AATCACAGTGAATCCTAAACTGG + Intergenic
926709642 2:15868253-15868275 AAGCCCAGTGAATCCCAAGCAGG + Intergenic
929359770 2:41073584-41073606 AAGCTGAGTAAACCCCAAACAGG - Intergenic
929839175 2:45438876-45438898 AAGCTCAGTGAACCCTAAGAAGG + Intronic
930155128 2:48099053-48099075 AGTTTCAGTGAAACCCAAGCAGG + Intergenic
930338574 2:50083020-50083042 AAGCTCAGTGAAACCCAAACAGG - Intronic
930531953 2:52599279-52599301 TATCTCAGTGAAACTCATTCAGG - Intergenic
930990942 2:57653780-57653802 AAGCTCAGTGAACTCCAAGTAGG - Intergenic
931490071 2:62736005-62736027 AACCTCAGAGAACACCAAGCAGG - Intronic
932824108 2:74924697-74924719 AGTCTCAGGGAGCCCCATTCAGG - Intergenic
934501716 2:94866328-94866350 AAGCTCAGAGAACACCAAGCAGG + Intergenic
934565235 2:95335615-95335637 AAGCTCAATGAACCCCAGGCAGG - Intronic
934908105 2:98223489-98223511 AATCTGAGTAAACTCCAAACAGG + Intronic
934988751 2:98905944-98905966 AATTTCAGGGAACCCCTAGCAGG - Intronic
935140303 2:100347307-100347329 AAGCTCAGTGAACTCCAAGAGGG - Intergenic
935393775 2:102583789-102583811 AATCTCAGTGAAACTCAAGCAGG - Intergenic
936274073 2:111077907-111077929 AAGTTTAGTGAACCCCAAACAGG - Intronic
936793372 2:116177882-116177904 AATCTCAGAGGACACCAAGCAGG + Intergenic
937563339 2:123252757-123252779 AAACTCTGTGAACTCCAATTAGG - Intergenic
937598016 2:123693360-123693382 AAGCTCAGAGAACACCAAGCAGG + Intergenic
938633716 2:133198292-133198314 AAACTCAGTGAACCCCAAACAGG + Intronic
939751647 2:146054587-146054609 AATCTCAGAGAACTCCATTCAGG + Intergenic
939980853 2:148779042-148779064 AAACTCAGAAAATCCCAATCTGG - Intronic
940845406 2:158636512-158636534 AATCTCAGTGAACCCTAAGCAGG - Intronic
942157117 2:173141712-173141734 AAGCTCAGAAAACCCCAAGCAGG + Intronic
943174869 2:184458053-184458075 AAGCTCAGAGAACACCAACCAGG + Intergenic
943341396 2:186686197-186686219 AAGCTCAGTGAACCCTAAACAGG + Intergenic
944433029 2:199657103-199657125 AACCTCAGAGAACACCAAGCAGG - Intergenic
945899427 2:215521170-215521192 ACTCTCACAGAACCCCCATCAGG + Intergenic
947300757 2:228686038-228686060 AAACTCAGAGAACACCAAGCAGG + Intergenic
947678127 2:232003943-232003965 AAACTGAGTGAACCCCAAAAAGG - Intronic
948303417 2:236927284-236927306 AAACTCAGAGAATCCCAAGCAGG - Intergenic
948416929 2:237814468-237814490 TATCTCAGTAAATCCCAATAGGG + Intronic
1169156623 20:3336202-3336224 AAGCTGAGTGAACCTCAAACAGG - Intronic
1169511052 20:6264206-6264228 AATTTCAGTTAGCCCCAATTTGG + Intergenic
1170655638 20:18285492-18285514 AATCTCAATAAACCTCAAACTGG + Intergenic
1170731234 20:18977320-18977342 AGGCTCTGTGTACCCCAATCAGG - Intergenic
1170763233 20:19270050-19270072 AATCCCAGGGACTCCCAATCAGG - Intronic
1173535555 20:43809602-43809624 AAGCTCAGTGAACTCCAAGTAGG - Intergenic
1175143223 20:56875958-56875980 AAGATCAGTGAACCCCAAGAAGG - Intergenic
1175437547 20:58964648-58964670 AAACTCAGAGAACACCAAACAGG + Intergenic
1175587630 20:60157302-60157324 AATCTCAGCAAACCCCAAACAGG - Intergenic
1175673488 20:60927063-60927085 AAACCCAGTGAAACCCAAGCTGG + Intergenic
1176366497 21:6036059-6036081 AACCTCAGTGAGCCCCGAGCAGG - Intergenic
1176624289 21:9078887-9078909 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1177722226 21:24922410-24922432 AATCTCAGTGAACACTAAGCAGG - Intergenic
1177829136 21:26117359-26117381 AATCTGAGTGAACCCCTTTCAGG + Intronic
1179096133 21:38316208-38316230 AAACTCAGAGGACCCCAAACAGG + Intergenic
1179390350 21:40983326-40983348 AAACTCAGAGAACACCAAGCAGG + Intergenic
1179757020 21:43502486-43502508 AACCTCAGTGAGCCCCGAGCAGG + Intergenic
1179895898 21:44363152-44363174 AATCTGAGTGAACACCAGACAGG - Intronic
1180139621 21:45885384-45885406 AAGCTGAGTAAACCCCAAACAGG - Intronic
1181485494 22:23228851-23228873 AAATGCAGTGAACCCCAAACAGG - Intronic
1184056732 22:42057045-42057067 AAGCTCAGTGAACTCCAAGTAGG - Intronic
1184638161 22:45852398-45852420 AATCCTAGTGAACCCCAAGAAGG + Intergenic
1185264511 22:49893307-49893329 AATATCTTTGAACCCCAATGAGG + Intergenic
949470526 3:4391275-4391297 AAGCTCAGTGAACCTCAATTAGG - Intronic
949655292 3:6211048-6211070 AATCTCAGTGAAAACCAAGCAGG + Intergenic
950807926 3:15624227-15624249 AAGCTCAGAGAACACCAATCAGG - Intronic
952554565 3:34517590-34517612 ATGCTCAGTAAACCCCAATTAGG + Intergenic
952686558 3:36156148-36156170 AATCTCAGAGAACATCAAGCAGG + Intergenic
953060612 3:39425849-39425871 AACCTCAGTCCACCCCAAGCTGG + Intergenic
953586515 3:44206138-44206160 AATCTCAGTGAATTCCATTTTGG - Intergenic
954607302 3:51922471-51922493 AAACTCAGAGAACACCAAACAGG + Intergenic
954762532 3:52886915-52886937 AATATCAGACAAACCCAATCTGG + Intronic
955081400 3:55660810-55660832 AACCTCTGTGAGCCTCAATCAGG + Intronic
955493349 3:59505349-59505371 AATCTTAGTGATACCCAAGCAGG - Intergenic
959204388 3:103285962-103285984 AAGCTCAGTGAACTCCAAAGAGG - Intergenic
959830137 3:110851478-110851500 AAACTCAGCAAACCCCAAGCAGG - Intergenic
959886098 3:111501941-111501963 AATCTCACTGAACCCTAAAGAGG + Intronic
960113377 3:113867784-113867806 AAACTCAATGAATCCCAAGCAGG - Intronic
960797260 3:121500716-121500738 AAACTCAGTGAACTCCAAGCAGG + Intronic
960981272 3:123229133-123229155 AAGCTCAGTGAACTCCAAATGGG + Intronic
961733207 3:128983089-128983111 GATCTCTGTGAAGCCCAATAAGG + Intronic
963096230 3:141544243-141544265 AAGCTGAGCGAACCCCAAACAGG - Intronic
963279907 3:143373963-143373985 AAATTCAGTGAACCCAAATTAGG + Intronic
964576267 3:158172210-158172232 AAACTCAGTGAATCCCAAACAGG + Intronic
965724950 3:171705301-171705323 AAGCTCAGAGAACCCCAAACAGG + Intronic
967548151 3:190757198-190757220 AATCTCAGATAACACCAATCAGG - Intergenic
967662593 3:192131484-192131506 AAGCTCAGTGAATGCCAAACAGG + Intergenic
968439530 4:615868-615890 AAGCTCAGAGAACACCAAGCAGG - Intergenic
969629254 4:8325975-8325997 AAGCTCAGTGAACCATAATGGGG + Intergenic
970186916 4:13465289-13465311 AATCTCAGAGAACACCAATTTGG + Intronic
972126410 4:35772171-35772193 AATCTCAGAGTCCCCCACTCTGG + Intergenic
972444624 4:39131593-39131615 AATCTAAGTGAAAGCCAACCAGG + Intergenic
972449109 4:39179313-39179335 AAGCTCAGAGAACTCCAAACAGG - Intergenic
972520939 4:39855978-39856000 AAACTCAGTGATCTCCAAGCAGG + Intronic
973587044 4:52403661-52403683 AAGCTCAGTGAACCCCAAACAGG - Intergenic
974477111 4:62397093-62397115 AAGCTCAGTAAAGCCCAAACAGG + Intergenic
974614017 4:64257336-64257358 AAGCTCAATGAACTCCAAACAGG - Intergenic
977831508 4:101599353-101599375 AATCTAAGTGATGCCCAATAGGG - Intronic
978173833 4:105706299-105706321 GATCTCAGTGCACTCCAACCTGG - Intronic
978719624 4:111893080-111893102 AATCTCAGCAAACCCCAAAAAGG - Intergenic
980189897 4:129510882-129510904 TATCTCAGTGGATGCCAATCTGG + Intergenic
980770356 4:137364159-137364181 AAGCTCAGAGAACACCAAGCAGG + Intergenic
981266139 4:142785815-142785837 AAGCTCAGAGAACACCAAGCAGG + Intronic
981838033 4:149078317-149078339 CATCTCAGTGAATCCATATCAGG + Intergenic
981849132 4:149207551-149207573 AATGTCAGAGAAGGCCAATCTGG - Intergenic
982029358 4:151284066-151284088 AAACTCAGTGAACCCCAAATAGG - Intronic
985698250 5:1354899-1354921 AAGCTCAGTAAGCCCCAAGCAGG - Intergenic
985766139 5:1780474-1780496 GATCACACTGAACCCCAAACAGG + Intergenic
986277319 5:6288171-6288193 AAGCTCAGAGAACACCAAGCAGG + Intergenic
986941266 5:12952869-12952891 AATCTCAGAGGACTCCAAGCAGG + Intergenic
987920878 5:24278797-24278819 AAGCTCAGTGAACTCCAAGTCGG - Intergenic
989554373 5:42775218-42775240 AAGCTCAGTGAACACCAAGCAGG + Intronic
991007851 5:61847535-61847557 AAACTCAGAGAACACCAAGCAGG + Intergenic
992033514 5:72748144-72748166 AAGCTCAGAGAACACCAAGCAGG + Intergenic
992655361 5:78904447-78904469 AAGCTCAGTGAAATCCAAACAGG - Intronic
992841007 5:80694967-80694989 AAGCTGAGTGAACCCCAAAAAGG - Intronic
994702811 5:103158469-103158491 AATCTAAGTAAACCACAACCAGG - Exonic
994841068 5:104925770-104925792 AAACAAAGTGAACCCCAAGCAGG + Intergenic
995081398 5:108054546-108054568 AACCTCAGTTAACCCCACTGTGG - Intronic
995311587 5:110718591-110718613 AAGCTCAGTGAACTCCAATTAGG - Intronic
996027813 5:118668353-118668375 AATCTCAGAGAACATCAAGCAGG - Intergenic
996971022 5:129367896-129367918 AAGCTCAGTGAACTCCAAGTGGG + Intergenic
997053361 5:130409694-130409716 AATCTCAATGAACTCCAACTGGG + Intergenic
999689626 5:154135429-154135451 AATCTCAGTGAATTTCATTCAGG - Intronic
1001478430 5:172067837-172067859 AAGCTCAATGAAACCCAAACAGG + Intronic
1002084613 5:176765600-176765622 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1002609451 5:180405074-180405096 AAACTCAGGGAACAGCAATCGGG + Intergenic
1003993339 6:11511076-11511098 AAACCCAGTGAAGCCCAAGCAGG + Intergenic
1005072059 6:21871043-21871065 AGTCTCAGTGCACCTCAAACCGG - Intergenic
1005699144 6:28382553-28382575 AATCACTCTGAACCCCAAGCTGG - Exonic
1006528568 6:34629657-34629679 AAGCTCAGAGAACACCAAACAGG - Intronic
1006880798 6:37337699-37337721 AAAATTAGTGAACCCCAAACAGG - Intergenic
1008688104 6:53946239-53946261 ACTCTCTGTGAACCACATTCAGG - Intronic
1008851841 6:56031808-56031830 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1008883094 6:56401755-56401777 AAGCTCAATGAACCCCAAGAAGG - Intergenic
1009467521 6:63990556-63990578 GTTCTCAGTGATCCCCAATGTGG - Intronic
1009528185 6:64774683-64774705 AGTCTCAGTCAGCCCTAATCTGG + Intronic
1009533839 6:64855201-64855223 AAGCTCAGAGAACCTCAATCAGG - Intronic
1009897321 6:69769025-69769047 AAGCTCAGTGAAGCCCAAGTAGG - Intronic
1010962941 6:82167554-82167576 AAAATCAATGAACCCCAAGCTGG + Intergenic
1012444851 6:99297055-99297077 AATCACAGTGAACTCAAGTCTGG - Intronic
1012914917 6:105159733-105159755 GGTCTCAGTGAATCCCACTCAGG + Exonic
1016310572 6:142728997-142729019 CATATCAGTAAACCCCAATCAGG + Intergenic
1016608008 6:145956313-145956335 AAGCTCAATGAAACCCAATCAGG + Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018722640 6:166584624-166584646 AAACTCAGTATACCCCAATCTGG + Intronic
1019945315 7:4324104-4324126 AAGCTAAGTGAGCCCCAAACAGG - Intergenic
1020385031 7:7591752-7591774 AAGCTCAGTGAACCACAAACAGG - Intronic
1020752367 7:12158353-12158375 AAGATGAGTGAACCCCAAACAGG + Intergenic
1021331633 7:19345600-19345622 AATCTCAGAGAACACCAAGCAGG - Intergenic
1021734520 7:23629970-23629992 AAGCTGAGCAAACCCCAATCGGG + Intronic
1021846807 7:24771044-24771066 AATATCAGAGAACACCAAGCAGG + Intergenic
1024470520 7:49765244-49765266 AAACTCAGAGAACCCCAAGCAGG + Intergenic
1024829295 7:53429559-53429581 AAACTCAGTGAACCCTAAGTAGG + Intergenic
1025965438 7:66265648-66265670 AAGCTCAGTAAACTCCAAGCAGG + Intronic
1026712045 7:72750558-72750580 AATTTGAGGGAACCCCAAACAGG - Intronic
1027345185 7:77252326-77252348 AAGCTCAATGAGCCCCAAACAGG + Intronic
1028942409 7:96537778-96537800 AAGCTCAGAGAACACCAACCAGG - Intronic
1030227905 7:107172369-107172391 AAACTCAGTGAACCACATTATGG + Intronic
1030407412 7:109131829-109131851 AAGCTCAGAAAACCCCAAACAGG + Intergenic
1031990484 7:128195181-128195203 AAACTCAGGGAACTCCAACCAGG - Intergenic
1032053694 7:128667323-128667345 AAGCTCAATAAACCCCAAGCAGG - Intergenic
1032570612 7:132992263-132992285 AGCCTCAGTGCACCCCATTCTGG + Intronic
1033057401 7:138071251-138071273 AAGCTCAGTGAACTCCAAGAAGG + Intronic
1033858061 7:145589276-145589298 AATCTCACTGAATCCAATTCTGG + Intergenic
1033926545 7:146469179-146469201 ACTCTCAGGGAACCCCAAAGGGG - Intronic
1034375967 7:150644456-150644478 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1035917692 8:3643180-3643202 AAGCTCAGGGAAAACCAATCAGG + Intronic
1037230971 8:16658105-16658127 AAGCTCAGAGAACACCAAACAGG + Intergenic
1037406481 8:18547789-18547811 AATCTCAAAGACCTCCAATCAGG - Intronic
1037657635 8:20899265-20899287 AATCTCAGAAAACCTCAAGCAGG - Intergenic
1038159136 8:25020128-25020150 AGTCTCAGTCAATCCCAAGCAGG - Intergenic
1038323349 8:26549562-26549584 AAGCTCAGAGAACACCAAGCAGG + Intronic
1040525629 8:48222057-48222079 AATCTCAGTGAACTCCAAGCAGG - Intergenic
1040758716 8:50812087-50812109 AGTCTGAGTGAACTCCAAACAGG - Intergenic
1042113766 8:65409384-65409406 AATCTCACTGAACATCAAGCTGG + Intergenic
1042824976 8:72971095-72971117 AATCTCAGCAAACACCAAGCAGG + Intergenic
1043028300 8:75099558-75099580 ATTCTCAGTGACACCCTATCTGG - Intergenic
1043292598 8:78621697-78621719 AATCTCAGAGAACACCAGGCAGG - Intergenic
1044376283 8:91475624-91475646 AATCTCAAAGAACCCCTAGCAGG + Intergenic
1045131114 8:99154180-99154202 AAACTCAGAGAACACCAAGCAGG - Intronic
1045229854 8:100293597-100293619 AAGTTCAGTGAACCCCAAGCAGG - Intronic
1045594897 8:103642907-103642929 AAGCTCAGAGAACACCAAACAGG - Intronic
1046241787 8:111506194-111506216 AAGCTCAATGAACCCCAAACAGG + Intergenic
1048257156 8:132913664-132913686 AACCCAAGTGAACCTCAATCAGG - Intronic
1048393956 8:133995343-133995365 AATATCAGAGAACACCAAACAGG - Intergenic
1048396364 8:134017935-134017957 AATCTCAGAGAAACCAAAGCGGG + Intergenic
1048966873 8:139621347-139621369 AAATTCAGTGAACCCCAGGCAGG + Intronic
1052654946 9:31346469-31346491 AAGCTCATTAAACCCCAAACAGG - Intergenic
1052983715 9:34469058-34469080 AAACTCAGTGAGCCCCAAGCAGG + Intronic
1053554720 9:39123549-39123571 AATCTCAGCAAACACCAAGCAGG + Intronic
1054109105 9:61087459-61087481 AATCTCAGCAAACACCAAGCAGG + Intergenic
1054611752 9:67243666-67243688 AATCTCAGCAAACACCAAGCAGG - Intergenic
1055581169 9:77708197-77708219 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1055606488 9:77976069-77976091 AATGTCAGTGAACCTCAAACTGG - Intronic
1055894482 9:81159498-81159520 CATGCCACTGAACCCCAATCTGG - Intergenic
1056345113 9:85685262-85685284 AATCTCAGTGAATTCCAAGCAGG + Intronic
1056428188 9:86499993-86500015 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1057341713 9:94208155-94208177 ATGCTCTGTGAACCCCAAGCAGG - Intergenic
1057531383 9:95849573-95849595 AAGCTCAGAGAACACCAAGCAGG + Intergenic
1057873742 9:98737068-98737090 AATCTCTGTGAAGACAAATCCGG - Intronic
1058788775 9:108419617-108419639 AAACCCAGAGAACACCAATCAGG + Intergenic
1059266511 9:113037025-113037047 AATCTCAGTGAATTCCAATCAGG - Intergenic
1060615433 9:125008847-125008869 AAACTCTGTGAACCTCAAGCAGG + Intronic
1061388335 9:130303435-130303457 AATCACACTGACCCCCACTCAGG - Intronic
1061447568 9:130649606-130649628 AAACTCAGAGAACACCAATCTGG - Intergenic
1186973109 X:14871534-14871556 AACCTCAATGAACACCAATAGGG + Intronic
1187595544 X:20767985-20768007 GATCTCAGTGAAATCCAAACAGG + Intergenic
1189504246 X:41594966-41594988 AATGTCAGAGAACCCGAGTCTGG - Intronic
1190133370 X:47771518-47771540 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1190902406 X:54690297-54690319 AAGCTCAGAGAACACCAAGCAGG - Intergenic
1190932943 X:54965184-54965206 AAGCTCAGAGAACACCAACCAGG + Intronic
1192956414 X:76075398-76075420 AAACTCAATGAACCCCAAGTAGG + Intergenic
1195630200 X:107047764-107047786 AATCTCAGTAAACCCCAAGTAGG - Intergenic
1195991633 X:110688554-110688576 AATCTCAGTCAACCAAAAGCAGG + Intronic
1196354159 X:114770207-114770229 AAGCTCAATGAACACCAATTAGG - Intronic
1197832447 X:130658532-130658554 GAGCTCAGTGAACCCCAAGCAGG + Intronic
1197968213 X:132087565-132087587 AATCACATTGAAACCCAATAAGG + Intronic
1198444748 X:136701267-136701289 TATCTCAGAGAACACCAAGCAGG + Intronic
1198538541 X:137611553-137611575 AATCTCAGTGAATCCCACCCAGG + Intergenic
1199174346 X:144767426-144767448 AAGCCCAGTGAACCCCAGGCAGG - Intergenic
1200341535 X:155402210-155402232 AATTTCAATGAATCTCAATCAGG + Intergenic
1200371934 X:155736692-155736714 AAGCTCAGTGAATACCAAGCAGG - Intergenic
1201160794 Y:11164303-11164325 AAGCTCAGAGAACACCAAGCAGG - Intergenic